Literature DB >> 35132333

HD-13 Induces Swine Pneumonia Progression via Activation of TLR9.

Jing Liu1, Jiayi Xu2, Honglei Zhou1, Lihua Wang1.   

Abstract

Swine pneumonia commonly known as swine pasteurellosis is an infectious disease of swine caused by Pasteurella multocida infection. It has been reported that Toll-like receptors (TLRs) play a vital role in swine pneumonia progression. However, the underlying mechanism has not been elucidated. This research was aimed at investigating the molecular mechanism by which TLR9 regulates swine pneumonia progression. Our findings illustrated that the HD-13 strain of Pasteurella multocida D (HD-13) accelerated TLR9 expression in porcine alveolar macrophage 3D4/21 cells; HD-13 activated the inflammatory response via accelerating TLR9 expression. Mechanistically, HD-13 activated mitogen-activated protein kinase (MAPK) and nuclear factor kB (NF-κB) signals. In conclusion, HD-13 may activate MAPK and NF-κB pathways via accelerating TLR9 expression, thereby accelerating the inflammatory response in the progression of swine pneumonia. TLR9 may serve as a novel therapeutic target for swine pneumonia. Our research may provide a theoretical basis for the prevention and treatment of swine pneumonia.
Copyright © 2022 Jing Liu et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35132333      PMCID: PMC8817872          DOI: 10.1155/2022/8660752

Source DB:  PubMed          Journal:  Comput Math Methods Med        ISSN: 1748-670X            Impact factor:   2.238


1. Introduction

Swine pneumonia, commonly known as swine pasteurellosis, is a contagious disease induced by Pasteurella multocida infection which is divided into chronic type, acute type, and most acute type according to clinical manifestations and the course of the disease [1]. What is more, swine pneumonia has a strong infectivity, and it also causes other infectious diseases, which seriously affects economic benefits [2]. At present, the prevention of swine pneumonia mainly depends on antibiotics, inactivated vaccines, attenuated vaccines, subunit vaccines, etc. [3]. However, no obvious therapeutic effect has been achieved, due to the emergence of drug resistance and side effects [4]. Therefore, it is urgent to elucidate the specific pathogenesis of swine pneumonitis for seeking effective therapeutic drugs. Pasteurella multocida, which is an important zoonotic pathogenic bacterium to infect a variety of livestock, such as poultry and wild animals, results in causing pasteurellosis [5]. Pig is one of the susceptible animals of Pasteurella multocida, which mainly causes swine lung disease [6]. Pasteurella multocida is divided into five types, A, B, D, E, and F, depending on the serotype of the capsular antigen [7]. It has been reported that the HD-13 strain of Pasteurella multocida D (HD-13) has strong infectivity [8]. In this paper, we aimed to study the specific mechanism of swine pneumonia induced by HD-13. A Toll-like receptor (TLR) is a transmembrane protein encoded by the Toll gene, which is one of cell transmembrane receptors and pathogen pattern recognition receptors (PRRs) in the innate immune system [9]. Prompt commencement of an inflammatory response is accomplished with the help of unique and conserved PRRs present on the surface of myeloid cells, lung epithelial cells, and lymphoid tissue. PRRs comprise TLRs, RIG-I-like receptors (RLRs), and NOD-like receptors (NLRs). TLRs activate viral responses by recognizing pathogenic microorganisms such as viruses, bacteria, and mycoplasmas to release inflammatory cytokines [10]. TLRs are important constituents of the innate immune system, which were applied to recognize and defend against foreign pathogens. Toll is a gene in fruit fly and toll-like proteins which was discovered in animals and also was named as TLRs. TLRs are conserved and approximately comprised 10 functional TLRs (TLR1 to TLR10) in humans and 12 (TLR1 to TLR9, TLR11 to TLR13) in mice. TLR1, TLR2, TLR4, TLR5, TLR6, and TLR10 are expressed on the human cell surface, while TLR3, TLR7, TLR8, and TLR9 are expressed on the membrane of intracellular vesicles [9, 10]. TLR9 is a member of the TLR family whose function is triggered by the unmethylated CpG motif of microbial DNA, which initiates the immune response by inducing cytokines and many molecules [11]. It has been reported that various hosts recognize lipopolysaccharides in the cell membrane structure through TLR9 and activate downstream mitogen-activated protein kinase (MAPK) and nuclear transcription factor-κB (NF-κB) pathways mediated by MyD88 to promote the MAPK protein phosphorylation, and NF-κB enters the nucleus, further releasing cellular inflammatory factors [12]. Namely, TLR9 is triggered by lipopolysaccharide in the same way that it is by CpG motifs, resulting in cellular inflammatory factor release. Therefore, it is speculated that TLR9, MAPK, and NF-κB pathways may play a vital role in the inflammatory response of swine pneumonia. However, the underlying mechanism remains unclear. In this research, we aimed to explore TLR9 roles in swine pneumonia progression, and the underlying mechanism was illuminated by evaluating the levels of TLR9 downstream effectors, including myeloid differentiation factor 88 (MyD88), Toll-like receptor-associated activator of interferon (TRIF), and tumor necrosis factor receptor-associated factor 6 (TRAF6), and the inflammatory cytokines, including interleukin- (IL-) 1β, IL-6, IL-12, and tumor necrosis factor α (TNF-α). Our findings may provide a theoretical basis for the prevention and treatment of swine pneumonia.

