miR-204-5p Hampers Breast Cancer Malignancy and Affects the Cell Cycle by Targeting PRR11.

PURPOSE: To unravel mechanisms of miR-204-5p in breast cancer (BC) cells.
METHODS: miR-204-5p expression level in BC cell lines was measured by qRT-PCR. Putative binding sites of miR-204-5p on the 3'-untranslated region of PRR11 were predicted by the bioinformatics method and verified by the dual-luciferase method. Protein and mRNA levels of PRR11 in BC were determined by western blot and qRT-PCR. The association between two genes was analyzed by correlation analysis. Cancer cell functions were evaluated through CCK8, flow cytometry, and Transwell approaches.
RESULTS: Significant downregulation of miR-204-5p was observed in BC tissue and cells. Cell functional experiments showed the inhibition of miR-204-5p on cell behaviors and cell cycle. PRR11 was the downstream target of miR-204-5p. Inhibition of RPP11 could reverse the impacts of the miR-204-5p inhibitor on cell functions of BC.
CONCLUSION: Our study revealed that the miR-204-5p/PRPP11 axis suppressed BC progression, which may provide a novel insight into the regulatory roles of miR-204-5p.

1. Introduction

Despite advances in breast cancer (BC) research, its pathogenesis, pathological process, and related molecular mechanisms are yet far less understood [1]. miRNAs play a crucial role in BC development [2]. Correspondingly, an increasing number of studies attempted to explore the regulating roles of miRNAs in BC. The study is aimed at identifying whether and how miR-204-5p modulates BC cell behaviors.

miR-204-5p performed diverse effects on tumor progression, which remains having several different views in cancer research. Referring to many studies, miR-204-5p was concluded as a tumor suppressor factor. For example, it has been reported that miR-204-5p attenuates tumor malignancy from various levels in gastric cancer, prostate cancer, and hepatocellular cancer [3-6]. However, some researchers observed the converse results in other tumors; for example, Zhang and his colleagues summarized a tumorigenesis role of miR-204-5p in cervical cancer [7]. The diverse or even converse effects of miR-204-5p on different tumors may be caused by its multiple target genes. Although miR-204-5p is considered a BC suppressor widely, the molecular mechanisms involved and the downstream are displayed differently [8-10]. These investigations have elaborated miR-204-5p as an underlying biomarker in BC. Thus, in-depth studies on the underlying mechanisms and the potential target genes of miR-204-5p are still urgently needed.

The current research investigated the effects of miR-204-5p on BC in terms of expression and cell function. Further, using bioinformatics methods, PRR11 was predicted as the target of miR-204-5p, and the mechanisms of miR-204-5p/PRR11 were examined as well. In conclusion, this study provides a new insight into the molecular mechanisms of miR-204-5p in BC, referring to potential therapeutic strategies based on this mechanism.

2. Materials and Methods

2.1. Microarray Analysis

The Cancer Genome Atlas (TCGA) database offered all data needed, including mRNA (tumor: 1,109, normal: 113) and miRNA (tumor: 1,103, normal: 104). miR-204-5p expression was analyzed based on the downloaded data. mRNAs were differentially analyzed (padj < 0.05, ∣logFC | >2) by using edgeR. Bioinformatics databases (miRDB, mirDIP, and TargetScan) were used to predict the targets of miR-204-5p, and the results were overlapped with the upregulated DEmRNAs. The mRNA with the highest correlation with the researched miRNA was selected for the investigation of the underlying mechanism of BC. GSEA was undertaken on the target mRNA.

2.2. Cell Lines

The cell lines this study adopted were listed as follows: BC cell lines MCF-7 (BNCC337656), AU565 (BNCC338197), MDA-MB-157 (BNCC338651), BT-20 (BNCC338513), and MDA-MB-231 (BNCC337893) and normal human mammary cell line MCF-10A (BNCC337734). Bena Culture Collection (Beijing, China) offered all cell lines, which were grown in RPMI- (Roswell Park Memorial Institute-) 1640 medium (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA). The medium contains FBS (10%; HyClone; GE Healthcare Life Sciences, Logan, UT, USA). Streptomycin and penicillin (both from Gibco; Thermo Fisher Scientific, Inc.) were added appropriately (each 100 U/mL). Routine cell incubation was performed in a constant temperature incubator (Thermo Scientific, HEARCELL150i).

