Xiaodong Jiang1, Wenbin Ding1, Weiguang Shen1, Jie Jin1. 1. Department of Interventional Medicine, Nantong First People's Hospital (the Second Affiliated Hospital of Nantong University), Nantong 226001, China.
Abstract
BACKGROUND: Adriamycin (ADM) is a drug commonly used for treating gastric cancer (GC). However, chemoresistance presents an obstacle to achieving successful outcomes in patients treated with chemotherapy. This study aimed to explore the effect of long non-coding RNA (lncRNA) H19 on chemoresistance in GC and its potential molecular mechanism. METHODS: The expression of H19 was detected in GC tissues and cell lines. The interaction between miR-152 with H19 and transcription factor 4 (TCF4) was validated by luciferase reporter assay. CCK-8 and flow cytometry were employed to measure cell viability and apoptosis, respectively. The levels of epithelial-mesenchymal transition (EMT) markers (E-cadherin, N-cadherin, Slug, Snail, and Twist) were detected by Western blot assay. A mouse model was established by subcutaneously injecting MGC-803 cells stably transfected with sh-H19 to investigate the effect of H19/miR-152-3p/TCF4 axis on ADM in vivo. RESULTS: In vitro, we observed that H19 was overexpressed in GC tissues and cell lines. After knockdown of H19, the IC50 of ADM was decreased and cell apoptosis rates increased in both BGC-823ADM and MGC-803ADM cells. Furthermore, H19 shRNA was found to inhibit epithelial-mesenchymal transition (EMT), and induction of EMT counteracted the inhibitory effect of H19 shRNA on chemoresistance of GC cells. miR-152 was a target of H19, and its expression was downregulated in GC tissues and cell lines. Furthermore, the expression of TCF4 was negatively regulated by miR-152 but positively regulated by H19. In vivo, the data indicated that H19 shRNA enhanced the chemosensitivity of GC tumor cells to ADM through sponging miR-152 from TCF4, resulting in the suppression of EMT. CONCLUSIONS: The results of this study elucidated that H19 was overexpressed in GC tissues and cell lines, and knockdown of lncRNA H19 increased the chemosensitivity of GC cells to ADM via sponging miR-152 from TCF4. The H19/miR-152/TCF4 axis may provide a new perspective for treating GC. 2020 Translational Cancer Research. All rights reserved.
BACKGROUND: Adriamycin (ADM) is a drug commonly used for treating gastric cancer (GC). However, chemoresistance presents an obstacle to achieving successful outcomes in patients treated with chemotherapy. This study aimed to explore the effect of long non-coding RNA (lncRNA) H19 on chemoresistance in GC and its potential molecular mechanism. METHODS: The expression of H19 was detected in GC tissues and cell lines. The interaction between miR-152 with H19 and transcription factor 4 (TCF4) was validated by luciferase reporter assay. CCK-8 and flow cytometry were employed to measure cell viability and apoptosis, respectively. The levels of epithelial-mesenchymal transition (EMT) markers (E-cadherin, N-cadherin, Slug, Snail, and Twist) were detected by Western blot assay. A mouse model was established by subcutaneously injecting MGC-803 cells stably transfected with sh-H19 to investigate the effect of H19/miR-152-3p/TCF4 axis on ADM in vivo. RESULTS: In vitro, we observed that H19 was overexpressed in GC tissues and cell lines. After knockdown of H19, the IC50 of ADM was decreased and cell apoptosis rates increased in both BGC-823ADM and MGC-803ADM cells. Furthermore, H19 shRNA was found to inhibit epithelial-mesenchymal transition (EMT), and induction of EMT counteracted the inhibitory effect of H19 shRNA on chemoresistance of GC cells. miR-152 was a target of H19, and its expression was downregulated in GC tissues and cell lines. Furthermore, the expression of TCF4 was negatively regulated by miR-152 but positively regulated by H19. In vivo, the data indicated that H19 shRNA enhanced the chemosensitivity of GC tumor cells to ADM through sponging miR-152 from TCF4, resulting in the suppression of EMT. CONCLUSIONS: The results of this study elucidated that H19 was overexpressed in GC tissues and cell lines, and knockdown of lncRNA H19 increased the chemosensitivity of GC cells to ADM via sponging miR-152 from TCF4. The H19/miR-152/TCF4 axis may provide a new perspective for treating GC. 2020 Translational Cancer Research. All rights reserved.