2. Materials and Methods

2.1. Piglet and Tissue Specimen

4-week-old Southern Yunnan small ear pigs (n = 60, 12 per group) used in this study were given by China Agricultural University (Beijing, China). Piglets were raised in houses with metal fences and concrete floors, with an area of 1.5 to 3.0 m2 per strip, and the fence should be at least 0.6 m high, providing dry ground for each animal to lie down and fully extend its body. The ground and playground are cement floors with obvious slopes to prevent sewage from being trapped or in the pouring circle. The passageway and the ground have an effective drainage system and are equipped with leaking fecal and urine floors and automatic drinking fountains. Pig manure was treated with “dry treatment”; that is, the feces were separated from the sewage, the pig manure was accumulated and fermented, and the sewage was discharged to the treatment area far away from the pig house through closure and sewage ditches. The suitable temperature for raising pigs is 18-25°C, and the relative temperature is 40%-60%. The pigsty requires warm winter, no wind, cool and ventilated summer, and shade. It is required to be ventilated at least 20 times per hour in order to effectively remove moisture and heat from the house and give it no less than 10 h of light every day. Hay, sawn wood, chuanhua, or sawdust was selected as bedding materials for pigsty. The bedding should be changed once a day. Drinking water was provided continuously, and the pigs were provided fodder (Zhong liang, COFCO, Beijing, China) every day. At the end of the experiment, the pigs were killed by neck detachment. Spleen and lung tissues were cut and frozen at 80°C for functional experiment. The animal experiments involved in this paper were carried out in accordance with the Guidelines for the Care and Use of Laboratory Animals issued by the National Institutes of Health (NIH).

2.2. Pasteurella multocida, Antibodies, and Reagents

HD-13 was provided by China Agricultural University (Beijing, China), which was provided ready to use. The HD-13 (104 CFU/mL) strain was infected by nasal drip and respiratory tract infection, and the bacterial solution was dropped into the nasal cavity of pigs. Reagents, including PD98059, which served as the p-ERK/ERK signaling pathway inhibitor, SB203580 which served as the p-p38/p38 signaling pathway inhibitor, SP600125 which served as the p-JNK/JNK signaling pathway inhibitor, and BAY11-7082 which served as the NF-κB signaling pathway inhibitor, were purchased from Solarbio (Beijing, China). Antibodies, including TLR9, MyD88, TRIF, TRAF6, p-ERK, ERK, p-p38, p38, p-JNK, JNK, p-p65, p65, p-IKKα, IKKα, and β-actin, were provided by Abcam (Cambridge, UK, 1 : 1000, monoclonal, species of mice).

2.3. Cell Culture

Primary 3D4/21 cells obtained from Kunming Medical University (Kunming, Yunnan) were cultured in Dulbecco's modified Eagle's medium (DMEM, Roche, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS, Roche, Basel, Switzerland) and 1% penicillin-streptomycin solution (Solarbio, Beijing, China) in a humid incubator containing 5% CO2 at 37°C.