2.3. Oligonucleotide and Plasmid Transfection

miR-mimic (50 nM), mimic negative control (mimic NC 50 nM), miR-inhibitor (50 nM), and inhibitor NC (50 nM) were purchased from GeneCopoeia (Guangzhou, China). Lentiviral vectors were used to create si-PRR11 and si-NC. The kit used in plasmid transfection was Lipofectamine 2000 (Invitrogen, Carlsbad, California). Subsequent analyses were undertaken on the transfected cells 48 h later.

2.4. qRT-PCR

The kit used for total RNA extraction was the TRIzol reagent (Thermo Fisher Scientific, Inc.). NanoDrop 2000 (Thermo Fisher Scientific, Inc.) was employed for concentration detection of RNA (1-2 μg was taken). mRNA/miRNA was transcribed to cDNA using PrimeScript RT Master Mix (Takara, P.R. China)/miScript II RT kit (Qiagen, USA). qRT-PCR was run on the ABI 7500 Real-Time PCR (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermal cycle condition was as follows: 5 min of initial denaturation at 95°C, followed by 40 cycles of 30 sec at 95°C, 60°C, and 72°C. See Table 1 for primer information. Internal references were U6 (miRNA) as well as GAPDH (PRR11). The results were quantitated and normalized by the 2−ΔΔCt value.

Table 1

Primer sequence.

Gene	Primer (5′-3′)
miR-204-5p	F: GCTACAGTCTTTCTTCATGTG
	R: CCAGTGATGACAATTGAACG
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT
PRR11	F: GACTTCCAAAGCTGTGCTTCC
	R: CTGCATGGGTCCATCCTTTTT
GAPDH	F: GGAGCGAGATCCCTCCAAAAT
	R: GGCTGTTGTCATACTTCTCATGG

2.5. Protein Examination

The kit used in protein lysis was radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Shanghai, China), which was added with protease inhibitors (Bioss, Beijing, China). The kit used in concentration examination of proteins was the BCA kit (Thermo Fisher Scientific, Inc.). Proteins of equal quantity (30 μg) were separated by 12% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The samples were then mounted onto polyvinylidene difluoride membranes (Millipore, Billerica, MA). Then, an overnight incubation was performed on 5% skimmed milk powder-blocked membranes (1 h) as well as primary antibodies. The used antibodies were PRR11 (ab237526, Abcam, UK) and GAPDH (ab9485, Abcam, UK). Following 3 washes (10 min/time) with PBST, the treated membranes were subjected to 1 h of secondary antibody incubation (ab6721, Abcam, UK, goat anti-rabbit IgG, horseradish-labeled). Following 3 washes with PBST (10 min/time), the membranes were scanned under an optical illuminator (GE, USA).

2.6. Cell Viability Examination

Cells AU565 and MDA-MB-231 (1 × 103 cells/100 μL) were inoculated into a sterile 96-well plate followed by 24 h of routine culture. Cells at indicated time points after transfection were collected. Cell proliferation was assayed by the CCK8 method (Beyotime, C0037, China). The CCK8 reagent was added to the plate, and the cells were incubated routinely for 4 h prior to detection. Measurement of absorbance was undertaken by using SpectraMax M5 (Molecular Devices, MD, USA) at 24 h, 48 h, 72 h, and 96 h, respectively (450 nm).

2.7. Cell Cycle Assay

Cells were transfected for 48 h. The adherent and floating cells were gathered for washing using 1 mL PBS. Then, the washed cells were resuspended using 500 μL PBS+50 μg/mL PI (propidium iodide). After that, 0.2% Triton X-100 as well as RNase A (100 μg/mL) was added into the cells, and the cells were cultured for 30 min in the dark at 4°C. Then, the FACSCalibur (Becton, Dickinson and Company, CA) was used for cell counting. Cell percentage in G2/M, S, and G0/G1 stages was analyzed.

2.8. Transwell Methods

Normal Transwell chambers and Matrigel-coated Transwell chambers were, respectively, used. The filter was washed with serum-free DMEM and placed in a 24-well plate. The lower Transwell chamber contained DMEM with 10% FBS. Then, 3 × 104 BC cells were inoculated into the upper chamber which was added with 200 μL DMEM, 0.1% bovine serum albumin, and 2 mg/mL Matrigel-coated film. The same as general conditions, the Transwell chamber was cultured for 24 h. After the culture, the remaining cells on the upper membrane surface were removed with cotton swabs. Cells on the lower membrane surface were fixed at 10% methanol temperature for 30 min and stained with 0.5% crystal violet. Six randomly selected fields were pictured using an inverted microscope. For migration detection, transfected cells (2 × 104 cells/compartment) were inoculated in the apical compartment, as noted above, without Matrigel.