Gastric cancer (GC), a highly common form of malignant tumor, is responsible for approximately 10% of all cancer-related deaths worldwide (1). As a disease that is often asymptomatic early on, the prognosis for GC patients is usually dismal. Although diagnostic techniques and treatments have significantly improved in recent years, GC patients can still expect a low 5-year survival rate of about 20–30% (2). Surgery is currently considered to be the main treatment for GC, while chemotherapy and radiotherapy are the auxiliary means to prevent recurrence and metastasis (3). In patients with late-stage GC for whom the best time for surgery has passed, palliative chemotherapy is the main therapy to increase their prognosis. However, chemoresistance poses an obstacle to achieving successful outcomes for patients who receive chemotherapy (4). Therefore, a deeper understanding of the molecular mechanism of resistance to chemotherapy is crucial to improving the prognosis of GC patients. At present, the research on drug resistance of gastric cancer is not in-depth, which provides us with new ideas.Epithelial mesenchymal transition (EMT) is a cellular process in which epithelial cells gradually transform into stromal phenotypes (5). There is accumulating evidence to indicate that EMT is an important participant in the chemoresistance of tumor cells. Ying et al. showed that, by inhibiting EMT, emodin can effectively reverse the resistance of lung cancer cells to doxorubicin (6). Gaianigo et al. elucidated that EMT occurred in the early stage of tumor development and explored its connection with treatment resistance (7). Thus, the chemosensitivity of tumor cells may be increased via the suppression of EMT.LncRNA-H19 was reported to be an oncogenic lncRNA in several cancers (8). In temozolomide treatment, knockdown of H19 has been identified to sensitize glioma cells to (9). However, the relationship between H19 and chemoresistance in GC cells is yet to be fully established.In this study, we examined the mRNA levels of H19 in GC tissues and cell lines and explored the role and underlying mechanism of H19 in the chemoresistance to adriamycin (ADM) in GC cells. The data revealed that H19 was overexpressed in GC tissues and cell lines and that the chemosensitivity of GC cells can be increased by inhibiting H19 through the suppression of the EMT via the H19/miR-152-3p/transcription factor 4 (TCF4) axis.We present the following article in accordance with the ARRIVE reporting checklist (available at http://dx.doi.org/10.21037/tcr-20-1736).
Methods
Clinical specimens
A total of 30 human GC tissues and adjacent normal tissues were obtained from patients who received surgical treatment without radiotherapy and/or chemotherapy at the second affiliated hospital of Nantong university. After surgical resection, all fresh specimens were immediately placed in liquid nitrogen and stored at −80 °C until use. This study was approved by the Medical Ethics Committee of the second affiliated hospital of Nantong university.
Cell culture and induction of ADM resistant cells
Human GC cell lines (BGC-823, AGS, MGC-803) and normal gastric epithelium cell lines (GES-1) were obtained from ATCC (Manassas, VA, USA) and cultured in RPMI 1640 medium (Gibco, CA, USA) supplemented with 10% FBS (Gibco, CA, USA) and 1% antibiotics in a humidified incubator (at 37 °C, 5% CO2). For the induction of ADM resistant cells (BGC-823 and MGC-803), ADM from 4 ng/mL, the concentration increased by 25%. After 6 months of continuous culture, the subcultures capable of exponential growth at the highest concentration (44 ng/mL) were designated as ADM-resistant cell lines (BGC-823ADM and MGC-803ADM) (10).
Trizol reagent (TaKaRa, Dalian, China) was used to extract total RNA from GC tissues or cells. RNA was reverse transcribed into cDNA using Primescript one-step RT-PCR kit (TaKaRa, Dalian, China). Finally, the expression levels of genes were measured using SYBR Green Master Mix (Life Technologies) with pre-denaturation at 93 °C for 5 min, 35 cycles of denaturation at 95 °C for 40 sec, then hybridization at 55 °C for 60 sec, and followed by a extend at 72 °C for 1 min. The levels were calculated via the 2−ΔΔCt mean. GAPDH and U6 served as the controls. The primers used are shown as follows: H19 F: ACCACTGCACTACCTGACTC, R: CCGCAGGGGGTGGCCATGAA; MiR-152-3p F: 5'-GCAGTCAGTGCATGACAGA-3', R: 5'-GTCCAGTTTTTTTTTTTTTTTCCAAG-3'; TCF4 F: 5'-GATCCGTTGGGGAGGTAGG-3', R: 5'-TGGAGGGCTCTTTAAGGGG-3'; GAPDH F: 5'-CTGGGCTACACTGAGCACC-3', R: 5'-AAGTGGTCGTTGAGGGCAATG-3'; U6 F: 5'-CTCGCTTCGGCAGCACA-3', R: 5'-ACGCTTCACGAATTTGCGT-3'.