2.4. Cell Transfection and Infection

Sangon Biotech (Shanghai, China) synthesizes the random sequences of TLR9 siRNA and the negative controls (Scra siRNA). When the cell confluency reached about 80%, TLR9 siRNA or Scra siRNA was transfected into 3D4/21 cells by using the Lipofectamine™ 3000 Transfection Reagent (Takara, Liaoning, China). Taken briefly, 3D4/21 cells were randomly divided into 4 groups: Scra group—cells were transfected with Scra siRNA (2 μg) for 48 h, which serves as a negative control; TLR9 siRNA group—cells were transfected with TLR9 siRNA (2 μg) for TLR9 silencing for 48 h; HD-13+Scra group—cells were infected with HD-13 and transfected with Scra siRNA (2 μg) for 48 h; and HD-13+TLR9 siRNA group—cells were infected with HD-13 and transfected with TLR9 siRNA for TLR9 silencing for 48 h. At 48 h posttreatment, 1 × 106 3D4/21 cells were applied to subsequent experiments in each group. Furthermore, in vivo, plasmids (1 × 1012 PFU/mL) were injected into piglets via tail vein injection.

2.5. RT-qPCR

The TRIzol reagent (Takara, Liaoning, China) was used to extract the total RNA from 3D4/21 cells with transfection of corresponding plasmids or piglet tissues. The M-MLV Reverse Transcriptase (RNase H) kit (Takara, Liaoning, China) was employed to synthesize cDNA. RT-qPCR was performed as previously described [13]. Primers used in RT-qPCR are shown in Table 1.
Table 1

Primer sequences.

Primer name(5′-3′) primer sequences
F-TLR1GCCTGGATGTGGTTCCTTTA
R-TLR1ATGGATTGTTCCCTGCTTTG
F-TLR2ACACCGCCATCCTCATTCTG
R-TLR2CTTCCCGCTGCGTCTCATCC
F-TLR3ACTGATGCTCCGAAGGGTGG
R-TLR3CGTGTTTCCAGAGCCGTGCT
F-TLR4CCGTCATTAGTGCGTCAGTT
R-TLR4TTCCTCACCCAGTCTTCGTC
F-TLR5GGTTCTCGCCCACCACATTA
R-TLR5GGGTCCCAAAGAGTCGGAAG
F-TLR6TCTGCTCAAGGACTTCCGTGTA
R-TLR6CGGTCATGGTAAGAGCCAAT
F-TLR7GTATGGGCAGACCTTGGACC
R-TLR7TTGGCTGATGCTATTTCCTGAT
F-TLR8GTGGAAACCGCCTGGACCTT
R-TLR8GGCTTCACTCGGGATGTGCT
F-TLR9AGACTGGTTACCTGGCAAGACG
R-TLR9AGGAAACTGGCACGCAAGAG
F-TLR10TGGAAATCCTGGGTTTGAGT
R-TLR10ATGGGCAGGCTACCTTCTTC
F-TLR95′-ACAACAACATCCACAGCCAAGTGTC-3′
R-TLR95′-AAGGCCAGGTAATTGTCACGGAG-3′
F-MyD885′-CGACGCCTTCATCTGCTACTGC-3′
R-MyD885′-CCACCACCATGCGACGACAC-3′
F-TRIF5′-TGAAGGAGGAAGCTGTAGCA-3′
R-TRIF5′-TGAAGGAGAAATGGCTTTCC-3′
F-TRAF65′-GTTGCTGAAATCGAAGCACA-3′
R-TRAF-65′-CGGGTTTGCCAGTGTAGAAT-3′
F-IL-1β5′-CTCGTGCTGTCGGACCCAT-3′
R-IL-1β5′-CAGGCTTGTGCTCTGCTGTG-3′
F-IL-65′-GGTACATCCTCGACGGCATCT-3′
R-IL-65′-GTGCCTCTTGCTGCTTTCAC-3′
F-IL-125′-GACATTCTGCGTTCAGGTCCAG-3′
R-IL-125′-CATTTTTGCGGCAGATGACCGTG-3′
F-TNF-α5′-ATCCGCGACGTGGAACTGG-3′
R-TNF-α5′-CCATGCCGTTGGCCAGGAGG-3′
F-GAPDH5′-GAGTCAACGGATTTGGTCGT-3′
R-GAPDH5′-TTGATTTTGGAGGGATCTCG-3′
TLR9 siRNAGCCCCACTTCTCGGCGGCAGC
ScraCCCAUUCGGGGGGGCAAACUCTT

2.6. Western Blot

Total proteins were harvested from the transfected 3D4/21 cells with corresponding plasmids or infected with HD-13 by using cell lysis buffer (Beyotime, Nanjing, China). Western blots were conducted as previously described [14]. In brief, proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred onto polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA), and incubated with primary antibodies overnight at 4°C. A horseradish peroxidase-conjugated secondary antibody was incubated with the membrane at the second day. The blots were visualized with the ECL reagent (Millipore). All antibodies were obtained from Abcam (Cambridge, UK, 1 : 1000). The optical density of protein bands was quantified by using ImageJ software (ImageJ Software Inc., USA).

