Non-target genetic manipulation induces rhabdomyosarcoma in KrasPten-driven mouse model of ovarian cancer.

BACKGROUND: Genetically engineered mice are ideal models to advance our understanding the tumorigenesis of ovarian cancer. Our original objective was to establish an ovarian cancer model induced by Kras activation and Pten deletion. However, proficiently establishing the model remains a technical problem, which limits its application.
METHODS: We established the Kras activation/Pten deletion-induced mouse model of ovarian cancer by injecting Cre recombinase-expressing adenovirus in the ovarian bursa. PCR analysis, Western blotting, and immunohistochemistry staining were performed to verify the alteration of conditional genes. We detected expression of canonical molecular markers in order to examine the origin of the tumors.
RESULTS: Subcutaneous lumps developed accidentally in mice with ovarian cancer, as early as 2 weeks post in vivo genetic manipulation, far before the destructive growth of ovarian cancer. PCR analysis confirmed the efficient Cre-mediated recombination of Kras and Pten in tumor tissues, which are consistent with the activation of the MAPK and PI3K/Akt/mTOR pathways. Histomorphological and histological analysis showed that the lumps were actually rhabdomyosarcoma (RMS). We confirmed that the leakage of adenovirus transformed healthy adjacent tissues into RMS.
CONCLUSIONS: Avoiding accidental exposure of non-target tissues to adenovirus is crucial to successfully establish the ovarian cancer mouse model. Moreover, non-specific genetic manipulations can induce the development of RMS. 2020 Translational Cancer Research. All rights reserved.

Introduction

Ovarian cancer is a lethal gynecologic malignancy with the highest case-fatality rate (1), and it demonstrates five major histological subtypes (serous, endometrioid, mucinous, clear cell and transitional adenocarcinomas) (2). Ovarian surface epithelium (OSE), a single layer of cells covering the ovary, is the potential site of the origin of ovarian cancer. The “incessant ovulation” theory proposes that frequent ovulation and surface repair contribute to the malignant transformation (3). In the past few decades, significant progress has been made in uncovering insights into genetics of tumorigenesis in ovarian cancer. Indeed, distinct genetic alterations, coupled with other etiological factors, contribute to the development of different subtypes of ovarian tumor (4). Frequent somatic mutations in Kras and Pten discovered in ovarian endometrioid adenocarcinomas (OEAs) indicate that they play key roles in the etiology of this subtype (5,6).

Kras, a member of the Ras gene family, is involved in transmitting signals within cells (7). Specific alterations in the Kras gene can convert it into an active oncogene, which has been observed with varying frequencies in a significant proportion of human malignancies, including colorectal cancer, lung cancer, and pancreatic cancer (8-11). Homozygous deletion of Pten, a tumor suppressor gene, is also detected in a variety of human malignancies (12,13). Germ-line Pten mutations are frequently seen in patients with autosomal dominant cancer-predisposition syndromes (14), while somatic Pten mutations are detected in many tumors, including glioblastoma, OEAs, prostate cancer, and melanoma (15-18). A mouse model for OEAs has been previously generated through activation of Kras and deletion of Pten in transgenic mice using the Cre/lox recombination (19). The OEAs developed in mice exhibit histomorphology and biological behavior similar to that of human OEAs; therefore, this mouse model provides a useful tool for studies on ovarian cancer.

In order to generate the mouse model of OEAs driven by Kras activation and Pten deletion, Cre recombinase-expressing adenovirus (AdCre) were delivered into the ovarian bursa for activation of conditional alleles within the OSE. Subcutaneous lumps developed accidentally around the surgical incision post-AdCre administration. Cre-mediated recombination of Kras and Pten was verified in tumor tissues, and the activation of the downstream pathways was also consistent with specific genetic events. Furthermore, histopathological analysis revealed that these newly developed tumors were rhabdomyosarcoma (RMS). We verified that the leakage of adenovirus transformed healthy adjacent tissues into RMS. These findings imply that it is essential to avoid accidental non-target genetic manipulations to stably establish this mouse model of ovarian cancer. We present the following article in accordance with the ARRIVE reporting checklist (available at http://dx.doi.org/10.21037/tcr-20-2561).