Cell transfection
shRNA against H19 (H19 shRNA), miR-152 mimic, miR-152 inhibitor, pcDNA3.0-TCF4 (TCF4/pcDNA3.0), and the corresponding negative controls (H19 scramble, mimic NC, inhibitor NC, and pcDNA3.0 vector) were synthesized from Santa Cruz (CA, USA). The sequences were as follows: H19 shRNA: 5'-GCGGGUCUGUUUCUUUACUUU-3'; H19 scramble: 5'-GACCAGCTGTCTAGGACTGACTT-3'; miR-152 mimic: 5'-UCAGUGCAUGACAGAACUUGG-3'; mimic NC: 5'-UUCUCCGAACGUGUCACGUTT-3'; miR-152 inhibitor: 5'-UGUUAAGCUGUCUCUGGCUUG-3'; inhibitor NC: 5'-UUUCCAAGGAAAGAGACAGCU-3'; TCF4/pcDNA3.0: 5'-CCGGGCTGAGTGATTTACTGGATTTCTCGAGA-3'; pcDNA3.0 Vector: 5'-CGAAAAAGCTGAGTGATTTACTGGATTTCT-3'. GC cells were inoculated into 6-well plates at a density of 1×106 and cultured to 70% confluence. Lipofectamine 2000 (Invitrogen, USA) was then used to transfect molecular products into the cells.
Cell viability assay
Transfected BGC-823ADM or MGC-803ADM cells were seeded in 96-well plates at a concentration of 5×104 cells/well. After 24 h of incubation with ADM (0–8 µM), 20 µL of MTT solution (5 mg/mL, Sigma, MO, USA) was added to the medium, and the cells were incubated at 37 °C for a further 4 h. Next, 150 µL of dimethy sulfoxide (DMSO, Sigma, MO, USA) was used in place of the entire supernatant, and the formalazine crystals were dissolved at 37 °C for 30 min. Finally, the absorbance at 490 nm of each well was measured with a microplate reader (Bio-Rad).
Cell apoptosis analysis
Cells with a number of 2×105 were cleaned twice with PBS and then resuspended in 500 µL Annexin-binding buffer. Next, 5 µL Anexin v-FIFC and 10 µL PI were added to the suspension and reacted at room temperature for 10 min. After incubation with DAPI staining for 20 min in the dark, the rate of cell apoptosis was analyzed by flow cytometry (BD Biosciences, San Jose, California, USA).
Western blot analysis
Cells were lysed with RIPA lysis buffer (Beyotime, Shanghai, China), and a bicinchoninic acid Protein Assay Kit was used to measure protein concentrations (CoWin Biotechnology, Beijing, China). The protein lysate (30 µg) in each sample was isolated with a 10% SDS-PAGE gel and transferred to a PVDF membrane (Bio-Rad, CA, USA). The membranes were blocked with 5% low-fat milk for 1 h at 37 °C, before incubation with primary antibody (1:1,000; anti-Twist, anti-Snail, anti-Slug, anti-TCF4, anti-E-cadherin, anti-N-cadherin, and anti-GAPDH antibodies, CST) overnight at 4 °C. The following day, the membranes were incubated with the corresponding secondary antibodies (1:5,000, CST) for 1 h at room temperature, respectively. The imprinted membranes were visualized using an ECL system (Bio-Rad Laboratories).
Luciferase reporter assay
H19 wild-type (wt-H19) and TCF4 wild-type (wt-TCF4) luciferase vectors were constructed including mutated binding sites (mut-H19 and mut-TCF4, respectively). Cells were promptly co-transfected with wt or mut and miR-152-3p mimics using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. The luciferase activity buffer (Promega, WI, USA) was added to the 24-well plate containing the transfected cells, followed by placed on a shaker to lyse them sufficiently. Finally, luciferase activity was detected using a dual-luciferase reporter system (Promega, WI, USA).
