| Literature DB >> 35126160 |
Zhongyan Du1, Zhimei Ma2, Shanglei Lai2, Qinchao Ding2,3, Ziyi Hu2, Wenwen Yang2, Qianyu Qian2, Linwensi Zhu4, Xiaobing Dou2, Songtao Li5.
Abstract
Background: Acetaminophen (APAP) overdose results in the production of reactive oxygen species (ROS), induces hepatocyte necrosis, and leads to acute liver failure. Atractylenolide I (AO-I), a phytochemical found in Atractylodes macrocephala Koidz, is known to exhibit antioxidant activity. However, its clinical benefits against drug-induced liver injury remain largely unclear. Purpose: This study aimed at evaluating the protective effects of AO-I against APAP-induced acute liver injury.Entities:
Keywords: TLR4/MAPKs/NF-κB; acetaminophen; atractylenolide I; inflammation; liver injury
Year: 2022 PMID: 35126160 PMCID: PMC8815859 DOI: 10.3389/fphar.2022.797499
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primer sequence for quantitative real-time PCR.
| Gene | Primer sequence (5′–3′) | |
|---|---|---|
|
| Forward | CCCTCACACTCAGATCATCTTC |
| Reverse | GTTGGTTGTCTTTGAGATCCAT | |
|
| Forward | GAAATGCCACCTTTTGACAGTG |
| Reverse | TGGATGCTCTCATCAGGACAG | |
|
| Forward | CTCTGGGAAATCGTGGAAAT |
| Reverse | CCAGTTTGGTAGCATCCATC | |
|
| Forward | GAATGGGGTTCAACGGGTTA |
| Reverse | AGGTCTGTGATGCCCTTAGA |
FIGURE 1AO-I protects against APAP-induced liver injury. Mice were given AO-I (60 and 120 mg/kg) or NAC (120 mg/kg) via intragastric administration 2 h before intraperitoneal APAP administration (500 mg/kg) (n = 4–6 in each group). (A,D) Plasma ALT level. (B,E) Plasma AST level. (C) Liver H&E staining (left panel) and Suzuki score (right panel). All data are presented as the mean ± SEM. Bars with different characters present statistically significant results, p < 0.05.
AO-I ameliorates APAP-induced oxidative injury.
| Group | MDA (nmol/mgprot) | CAT(U/gprot) | GSH(μmol/L) |
|---|---|---|---|
| Control | 6.10 ± 1.01a | 547.40 ± 45.19a | 103.29 ± 32.69a |
| APAP (500 mg/kg) | 20.07 ± 0.86b | 341.50 ± 59.75b | 5.62 ± 0.37b |
| APAP (500 mg/kg)+AO-Ⅰ(60 mg/kg) | 9.22 ± 1.28c | 422.05 ± 35.80c | 13.57 ± 1.75c |
| APAP (500 mg/kg)+AO-Ⅰ(120 mg/kg) | 4.63 ± 0.77a | 510.12 ± 52.40a | 22.89 ± 7.65c |
Liver tissues were obtained from the mice 8 h after APAP, challenge for the measurement of MDA, content; CAT activity, and GSH, level. All data are presented as the mean ± SEM., bars with different characters present statistically significant results, p < 0.05.
FIGURE 2AO-I inhibits APAP-induced gene expression of inflammatory factors. Gene expression level of (A) IL-1B, (B) IL-6 and (C) TNFA. All data are presented as the mean ± SEM. Bars with different characters present statistically significant results, p < 0.05.
FIGURE 3AO-I inhibits APAP-induced NF-κB signaling pathway. (A) Effect of AO-I on APAP-induced nuclear translocation of NF-κB, IL-1β, IL-6, and TNF-α in the liver. (B) Quantitative map of NF-κB, IL-1β, IL-6, and TNF-α protein expression. All data are presented as the mean ± SEM. Bars with different characters present statistically significant results, p < 0.05.
FIGURE 4AO-I inhibits APAP-induced TLR4 signaling pathway. (A) Effects of AO-I on APAP-induced TLR4 and MYD88 expression in the liver. (B) Quantitative map of TLR4 and MYD88 protein expression. All data are presented as the mean ± SEM. Bars with different characters present statistically significant results, p < 0.05.
FIGURE 5AO-I inhibits APAP-induced MAPK signaling pathway. (A) Effects of AO-I on APAP-induced p-JNK and p-p38 expression in the liver. (B) Quantitative map of p-JNK and p-p38 protein expression. All data are presented as the mean ± SEM. Bars with different characters present statistically significant results, p < 0.05.