2.7. Immunofluorescence

Immunofluorescence was performed as described with a minor modification. Briefly, 1 × 105 3D4/21 cells were seeded in 12-well plates for transfection or infection. Cells were washed with 1× PBS and fixed for 15 min in 4% formaldehyde. Then, Triton-XTM 100 was added to increase membrane permeability. After washing and blocking, 3D4/21 cells were incubated with the TLR9 or p-p65 antibody (Abcam, Cambridge, UK, 1 : 1000) overnight at 4°C. At the following day, cells were incubated with a secondary antibody (mouse anti-rabbit IgG-HRP, Abcam, Cambridge, UK, 1 : 1000) for 1 h. Then, cells were counterstained with DAPI and sealed with a cover glass and finally observed with a confocal fluorescence microscope (LSM880, Zeiss, Germany).

2.8. ELISA

1 mL of protein extraction reagent (Beyotime, Nanjing, China) was applied to lyse lung tissues which were separated from the piglet or HD-13-infected or plasmid-transfected 3D4/21 cells. Subsequently, the concentration of inflammatory cytokines, including IL-6, IL-12, TNF-α, and IL-1β, was determined by using an ELISA kit (Roche, Basel, Switzerland) as depicted in the manual.

2.9. Statistical Analysis

The representative data obtained from this study was shown as the mean ± SD from three independent experiments. GraphPad Prism version 5.0 software (GraphPad Software, Inc.) is used for statistical analysis of all data. A t-test was used for comparison between two groups, and ANOVA followed by the Tukey post hoc analysis was used for comparison between multiple groups. P value < 0.05 indicates that the difference is statistically significant.

3. Results

3.1. HD-13 Upregulates TLR9 Level in 3D4/21 Cells

To explore the role of TLR receptor in swine pneumonia progression, RT-qPCR was conducted to assess the levels of TLRs in 3D4/21 cells, following HD-13 infection at 0 h, 1 h, 4 h, 8 h, 12 h, 24 h, and 48 h, respectively. Results indicated that except for the TLR9 gene, there are no changes of mRNA levels in other TLR genes, compared with the control. For the TLR9 gene, HD-13 upregulated TLR9 level in a time-dependent manner (Figure 1(a)). Following HD-13 infection of the piglet at 0 h, 12 h, 24 h, 36 h, and 48 h, respectively, RT-qPCR was carried out to detect TLR level in spleen tissues; the results were consistent with the above (Figure 1(b)). To further verify the effect of HD-13 on TLR9, Western blot was performed to evaluate the level of TLR9 in 3D4/21 cells, following HD-13 infection at 0 h, 1 h, 4 h, 8 h, 12 h, 24 h, and 48 h, respectively. Findings showed that HD-13 promoted the level of TLR9 protein in a time-dependent manner (P < 0.05; Figure 1(c)). What is more, the same phenomenon was observed via immunofluorescence (Figure 1(d)). Collectively, HD-13 may upregulate TLR9 level in 3D4/21 cells.
Figure 1

HD-13 activates TLR9 expression. (a) RT-qPCR was performed to assess TLR expression in 3D4/21 cells, following HD-13 infection at 0 h, 1 h, 4 h, 8 h, 12 h, 24 h, and 48 h, respectively. (b) RT-qPCR was conducted to assess TLR expression in the spleen of pig, following HD-13 infection at 0 h, 12 h, 24 h, 36 h, and 48 h, respectively. (c) Western blot was carried out to detect TLR9 expression in 3D4/21 cells, following HD-13 infection at 0 h, 1 h, 4 h, 12 h, 24 h, and 48 h, respectively. (d) Immunofluorescence was performed to assess TLR9 expression in 3D4/21 cells. ∗P < 0.05, ∗∗P < 0.01vs. control group.