In vivo animal study
Male BALB/c 4-week-old nude mice were obtained from the laboratory animal center of Nantong university. All operations were in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (8th edition, NIH Publications, revised 2011) and were approved by the medical ethics committee of the Second Affiliated Hospital of Nantong University. The mice were housed in a standard environment (at 23±1 °C, relative humidity 60%±10%, and a 12-h light/dark cycle) with free access to water and food. The mice were divided at random into groups (n=5): the control group mice were subcutaneously injected with MGC-803ADM cells suspension (1×106/mL) into the flank area; the ADM-treated group mice were injected with MGC-803ADM cells and treated with ADM (10 mg/kg); and the ADM + H19 shRNA group mice were injected with H19 shRNA-transfected MGC-803ADM cells and treated with ADM (10 mg/kg). Tumor volume and the body weight in mice were measured every 5 days after injection. The mice were sacrificed at 30 days after injection and tumors were collected for follow-up study.
TdT-mediated dUTP nick-end labeling (TUNEL) assay
Briefly, the tissue sections were incubated in 3% H2O2, and then mixed with the TUNEL reaction mixture (Beyotime, Jiangsu, China), in line with the manufacturer’s instructions. Positive cells were visualized using a DAB kit (Beyotime, Jiangsu, China) and counterstained using Hematoxylin. For positive cell count, six visual fields were selected at random under a light microscope (Olympus Corporation, Tokyo, Japan).
Statistical analysis
Data in our present study were presented as mean ± standard deviation (SD) and statistical analysis was conducted using SPSS 20.0 software. Differences between two groups were analyzed with Student’s t-test (unpaired, two tailed) and differences among multiple groups were analyzed with one-way analysis of variance (ANOVA). Statistical significance was considered to exist when P<0.05.
Results
H19 is upregulated in GC tissues and cells
Our data revealed that the mRNA level of H19 was upregulated in GC tissues compared with normal tissues (, P<0.001). The expression of H19 was also higher in GC cell lines (BGC-823, AGS and MGC-803) than in GES-1 (, P<0.01). These results indicated that H19 was overexpressed in GC tissues and cells.
Figure 1
H19 shRNA increases the chemosensitivity of GC cells by inhibiting EMT. (A) The mRNA levels of H19 in healthy and GC tissues were detected by qRT-PCR. ***, P<0.001 vs. healthy tissues. (B) The expression of H19 in GES-1 and GC cell lines was detected by qRT-PCR. **, P<0.01 and ***, P<0.001 vs. healthy tissues or GES-1, respectively. (C) Relative mRNA levels of H19 were detected by qRT-PCR. **, P<0.01 vs. the H19 scramble group. (D,E) Cell viability was detected by MTT assay. *, P<0.05 vs. the control group. (F) Cell apoptosis was detected by flow cytometry. **, P<0.01 vs. the ADM + H19 scramble group. (G,H) Relative expressions of E-cadherin, N-cadherin, Slug, Snail, and Twist were detected by Western blotting. (I) Cell viability was detected by MTT assay. *, P<0.05 vs. the control group; #, P<0.05 vs. the H19 shRNA group. (J) Cell apoptosis was detected by flow cytometry. *, P<0.05 vs. the ADM + H19 scramble group; #, P<0.05 vs. the ADM + H19 shRNA group. Data were represented as the mean ± SD.
H19 shRNA increases the chemosensitivity of GC cells by inhibiting EMT. (A) The mRNA levels of H19 in healthy and GC tissues were detected by qRT-PCR. ***, P<0.001 vs. healthy tissues. (B) The expression of H19 in GES-1 and GC cell lines was detected by qRT-PCR. **, P<0.01 and ***, P<0.001 vs. healthy tissues or GES-1, respectively. (C) Relative mRNA levels of H19 were detected by qRT-PCR. **, P<0.01 vs. the H19 scramble group. (D,E) Cell viability was detected by MTT assay. *, P<0.05 vs. the control group. (F) Cell apoptosis was detected by flow cytometry. **, P<0.01 vs. the ADM + H19 scramble group. (G,H) Relative expressions of E-cadherin, N-cadherin, Slug, Snail, and Twist were detected by Western blotting. (I) Cell viability was detected by MTT assay. *, P<0.05 vs. the control group; #, P<0.05 vs. the H19 shRNA group. (J) Cell apoptosis was detected by flow cytometry. *, P<0.05 vs. the ADM + H19 scramble group; #, P<0.05 vs. the ADM + H19 shRNA group. Data were represented as the mean ± SD.