2.9. Dual-Luciferase Reporter Gene Assay

In the dual-luciferase reporter gene assay, the 3′-UTR of PRR11 which contained wild-type (WT) or mutant-type (MUT) binding sites of miR-204-5p was cloned into psiCHECK vectors. PRR11-WT and PRR11-MUT reporter plasmids were constructed and validated by sequencing. PRR11-WT and PRR11-MUT plasmids were, respectively, transfected with miR-mimic or mimic NC into AU565. The Renilla luciferase expression vector pRL-TK (Takara, Dalian, China) was used as an internal reference. After transfection for 36 h, luciferase activity was measured by the dual-luciferase reporter gene assay (Promega, Madison, WI, USA).

2.10. Statistical Analysis

Results of assays were processed on Graphpad Prism 6.0 (San Diego, CA, USA). All analyses were assayed 3 times. Results were exhibited as standard deviation ± mean. Analysis of variance and Student's t-test were, respectively, used for comparisons among and between groups. p less than 0.05 was considered to indicate a statistical significance.

3. Results

3.1. miR-204-5p Expression Is Downregulated in BC

Numerous investigations mentioned that miR-204-5p is crucial for tumor development [11-13]. Based on the bioinformatics assay, miR-204-5p is expressed in BC in a low level (Figure 1(a)). Survival analysis proved bad survival outcomes of patients with low level of miR-204-5p (Figure 1(b)). As shown in Figure 1(c), cancer cell lines displayed a conspicuously low level of miR-204-5p, which coincided with earlier investigations and bioinformatics results. AU565 and MDA-MB-231 which, respectively, had the highest and lowest levels of miR-204-5p were applied for functional experiments.

Figure 1

Low level of miR-204-5p in BC: (a) violin plot of miR-204-5p level in TCGA, with blue presenting normal and yellow presenting tumor; (b) survival analysis of patients; (c) level of miR-204-5p in cells (∗ means p < 0.05, compared with MCF-10A).

3.2. miR-204-5p Induces Cell Cycle Arrest and Hampers Cell Functions

miR-204-5p was overexpressed, respectively, in AU565 and MDA-MB-231. qRT-PCR suggested that when the miR-204-5p mimic was transfected, miR-204-5p expression was considerably upregulated in two cell lines (Figure 2(a)). Then, the biological behaviors of transfected cells were verified by functional experiments. The CCK8 result exhibited conspicuously reduced proliferative potential of BC cells (Figure 2(b)). Meanwhile, based on Transwell assays, the abilities to migrate and invade BC cells were significantly decreased upon miR-204-5p overexpression (Figures 2(c) and 2(d)). The cell cycle was arrested in the G0/G1 stage after miR-204-5p overexpression (Figure 2(e)). In a word, miR-204-5p may serve as a tumor suppressor in BC.

Figure 2

miR-204-5p induces cell cycle arrest and hampers cell functions: (a) transfection efficiency of miR-204-5p in BC cells; (b) cell activity assayed by CCK8; (c) migratory ability of BC cells (×100) tested by the Transwell assay; (d) invasive ability of BC cells (×100) assayed by the Transwell assay; (e) proportion of cells in each cell cycle phase (∗ means p < 0.05).

3.3. PRR11 Is Directly Targeted by miR-204-5p in BC

Totally, 2,162 DEmRNAs were obtained. Among them, there were 1,405 upregulated mRNAs and 757 downregulated mRNAs (Supplementary Table 1). Targets of miR-204-5p were found using bioinformatics databases. The results were intersected with the 1,405 upregulated DEmRNAs, and 11 target genes that possessed binding sites with miR-204-5p were obtained (Figure 3(a)). PRR11 manifested the strongest negative correlation with the miRNA researched and was therefore used hereinafter (Figure 3(b)). PRR11 was significantly highly expressed in BC tissue (Figure 3(c)). PRR11 level was associated with the patient's survival and cell cycle (Figures 3(d) and 3(e)).

Figure 3

PRR11 is a direct target of miR-204-5p in BC: (a) Venn plot for screening target mRNA; (b) results of Pearson correlation analysis; (c) violin plot of PRR11 level in TCGA (blue for normal and yellow for tumor); (d) survival analysis on PRR11 levels and survival; (e) outcomes of GSEA; (f) potential binding area between 2 genes; (g) the binding between 2 genes; (h) PRR11 levels in differing cells; (i, j) the results of qRT-PCR and western blot (∗ means p < 0.05).