3.2. HD-13 Activates the Inflammatory Response via Upregulating TLR9 Level

To investigate whether HD-13 mediates the inflammatory response in 3D4/21 cells by accelerating TLR9, following infection with HD-13 or TLR9 silencing in 3D4/21 cells, RT-qPCR was performed to assess TLR9 level. Results showed that HD-13 upregulated the level of TLR9 and rescued the downregulation of TLR9 level caused by transfection of TLR9 siRNA (P < 0.05; Figure 2(a)). Further findings showed that TLR9 silencing inhibited the mRNA levels of the TLR9 downstream effector, including MyD88, TRIF, and TRAF6, but HD-13 upregulated their levels. It is worth noting that TLR9 silencing inhibited the mRNA levels of MyD88, TRIF, and TRAF6 accelerated by HD-13 (P < 0.05; Figure 2(b)). The above results were further verified by Western blot (P < 0.05; Figure 2(c)). IL-1β, IL-6, IL-12, and TNF-α serve as the vital inflammatory cytokines [15]; following infection with HD-13 or TLR9 silencing in 3D4/21 cells, RT-qPCR and ELISA were conducted to detect their levels. Results indicated that TLR9 silencing inhibited the levels of IL-1β, IL-6, IL-12, and TNF-α, whereas HD-13 upregulated their levels. Furthermore, TLR9 silencing suppresses the levels of IL-1β, IL-6, IL-12, and TNF-α promoted by HD-13 (P < 0.05; Figures 2(d) and 2(e)). Taken together, HD-13 may activate the inflammatory response via accelerating TLR9 level.
Figure 2

HD-13 activates the inflammatory response via accelerating TLR9 expression. (a, b) RT-qPCR was performed to assess the mRNA levels of TLR9, MyD88, TRIF, and TRAF6. (c) Western blot was conducted to evaluate the levels of MyD88, TRIF, and TRAF6 proteins. (d) RT-qPCR was carried out to detect the mRNA levels of IL-1β, IL-6, IL-12, and TNF-α. (e) ELISA was performed to detect the expression of IL-1β, IL-6, IL-12, and TNF-α in the supernatant of 3D4/21 cells. ∗∗P < 0.01vs. control group, ###P < 0.001vs. control group, and $$P < 0.01vs. HD-13 group.

3.3. HD-13 Activates the MAPK and NF-κB Pathway

To investigate the specific mechanism by which HD-13 activates the inflammatory response, following infection with HD-13 for 0 h, 0.5 h, 1 h, and 1.5 h, respectively, Western blot was conducted to assess the levels of MAPK pathway-related proteins, including ERK, p-ERK, p38, p-p38, JNK, and p-JNK in 3D4/21 cells. Findings showed that HD-13 accelerated the levels of p-ERK, p-p38, and p-JNK proteins, and HD-13 phosphorylation was most effective at 1 h of infection (P < 0.01; Figure 3(a)). Simultaneously, following infection with HD-13 for 0 h, 1 h, 6 h, and 12 h, respectively, in 3D4/21, Western blot was carried out to detect the levels of NF-κB pathway-related proteins, including p65, p-p65, IKKα, and p-IKKα. Results indicated that the levels of p-p65 and p-IKKα were promoted by HD-13, and the most effective time point was 6 h, which was confirmed by immunofluorescence (P < 0.05; Figures 3(b) and 3(c)). To further verify whether HD-13 activates the inflammatory response via the MAPK and NF-κB pathway, while infecting 3D4/21 cells with HD-13 for 1 h, the corresponding MAPK pathway inhibitors were added, in which PD98059 acts as the inhibitor of the p-ERK/ERK pathway, SB203580 serves as the inhibitor of the p-p38/p38 pathway, and SP600125 serves as the inhibitor of the p-JNK/JNK pathway. Western blot and ELISA results indicated that HD-13 promoted the levels of IL-1β, IL-6, IL-12, and TNF-α, which were alleviated by MAPK pathway inhibitors (P < 0.05; Figures 3(d) and 3(f)). The NF-κB pathway was investigated in the same manner, and similar results were observed (P < 0.05; Figures 3(e) and 3(g)). Collectively, HD-13 may activate the MAPK and NF-κB pathway.
Figure 3