H19 shRNA increases chemosensitivity of GC cells to ADM
H19 shRNA transfection significantly decreased relative expression of H19 in ADM-resistant GC cell lines (, P<0.01). Moreover, the IC50 values of ADM were approximately 1.2 and 3.3 µM in the ADM + H19 shRNA and ADM + H19 scramble groups of BGC-823ADM cells, respectively. Simultaneously, the IC50 values of ADM were about 0.9 and 3.2 µM in the ADM + H19 shRNA and ADM + H19 scramble groups of MGC-803ADM cells, respectively. These results suggested that knockdown of H19 increased the sensibility of ADM-resistant GC cells to ADM (, P<0.05). MGC-803ADM cells were chosen for the subsequent experiments. We observed that the cell apoptosis rate of ADM-resistant cells was not influenced remarkably by ADM treatment. However, knockdown of H19 increased the cell apoptosis rate of MGC-803ADM cells compared with the H19 scramble group treated with ADM (, P<0.01). Consequently, our results suggested that knockdown of H19 decreased the chemoresistance of GC cells to ADM.
Figure 2
H19 shRNA enhances the chemosensitivity of GC cells via the MiR-152-3p/TCF4 axis. (A) The target relationship between miR-152 and H19 mRNA was analyzed by bioinformatics analysis. (B) The mRNA levels of miR-152 in healthy tissues and GC tissues were measured by qRT-PCR. **, P<0.01 vs. healthy tissues. (C) The mRNA levels of miR-152 in GES-1and GC cell lines were measured by qRT-PCR. *, P<0.05 and **, P<0.01 vs. GES-1. (D,E) The relative mRNA levels of miR-152 were measured by qRT-PCR. *, P<0.05 and **, P<0.01 vs. the control group; #, P<0.05 vs. the ADM + H19 shRNA group. (F) The interaction between H19 and miR-152 was checked by luciferase reporter assay. **, P<0.01 vs. H19 WT group. (G) Cell viability was detected by MTT assay. *, P<0.05 vs. the control group; #, P<0.05 vs. the H19 shRNA group. (H) Cell apoptosis was detected by flow cytometry. **, P<0.01 vs. the control group; #, P<0.05 vs. the ADM + H19 shRNA group. (I) The target relationship between miR-152 and TCF4 was analyzed by bioinformatics analysis. (J,K,L) The mutual relationship among H19, miR-152, and TCF4 was measured through qRT-PCR. (M) The interaction between TCF4 and miR-152 was checked by luciferase reporter assay. **, P<0.01 vs. TCF4 WT group. (N,O) The expression of TCF4 was measured by Western blotting. *, P<0.05 vs. the control group; #, P<0.05 vs. the miR-152 inhibitor group. Data were represented as the mean ± SD.
H19 shRNA enhances the chemosensitivity of GC cells via the MiR-152-3p/TCF4 axis. (A) The target relationship between miR-152 and H19 mRNA was analyzed by bioinformatics analysis. (B) The mRNA levels of miR-152 in healthy tissues and GC tissues were measured by qRT-PCR. **, P<0.01 vs. healthy tissues. (C) The mRNA levels of miR-152 in GES-1and GC cell lines were measured by qRT-PCR. *, P<0.05 and **, P<0.01 vs. GES-1. (D,E) The relative mRNA levels of miR-152 were measured by qRT-PCR. *, P<0.05 and **, P<0.01 vs. the control group; #, P<0.05 vs. the ADM + H19 shRNA group. (F) The interaction between H19 and miR-152 was checked by luciferase reporter assay. **, P<0.01 vs. H19 WT group. (G) Cell viability was detected by MTT assay. *, P<0.05 vs. the control group; #, P<0.05 vs. the H19 shRNA group. (H) Cell apoptosis was detected by flow cytometry. **, P<0.01 vs. the control group; #, P<0.05 vs. the ADM + H19 shRNA group. (I) The target relationship between miR-152 and TCF4 was analyzed by bioinformatics analysis. (J,K,L) The mutual relationship among H19, miR-152, and TCF4 was measured through qRT-PCR. (M) The interaction between TCF4 and miR-152 was checked by luciferase reporter assay. **, P<0.01 vs. TCF4 WT group. (N,O) The expression of TCF4 was measured by Western blotting. *, P<0.05 vs. the control group; #, P<0.05 vs. the miR-152 inhibitor group. Data were represented as the mean ± SD.