Methods

Reagents and antibodies

The following reagents were used: Tris, glycine, sodium dodecyl sulfide and bovine serum albumin (BSA) (Sigma). Antibodies included: p-MAPKThr202/Tyr204, p-AKTSer473, p-mTORSer2448, p-S6KThr389 and p-4E-BP1Thr37746 (Cell signaling Technology); β-actin and myogenin (Genetex); myoD1 (Proteintech); vimentin, cytokeratin 8, Ki-67 and α-SMA (Abcam) and desmin (Servicebio Co. Ltd., China). Experiments were performed under a project license (NO.: L201501027) granted by ethics board of Sun Yat-sen University, in compliance with all national and/or institutional guidelines for the care and use of animals.

Generation of double transgenic KrasG12DPtenFl/Fl mice

LSL-KrasG12D (B6.129S4-Krastm4Tyj/J) and Pten (C;129S4-Ptentm1Hwu/J) mice were purchased from the Jackson Laboratory (Bar Harbor, USA). LSL-Kras mice were crossed with Pten to generate pups harboring LSL-Kras (n=10), LSL-Kras (n=10), and PtenFl/Fl (n=10). Eight-to-10-week-old female littermates were included in this study. DNA was extracted from the tail tissues for genotyping of mice following protocols provided on the Jackson Laboratory website (www.jax.org).

Administration of adenovirus

The recombinant adenovirus (AdCre-eGFP) was purchased from the Gene Transfer Vector Core, University of Iowa. We reconstituted the transduction system as described in a previous study (19). After using 5 units (U) of pregnant mare serum gonadotropin (Sigma) for 2 days, 5 U of human chorionic gonadotropin (Sigma) were used to promote synchronized ovulation, and 1.5 days later the animals were anesthetized and a dorsal incision was made to expose the ovaries. AdCre-eGFP was then delivered into the ovarian bursa via microinjection under a dissecting microscope. Then, we gently closed the dorsal incision by successively suturing the fascia, the muscle, and the skin with surgical stitches. Mice with tumors were sacrificed when they were moribund.

Fluorescence studies

Five days after the intrabursal administration of AdCre-eGFP, the treated-ovaries were harvested and snap-frozen using OCT (Sakura Fineteck). Seven-micrometer-thick cryo-sections of tumor tissues were prepared using cryo-ultramicrotome (Thermo). Sections were fixed in ice cold acetone for 15 minutes and the nuclei were stained with DAPI. Pictures were captured using a fluorescence microscope.

Recombination efficiency analysis

Genomic DNA was extracted from tumor and normal tissues using a TIANamp Genomic DNA Kit (TIANGEN, DP304), according to the manufacturer’s instructions. PCR was performed with primers designed for Cre-mediated recombination of Kras and Pten, followed by agarose gel electrophoresis of the PCR products. The primer sets used were as follows: KrasG12D (forward: GTCTGGAATTCCGCAAGCTA; reverse: GCACGCAGACTGTAGAGCAG), recombined KrasG12D (forward: GTCTTTCCCCAGCACAGTGC; reverse: CTCTTGCCTACGCCACCAGCTC), Pten (forward: CAAGCACTCTGCGAACTGAG; reverse: AAGTTTTTGAAGGCAAGATGC), and recombined Pten (forward: ACTCAAGGCAGGGATGAGC; reverse: GCTTGATATCGAATTCCTGCAGC). Transgenic alleles after genetic manipulation were as follows: (I) the Kras gene was heterozygous, expressing mutant Kras and wild-type Kras respectively, (II) the Pten gene was homozygous; hence, showed complete deletion.

Histological analysis and immunohistochemistry (IHC)

Mouse tissues were excised immediately after euthanasia and fixed in 4% paraformaldehyde, followed by paraffin-embedding. Paraffin sections were deparaffinized, rehydrated, and stained using hematoxylin and eosin (H&E) or processed for IHC. For IHC, tissues sections were incubated with primary antibodies after antigen retrieval, and the immunostaining intensity was scored as previously described (20).