HD-13 activates the MAPK and NF-κB pathway. 3D4/21 cells were infected with HD-13 for 0 h, 0.5 h, 1 h, and 1.5 h, respectively. (a) Western blot was performed to assess the levels of MAPK pathway-related proteins, including ERK, p-ERK, p38, p-p38, JNK, and p-JNK. (b) The levels of NF-κB pathway-related proteins, including p65, p-p65, IKKα, and p-IKKα, were evaluated by Western blot, following infection with HD-13 for 0 h, 1 h, 6 h, and 112 h, respectively. (c) Immunofluorescence was conducted to assess p-p65 expression. 3D4/21 cells were randomly divided into 3 groups: control group—cells were untreated; HD-13 group—cells were infected with HD-13 for 1.5 h; and HD-13+PD98059/HD-13+SB203580/HD-13+SP600125/HD-13+BAY11-7082 group—cells were infected with HD-13 and 10 μM PD98059 or 10 μM SB203580 or 10 μM SP600125 or 10 μM BAY11-7082 for 1.5 h. PD98059 serves as the p-ERK/ERK pathway inhibitor, SB203580 serves as the p-p38/p38 pathway inhibitor, SP600125 serves as the p-JNK/JNK pathway inhibitor, and BAY11-7082 serves as the NF-κB pathway inhibitor. (d, e) RT-qPCR was performed to assess the mRNA levels of IL-1β, IL-6, IL-12, and TNF-α. (f, g) ELISA was carried out to detect the expression of IL-1β, IL-6, IL-12, and TNF-α in the supernatant of 3D4/21 cells. ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001vs. control group; #P < 0.05, ##P < 0.01vs. HD-13 group.

3.4. HD-13 Activates MAPK and NF-κB Pathways via Upregulating TLR9 Level

To further investigate whether HD-13 activates MAPK and NF-κB pathways by accelerating TLR9 expression, thereby activating inflammatory response in 3D4/21 cells, following infection with HD-13 or TLR9 silencing in 3D4/21 cells, Western blot was performed to measure the levels of MAPK pathway-related proteins, including ERK, p-ERK, p38, p-p38, JNK, and p-JNK. Results showed that TLR9 silencing inhibited the levels of p-ERK, p-p38, and p-JNK proteins, but HD-13 upregulated their levels. Attentively, TLR9 silencing inhibited the levels of p-ERK, p-p38, and p-JNK proteins induced by HD-13 (P < 0.05; Figure 4(a)), indicating that HD-13 may activate MAPK pathways via upregulating TLR9 level. The NF-κB pathway was explored by the similar way; results indicated that TLR9 silencing inhibited the levels of p-p65 and p-IKKα, whereas HD-13 upregulates their level. Interestingly, the HD-13 effect was alleviated by TLR9 silencing (P < 0.05; Figures 4(b) and 4(c)). These findings suggested that HD-13 may activate the NF-κB pathway via upregulating TLR9 level. Taken together, HD-13 may activate MAPK and NF-κB pathways via upregulating TLR9 level.
Figure 4

HD-13 activates MAPK and NF-κB pathways via accelerating TLR9 expression. 3D4/21 cells were randomly divided into 4 groups: Scra group—cells were transfected with Scra siRNA for 48 h, which serves as a negative control; TLR9 siRNA group—cells were transfected with TLR9 siRNA for TLR9 silencing for 48 h; HD-13+Scra group—cells were infected with HD-13 for 48 h; and HD-13+TLR9 siRNA group—cells were infected with HD-13 and transfected with TLR9 siRNA for TLR9 silencing for 48 h. (a) Western blot was conducted to evaluate the levels of MAPK pathway-related proteins, including ERK, p-ERK, p38, p-p38, JNK, and p-JNK. (b) The levels of NF-κB pathway-related proteins, including p65, p-p65, IKKα, and p-IKKα, were measured by Western blot. (c) Immunofluorescence was performed to assess p-p65 expression. ∗P < 0.05, ∗∗P < 0.01vs. control group; ##P < 0.05, ###P < 0.001vs. control group; $P < 0.05, $$P < 0.01vs. HD-13 group.