H19 shRNA increases the chemosensitivity of GC cells by inhibiting EMT
Compared with the H19 scramble group, we found that H19 shRNA increased E-cadherin (epithelial marker) but decreased N-cadherin (mesenchymal marker) in MGC-803ADM cells. To induce EMT, we specifically employed TGF-β1 in this study. As shown in , TGF-β1 treatment diminished the protein level of E-cadherin while elevating the level of N-cadherin in H19 shRNA-transfected MGC-803ADM cells. In addition, H19 shRNA decreased relative expression of Slug, Snail and Twist while TGF-β1 treatment significantly weakened the effect of H19 shRNA (). Furthermore, the IC50 values of ADM were 0.9 and 3.2 µM in the H19 shRNA and H19 shRNA+ TGF-β1 groups, respectively, which indicated that the sensitivity of ADM-resistant GC cells to ADM was reduced when EMT was activated by TGF-β1 (, P<0.05). TGF-β1 treatment also weakened the cell apoptosis rate (, P<0.05). In summary, our data elucidated that TGF-β1-induced EMT attenuated the inhibitory effect of H19 on the chemoresistance of GC cells to ADM.
miR-152-3p is a target of H19
miR-152 was identified as a predicted target of H19 (), and the mRNA levels of miR-152 were downregulated in GC tumor tissues and cell lines (, P<0.05, P<0.01). MGC-803ADM cells were transfected with miR-152 mimic or inhibitor, and miR-152 was successfully transfected, as shown in (P<0.05, P<0.01). Furthermore, miR-152 expression was higher in the H19 shRNA group than in the H19 scramble group, with miR-152 inhibitor significantly offsetting this increase; this indicated that the expression of miR-152 was negatively regulated by H19 (, P<0.05, P<0.05). Luciferase reporter assay was applied to further confirm the target relationship between miR-152 and H19. As expected, luciferase activity in MGC-803ADM cells was significantly decreased by co-transfection with wt-H19 and miR-152 mimic, but co-transfection with mut-H19 and miR-152 mimic rescued this change (, P<0.01). The IC50 values of ADM were 0.9 and 2.9 µM in the H19 shRNA group and H19 shRNA + miR-152 inhibitor group, respectively, which demonstrated that downregulation of miR-152 could counteract the inhibitory effect of H19 shRNA on the chemoresistance of GC cells to ADM (, P<0.05). Moreover, the cell apoptosis rate was suppressed by miR-152 inhibitor in this group compared with the ADM + H19 shRNA group (, P<0.01, P<0.05). Taken together, these data showed that miR-152 was a direct target of H19 and was negatively regulated by H19. Inhibition of miR-152 weakened the inhibitory effect of H19 shRNA on the chemoresistance of GC cells to ADM.
TCF4 expression is regulated by miR-152 and H19 in GC cells
Bioinformatics analysis revealed TCF4 to be a potential target of miR-152 (). The expressions of TCF4, H19, and miR-152 were then analyzed, and it was observed that miR-152 was negatively correlated with TCF4 (, P<0.0001) or H19 (, P<0.0001), but TCF4 was positively correlated with H19 (, P<0.0001). Luciferase reporter assay further demonstrated that TCF4 was a direct target of miR-152 (, P<0.01). In addition, the mRNA level of TCF4 was downregulated in the H19 shRNA group but upregulated in the miR-152 inhibitor group (, P<0.05). All of these results indicated that TCF4 was positively regulated by H19 and negatively regulated by miR-152.
Overexpressed TCF4 decreases the chemosensitivity of GC cells to ADM through inducing EMT
MGC-803ADM cells were transfected with pcDNA3.0-TCF4 or pcDNA3.0 vector (, P<0.01). The protein level of E-cadherin was significantly downregulated by TCF4 overexpression, while the level of N-cadherin was upregulated (, P<0.05). The IC50 values of ADM were approximately 3.2 and 5.7 µM in the pcDNA3.0 vector group and the TCF4/pcDNA3.0 group, respectively (). Similarly, overexpressed TCF4 also suppressed cell apoptosis in ADM-resistant GC cells under the treatment of ADM although the difference was not obvious (). These results determined that TCF4 overexpression decreased the chemosensitivity of GC cells to ADM by inducing EMT.