Western blotting

Tissues were homogenized and then lysed in RIPA buffer with protease inhibitors (Roche) and phosphatase inhibitors (Sigma). The lysates were loaded onto polyacrylamide gels and then transferred onto polyvinylidene difluoride (PVDF) membranes. Blots were blocked with 5% BSA in Tris-buffered saline-Tween 0.1% for 1 hour at room temperature; then, probed with antibodies overnight at 4 °C. Following a 1-hour incubation with the HRP-conjugated secondary antibody (Cell Signaling Technology) at 37 °C, detection was performed using a Pierce ECL Western Blotting Substrate system.

Statistical analysis

Unpaired, two-tailed Student’s t-tests were used for all analyses comparing two experimental groups. All data were exported and calculated into Microsoft Excel, and statistical analyses were performed using the GraphPad Prism software. A P value of <0.05 was considered statistically significant.

Results

Subcutaneous lumps developed accidentally in mouse model of ovarian cancer driven by oncogenic activation of Kras and deletion of Pten

To achieve Cre-mediated recombination of Kras and Pten genes, adenoviruses expressing Cre recombinase and green fluorescent protein (AdCre-eGFP) were delivered into ovarian bursa after surgical exposure. This method was effective, as shown by the abundant GFP in the infected ovarian surface epithelial cells (OSECs) (). Then, we monitored the health of the animals every 3 days. Unexpectedly, large subcutaneous lumps rapidly developed in situ around the dorsal incision site in most of the compound mutant mice carrying LSL-KrasG12D and PtenFl/Fl (8/10, 80%), but not in mice carrying LSL-KrasG12D (0/10, 0%) or PtenFl/Fl (0/10, 0%) alone. These lumps had a shorter disease latency (range, 2–3.5 weeks) post-AdCre-eGFP administration before the mice exhibited the signs of ovarian cancer. More importantly, the rapid and infiltrative growth of these lumps complicated the ovarian cancer progression because of disordered symptoms. The animals with the subcutaneous lumps were moribund approximately 5 weeks post-AdCre-eGFP administration (range, 4.5–6.5 weeks), probably because of the end-stage cachexia and multiple organ dysfunction syndrome under high tumor burden. At the same time, the remaining two mice without lumps were healthy with palpable ovarian tumor. We euthanized the moribund animals and dissected the lumps anatomically. The lump appeared separate from the OEAs, and appeared to originate from the abdominal wall (). Furthermore, the lumps were circular (diameter between 2.5 to 6.2 cm) and displayed a firm, white and whorled appearance in sections (). H&E staining revealed that the lumps were separate from the ovarian cancer, and demonstrated remarkably different histomorphology from the typical glandular epithelium of OEAs (). Particularly, the lumps exhibited increased cellularity and frequent mitotic figures, and were made of spindle cells in sweeping fascicles (). Furthermore, frequent focal necrosis (, left), invasion of adjacent skeletal muscle (, middle), and adipose tissue invasion (, right) were observed in most cases. Some mice with lumps developed lung metastases (2/8, 25%; ). Consistent with the aggressive phenotype, >30% of cells were positive for Ki-67 in the nuclei (). Overall, these results demonstrated that subcutaneous lumps with a malignant phenotype developed in the transgenic mice because of Kras activation and Pten deletion.

Figure 1

Oncogenic Kras activation and Pten deletion-induced formation of subcutaneous lumps. (A) Fluorescence image of eGFP protein expression in ovarian surface epithelium 5 days post-AdCre-eGFP administration (green, left). DAPI was used for staining the nuclei (blue, right). (B) Macroscopic images of the subcutaneous lump. Arrows indicate the subcutaneous lump. Dashed circle indicates the ovarian cancer developed in the injected ovary. The inset shows the section of the lump. (C) Low power (2×) of H&E staining of the ovarian endometrioid adenocarcinomas and subcutaneous lumps. Dashed line and arrow indicate the ovarian bursa. Upper left: a partially enlarged picture of ovarian cancer. (D) H&E staining of the lump (left) and under high magnification (right). (E) H&E staining shows areas of necrosis (left), invasion of adjacent skeletal muscle (middle), and invasion of adipose tissue (right). (F) H&E staining of the lung metastasis. (G) Immunohistochemical staining for Ki-67 in the lump. Scale bar represents 50 µm.