4. Discussion

Swine pneumonia is a respiratory infectious disease caused by Pasteurella multocida, which is highly contagious and often causes other infectious diseases, seriously damaging the benefits of pig industry [16]. It is critical to explore the pathogenesis of swine pneumonia and seek effective prevention and treatment methods. Our findings demonstrated that HD-13 may activate MAPK and NF-κB pathways via accelerating TLR9 expression, thereby activating the inflammatory response in the progression of swine pneumonia. Our research may provide a theoretical basis for the prevention and treatment of swine pneumonia. Activated TLR initiates a series of events involving a variety of protein kinases, eventually leading to some transcription factors such as NF-κβ, activation of MAPK, IFN regulatory factor (IRF), and activator protein 1 (AP1). It is known that it plays an important role in the induction of inflammatory mediators, so it induces antiviral innate immune response through TLR3- and TLR4-mediated signal transduction. This was confirmed by the deficiency of IFN-related gene expression mediated by TLR3 and TLR4 in TRIF-knockout mice [9, 11, 15, 16]. Many genetic association studies have shown that TLR is also associated with the exacerbation of allergic asthma. For example, TLR7 and TLR 8 are associated with the progression of asthma, and their ligands can prevent airway remodeling in experimentally induced asthma [12-16]. The ligands of TLR10 have not been determined, but their SNPs share a correlation with asthma in two independent samples. TLR4 and TLR9 are associated with wheezing, while TLR4 is associated with the secretion of allergen-specific IgE. Therefore, the TLR9 ligand is currently in clinical trials to prevent or treat asthma [2, 4, 8]. TLR9 is the main pattern recognition receptor in the innate immune system, which selectively recognizes pathogen-related molecular patterns to initiate innate immunity and induce the release of inflammatory factors [17]. Fang et al.'s study show that TLR2 and TLR4 are closely associated with a variety of infectious diseases, particularly lung diseases [18]. Our findings indicated that HD-13 promoted the levels of TLR9 and its downstream effector, including MyD88, TRIF, and TRAF6. Besides, HD-13 activated the inflammatory response, because of the upregulation of IL-1β, IL-6, Il-12, and TNF-α expression in 3D4/21 cells. The above results indicate that HD-13 may activate the inflammatory response via accelerating TLR9 expression in swine pneumonia. The MAPK pathway is a vital component of innate immunity, which exists in animals, plants, and fungi [19]. The MAPK pathway is more conservatively involved in mediating cells to respond to various stimuli such as heat shock, mitosis, and inflammation and transmits the signal amplification to the nucleus, further promoting the transcription of cytokine mRNAs [20]. Wang et al.'s study indicates that activation of MAPK and NF-κB signaling pathways can aggravate pneumonia, myocarditis, and arthritis in piglets [21]. In this paper, our findings showed that 1 h HD-13 infection significantly accelerated the levels of MAPK-related proteins, including p-ERK, p-p38, and p-JNK. The above results indicate that HD-13 activates the MAPK pathway. What is more, TLR9 silencing inhibited the levels of p-ERK, p-p38, and p-JNK proteins, but HD-13 accelerated their expression, indicating that HD-13 may activate MAPK pathways via accelerating TLR9 expression to aggravate the development of swine pneumonia. NF-κB is a nuclear transcription factor with multidirectional transcriptional regulation, which plays a vital role in the regulation of natural immune response, acquired immune response, and inflammatory response [22]. It has been reported that the NF-κB pathway is closely related to the development of swine pneumonia [21]. Our results indicated that HD-13 promoted the levels of NF-κB-related proteins, including p-ERK, p-p38, and p-JNK, indicating that HD-13 activated the NF-κB pathway. Further results showed that TLR9 silencing inhibited NF-κB pathway activity, which was alleviated by HD-13. The above findings indicate that HD-13 may activate NF-κB pathways through accelerating TLR9 expression, resulting in aggravating the development of swine pneumonia. Besides, studies showed that human melanocytes express functional TLR9, and the TLR9 ligand activates NF-κB signals and induces the expression of cytokines and chemokines in melanocytes. Cytosine guanine ODN2006 is an agonist of TLR9, which can be activated by NF-κB activation increasing melanin synthesis. The combination of odn2006 and UVB irradiation significantly increased the expression of tyrosinase and PMEL in melanocytes. Therefore, TLR9 stimulation tends to enhance melanin production and inflammatory cytokine induction in human melanocytes. In summary, our findings illuminated that HD-13 accelerated TLR9 expression in 3D4/21 cells, HD-13 activated the inflammatory response via accelerating TLR9 expression, HD-13 activated the MAPK and NF-κB pathway, and HD-13 activated MAPK and NF-κB pathways via accelerating TLR9 expression. Our data collectively indicated that HD-13 may activate MAPK and NF-κB pathways via accelerating TLR9 expression, thereby activating the inflammatory response in the progression of swine pneumonia. Our research may provide a theoretical basis for the prevention and treatment of swine pneumonia.
  22 in total

1.  Inhibition of translation initiation factor eIF4A is required for apoptosis mediated by Microplitis bicoloratus bracovirus.