Figure 3
Overexpression of TCF4 decreases the chemosensitivity of GC cells to ADM by inducing EMT. MGC-803ADM cells transfected with pcDNA 3.0 vector or TCF4/pcDNA3.0 received ADM treatment with untreated cells as a control. (A,B,C,D) The relative expressions of TCF4, E-cadherin, and N-cadherin were measured by Western blotting. *, P<0.05, **, P<0.05 vs. the control group. (E) Cell viability was measured by MTT assay. *, P<0.05, #, P<0.05 vs. the control group. (F) Cell apoptosis was measured by flow cytometry. *, P<0.05 vs. the control group; #, P<0.05 vs. the ADM + pcDNA3.0 vector group. Data were represented as the mean ± SD.
Overexpression of TCF4 decreases the chemosensitivity of GC cells to ADM by inducing EMT. MGC-803ADM cells transfected with pcDNA 3.0 vector or TCF4/pcDNA3.0 received ADM treatment with untreated cells as a control. (A,B,C,D) The relative expressions of TCF4, E-cadherin, and N-cadherin were measured by Western blotting. *, P<0.05, **, P<0.05 vs. the control group. (E) Cell viability was measured by MTT assay. *, P<0.05, #, P<0.05 vs. the control group. (F) Cell apoptosis was measured by flow cytometry. *, P<0.05 vs. the control group; #, P<0.05 vs. the ADM + pcDNA3.0 vector group. Data were represented as the mean ± SD.
shRNA enhanced the chemosensitivity of GC tumor cells to ADM in vivo
Tumor volume and the body weight in mice were not significantly affected by ADM treatment. Compared with the ADM treated group, H19 shRNA transfection suppressed tumorigenesis and maintained body weight (, P<0.05). TUNEL assay revealed the apoptosis index to be significantly increased by H19 shRNA compared to treatment with ADM (, P<0.05). The mRNA level of miR-152 was also increased, while the protein level of TCF4 was decreased in the ADM + H19 shRNA group compared with the group treated with ADM (, P<0.05). Furthermore, E-cadherin expression was increased and N-cadherin expression was decreased in the ADM + H19 shRNA group compared with the ADM-treated group (, P<0.05). Our data revealed that H19 shRNA enhanced the chemosensitivity of GC tumor cells to ADM in vivo through sponging miR-152 from TCF4, resulting in the suppression of EMT.
Figure 4
H19 shRNA enhances the chemosensitivity of GC tumor cells to ADM in vivo. MGC-803ADM cells (with and without H19 shRNA transfection) were injected into nude mice and treated with ADM. (A,B) The tumor volume and body weight of the mice were detected every 5 days. #, P<0.05 vs. the ADM-treated group. (C,D) Apoptosis index was measured by TUNEL staining, images were magnified at 400×. #, P<0.05 vs. the ADM-treated group. (E) The mRNA level of miR-152 was measured by qRT-PCR. #, P<0.05 vs. the ADM-treated group. (F,G,H,I,J) The protein level of TCF4 was measured by Western blotting. #, P<0.05 vs. the ADM-treated group. Data were represented as the mean ± SD.
H19 shRNA enhances the chemosensitivity of GC tumor cells to ADM in vivo. MGC-803ADM cells (with and without H19 shRNA transfection) were injected into nude mice and treated with ADM. (A,B) The tumor volume and body weight of the mice were detected every 5 days. #, P<0.05 vs. the ADM-treated group. (C,D) Apoptosis index was measured by TUNEL staining, images were magnified at 400×. #, P<0.05 vs. the ADM-treated group. (E) The mRNA level of miR-152 was measured by qRT-PCR. #, P<0.05 vs. the ADM-treated group. (F,G,H,I,J) The protein level of TCF4 was measured by Western blotting. #, P<0.05 vs. the ADM-treated group. Data were represented as the mean ± SD.