Potential binding sites of two genes were discovered by TargetScan (Figure 3(f)). Then, 3′-UTR of PRR11 containing MUT or WT binding sites of miR-204-5p was cloned into psiCHECK vectors. The dual-luciferase method was used for targeting verification. Luciferase intensity was evidently weakened when AU565 cells were cotransfected with the miR-204-5p mimic and PRR11-WT (Figure 3(g)).

Compared to normal breast cells, the expression of PRR11 mRNA in BC cells was remarkably upregulated (Figure 3(h)). However, overexpressed miR-204-5p evidently decreased the mRNA and protein expression of PRR11 in cancer cells (Figures 3(i) and 3(j)). In conclusion, PRR11 was directly targeted by miR-204-5p.

3.4. miR-204-5p Induces Cell Cycle Arrest and Hinders Cancer Cell Functions via PRR11 Inhibition

We had introduced the important role of PRR11 in tumor development, while it was still a mystery about the function of PRR11 as a molecular target in the inhibition of the development of BC caused by miR-204-5p. Thus, the following assays were performed. Inhibiting miR-204-5p significantly decreased miR-204-5p expression in BC cells and increased PRR11 expression. Moreover, simultaneously transfecting si-PRR11 and miR-204-5p inhibitor decreased PRR11 expression (Figures 4(a) and 4(b)). The results of the CCK8 assay showed that transfecting the miR-204-5p inhibitor into cells could promote the proliferation of BC cells. When si-PRR11 and miR-204-5p inhibitor were cotransfected into cancer cells, cancer cell proliferation induced by low miR-204-5p expression could be inhibited (Figure 4(c)). Transwell was used to detect cell migration and invasion. The miR-204-5p inhibitor significantly enhanced the migration and invasion of AU565 and MDA-MB-231, while si-PRR11 reversed it (Figures 4(d) and 4(e)). In addition, the results of the cell cycle assay showed that inhibition of miR-204-5p decreased the proportion of cancer cells in G0/G1, while si-PRR11 increased this proportion (Figure 4(f)). All in all, miR-204-5p induces cell cycle arrest and hinders cancer cell functions via PRR11 inhibition.

Figure 4

miR-204-5p induces cell cycle arrest and hinders cancer cell functions via PRR11 inhibition: (a) expression of miR-204-5p and PRR11 mRNA in BC cells; (b) protein level of PRR11 was assessed by western blot; (c) cell activity of transfected cells; (d) migratory ability of transfected BC cells (×100) by the Transwell assay; (e) invasive ability of transfected BC cells (×100) by the Transwell assay; (f) cell proportion in each cell cycle phase (∗ means p < 0.05).

4. Discussion

We observed that miR-204-5p was lowly expressed in BC tissue, followed by the verification of the trend at the cellular level as well. Next, we verified its inhibitory effects on cancer cell functions by overexpressing miR-204-5p, whose results were consistent with the previous studies [8, 9, 14]. As indicated in the research carried out by Hong et al., miR-204-5p serving as a tumor suppressor downregulates PIK3CB expression, which slows tumor growth and inhibits metastasis via the PI3K/AKT pathway [8]. In addition, we predicted downstream targets of miR-204-5p by bioinformatics and found a binding site of miR-204-5p on PRR11 3′-UTR and verified the prediction using the dual-luciferase assay. This is the first time to study the mechanism by which the miR-204-5p/PRR11 axis worked in BC, which is a novelty from our study.

Based on the literature review, PRR11 overexpression affects the cell cycle and promotes lung cancer progression [15]. Interestingly, a similar result from cell cycle evaluation was observed in our research. Besides, cancer drug resistance also positively correlates with PRR11 expression level according to Lee et al.'s research [16], which may cause patients' poor prognosis. PRR11 has been proven to hold prognostic values and take a role as a carcinogenic factor in BC [17] (our bioinformatics prediction showed that patients with high expression of PRR11 suffered poor prognosis). Above all, the tumor-suppressing role of the miR-204-5p/PRR11 regulatory axis in BC seems to be reliable.

On the whole, we revealed the effects of miR-204-5p and PRR11 in BC. Of note, PRR11 was a crucial downstream regulatory factor in the progression of BC. miR-204-5p induced cell cycle arrest and hindered cancer cell functions via PRR11 inhibition. Clinical tissue collection and in vivo experiment are the future arrangement to offer a rationale for BC therapy.