Authors:  Shu-Mei Dong; Ji-Hui Cui; Wei Zhang; Xue-Wen Zhang; Tian-Chao Kou; Qiu-Chen Cai; Sha Xu; Shan You; Dong-Shuai Yu; Lei Ding; Jian-Hua Lai; Ming Li; Kai-Jun Luo
Journal:  Arch Insect Biochem Physiol       Date:  2017-09-20       Impact factor: 1.698

2.  FCN-A mediates the inflammatory response and the macrophage polarization in Aspergillus fumigatus keratitis of mice by activating the MAPK signaling pathway.

Authors:  Guoqiang Zhu; Guiqiu Zhao; Jing Lin; Cui Li; Qian Wang; Qiang Xu; Xudong Peng; Hengrui Zheng
Journal:  Int Immunopharmacol       Date:  2020-04-06       Impact factor: 4.932

3.  Hydroxychloroquine inhibiting neutrophil extracellular trap formation alleviates hepatic ischemia/reperfusion injury by blocking TLR9 in mice.

Authors:  Sigong Zhang; Qiuyue Zhang; Furong Wang; Xuehui Guo; Tao Liu; Yang Zhao; Baohong Gu; Hao Chen; Yumin Li
Journal:  Clin Immunol       Date:  2020-05-11       Impact factor: 3.969

4.  Failure of protection and enhanced pneumonia with a US H1N2 swine influenza virus in pigs vaccinated with an inactivated classical swine H1N1 vaccine.

Authors:  Amy L Vincent; Kelly M Lager; Bruce H Janke; Marie R Gramer; Juergen A Richt
Journal:  Vet Microbiol       Date:  2007-07-17       Impact factor: 3.293

5.  Vaccine efficacy of the attenuated Erysipelothrix rhusiopathiae YS-19 expressing a recombinant protein of Mycoplasma hyopneumoniae P97 adhesin against mycoplasmal pneumonia of swine.

Authors:  Yoshihiro Shimoji; Eiji Oishi; Yoshihiro Muneta; Hideji Nosaka; Yasuyuki Mori
Journal:  Vaccine       Date:  2003-01-17       Impact factor: 3.641

6.  Mycoplasma hyorhinis in Taiwan: diagnosis and isolation of swine pneumonia pathogen.

Authors:  J H Lin; S P Chen; K S Yeh; C N Weng
Journal:  Vet Microbiol       Date:  2006-03-15       Impact factor: 3.293

7.  Differences in pathogenicity and virulence-associated gene expression among Pasteurella multocida strains with high and low virulence in a lung tissue model.

Authors:  Yan Cheng; Kaicheng Wang; Lishan Lin; Xingkai Zhao; Zihao Pan; Zhenlei Zhou
Journal:  Microb Pathog       Date:  2019-12-10       Impact factor: 3.738

8.  Antimicrobial resistance of Pasteurella multocida isolated from diseased food-producing animals and pets.

Authors:  Clémence Bourély; Géraldine Cazeau; Eric Jouy; Marisa Haenni; Jean-Yves Madec; Nathalie Jarrige; Agnès Leblond; Emilie Gay
Journal:  Vet Microbiol       Date:  2019-07-21       Impact factor: 3.293

9.  Breed-linked polymorphisms of porcine toll-like receptor 2 (TLR2) and TLR4 and the primary investigation on their relationship with prevention against Mycoplasma pneumoniae and bacterial LPS challenge.

Authors:  Xiaomin Fang; Xiao Liu; Cui Meng; Yanfeng Fu; Xuemin Wang; Bixia Li; Feng Tu; Fang Zhao; Shouwen Ren
Journal:  Immunogenetics       Date:  2013-08-22       Impact factor: 2.846

Review 10.  TLRs in pulmonary diseases.

Authors:  Shweta Arora; Shaniya Ahmad; Rasha Irshad; Yamini Goyal; Sahar Rafat; Neha Siddiqui; Kapil Dev; Mohammad Husain; Shakir Ali; Anant Mohan; Mansoor Ali Syed
Journal:  Life Sci       Date:  2019-07-20       Impact factor: 5.037

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.