Discussion
GC metastasis and recurrence can be prevented by chemotherapy. However, the clinical application of chemotherapy in GC has been severely restricted by chemoresistance. In our present study, we confirmed that H19 shRNA enhanced the chemosensitivity of ADM-resistant GC cells to ADM, both in vitro and in vivo, through sponging miR-152 from TCF4, resulting in the suppression of EMT.In recently published studies, lncRNA H19 was found to be markedly elevated in multiple tumor types including breast, ovarian, and bladder cancer, in which it functioned as an oncogene (11-13). Previous reports showed that H19 was involved in the chemoresistance of tumor cells. Jiang, for example, elucidated that H19 knockdown sensitized glioma cells to temozolomide therapy (9). Meanwhile, H19 has been found to induce paclitaxel chemoresistance in breast cancer by silencing BIK (14). Similarly, in the present study, H19 was also observed to be overexpressed in GC. Consequently, H19 shRNA led to decreased IC50 values of ADM and increased apoptosis in both BGC-823ADM and MGC-803ADM cells, which suggests that H19 shRNA could increase the chemosensitivity of GC cells to ADM. In our study, we revealed that H19 shRNA inhibited EMT. TGF-β1 is well-known to induce EMT (15). TGF-β1 treatment abolished the changes made by H19 shRNA, indicating that chemosensitivity was increased by H19 shRNA through its suppression of EMT.H19 has been reported to regulate the inhibition of miRNA targets at the post-transcriptional level. Su reported that H19, as a competing endogenous RNA, regulated the expression of AQP3 by sponging miR-874 in the intestinal barrier (16). H19 was also reported to contribute to cell proliferation in gallbladder cancer through modulation of AKT expression by sponging miR-194-5p (17). In present study, we uncovered a direct binding relationship between miR-152 and H19. Meanwhile, we observed that miR-152 was downregulated in GC, and its expression was negatively regulated by H19. Moreover, compared with the ADM+H19-shRNA group, co-transfection of H19shRNA and miR-152 inhibitors elevated the IC50 value of ADM and reduced the apoptosis rate, suggesting that the knockout of miR-152 abolished the inhibition of H19-shRNA in cellular ADM chemoresistance. Overall, these data indicated that H19 acted as an miR-152 sponge to regulate the chemoresistance of GC cells, which was consistent with our hypothesis.TCF4 is a basic helix-loop-helix transcription factor, which is reported to play an important role during EMT (18). Our present study revealed that the mRNA level of TCF4 was negatively regulated by miR-152, and positively regulated by H19. Consistently, TCF4 overexpression induced EMT by decreasing the protein expression of E-cadherin while increasing N-cadherin. Additionally, TCF4 overexpression also decreased GC cell chemosensitivity to ADM. In all, our in vitro experiments indicated that H19 shRNA increased the chemosensitivity of GC cells to ADM via derepression of miR-152 from TCF4.Animal experiments were also employed to explore the effect of H19 in vivo. Previous study has indicated that H19 shRNA strongly reduces tumor growth and tumor volume in colon cancer (19). Similarly, we also found that H19 shRNA reduced tumor growth and tumor volume in GC while maintaining the body weight of the mice under the treatment of ADM. In addition, H19 shRNA increased the apoptosis index and suppressed EMT. Particularly, the mRNA and protein levels of miR-152 were increased and the levels of TCF4 were decreased by H19 shRNA, indicating that the H19-miR-152-3p-TCF4 axis suppressed GC tumor progression by inhibiting EMT when treated with ADM.In conclusion, our study demonstrated that H19 was aberrantly upregulated in GC tissues and cell lines, TCF4 was positively regulated by H19 and negatively regulated by miR-152. Knockdown of H19 increased the chemosensitivity of GC cells to ADM via sponging miR-152 from TCF4, overexpressed TCF4 abrogated the effect of H19 on the chemosensitivity of GC cells through inducing EMT. The H19/miR-152/TCF4 axis may be a new prospect in the treatment of GC.
Authors: Jacques Ferlay; Hai-Rim Shin; Freddie Bray; David Forman; Colin Mathers; Donald Maxwell Parkin Journal: Int J Cancer Date: 2010-12-15 Impact factor: 7.396
Authors: Magdalena Medrzycki; Yunzhe Zhang; Weijia Zhang; Kaixiang Cao; Chenyi Pan; Nathalie Lailler; John F McDonald; Eric E Bouhassira; Yuhong Fan Journal: Cancer Res Date: 2014-09-09 Impact factor: 12.701