Kras activation and Pten deletion are crucial for the development of the subcutaneous lumps

To understand the molecular mechanism underlying the efficient development of these subcutaneous lumps, the specific genetic events caused by Kras activation and Pten deletion were explored. We used PCR analysis to identify the recombination of the conditional alleles in the tumor, with the normal tissues from the corresponding mice as a control (). Cre-mediated recombination was further confirmed by examining Pten protein expression in the tumor using IHC staining () and Western blotting (). We reasoned that the activation of the pathways downstream oncogenic Kras activation and Pten deletion contributed to the pathogenesis of these lumps. As expected, high levels of phosphorylated MAPK, an effector of oncogenic Kras, suggested the activation of MAPK pathway (). Furthermore, enhanced phosphorylation of AKT, mTOR, and p70S6K indicated the activation of the PI3K-Akt-mTOR pathway (). We further examined similar changes in the levels of key proteins in the tumor mass preparations using Western blotting (). Collectively, these findings indicated that oncogenic activation of Kras and deletion of Pten were crucial in the pathogenesis of the subcutaneous tumor.

Figure 2

Role of Kras and Pten in the development of the subcutaneous lumps. (A) Gel electrophoresis of PCR amplification products. T1 and T2 are tumor tissues and N1 and N2 are normal tissues (liver tissue) from the indicated mice (lane 2, 4). Ascites cells indicated cells collected from the hemorrhagic ascites. (B) Immunohistochemical staining for Pten in the tumor section (left), positive control (ID8 cells allograft), and negative control (recombined KrasG12D/Pten ovarian cancer) (right). (C) Western blotting for Pten protein. (D) Immunohistochemical staining for p-MAPKThr202/Tyr204, p-mTORSer2448, p-S6KThr389, and p-AKTSer473 (left), positive control (recombined KrasG12D/Pten ovarian cancer), and negative control (recombined KrasG12D/Pten ovarian cancer with INK128 treatment for p-mTORSer2448, p-S6KThr389 and p-AKTSer473, and PD0325901 treatment for p-MAPKThr202/Tyr204 (right). (E) Western blotting for key proteins from the lumps and normal tissues. Scale bar represents 50 μm.

Histopathological analysis identified the lumps as aggressive soft tissue sarcomas (STSs) with a mesenchymal origin

We first evaluated the histopathological signatures of the subcutaneous tumors to understand the type of disease to which they belong. IHC revealed that the lumps did not show epithelial differentiation, indicated by negative staining of cytokeratin 8 (). Moreover, the intense positive staining for vimentin, the canonical mesenchymal marker, implied the mesenchymal origin of the tumor (). Consistently, the lung metastases showed no staining for cytokeratin 8 but were positively stained for α-smooth muscle actin (α-SMA) (). Thus, we concluded that the subcutaneous lumps developed in our model of ovarian cancer were mesenchymal-derived STSs.

Figure 3

Histopathological analysis identified the sarcomas as aggressive soft tissue sarcomas with mesenchymal origin. (A) Immunohistochemical staining for cytokeratin 8 (left) and vimentin (right) in the lumps. (B,C) Immunohistochemical staining for cytokeratin 8 (B) and α-SMA (C) in the lung metastases. Scale bar represents 50 µm.

The STSs showed properties of RMS

AS STSs have histological diversity, intricate molecular profiles, various biological behaviors, and different clinical syndromes, we next explored the specific histopathological properties of the STSs to make a differential diagnosis. According to the diagnostic standard in human STSs, diffuse expression of desmin and focal positivity for α-SMA in the subcutaneous lumps indicated them to be RMS, leiomyosarcoma, or low-grade myofibroblastic sarcoma (). We analyze published transcriptional data of diverse kind of human sarcomas from the Oncomine database (http://www.oncomine.org) and found that the up-regulation of myoD1 and myogenin were specific to RMS (). Indeed, the lumps showed specific and intensely positive staining for myogenic markers, myoD1 and myogenin (), which are sensitive and specific diagnostic molecular biomarkers of RMS (21). Based on these results, we diagnosis the STSs developed in our model as RMS. To reveal genomic alterations of Kras and Pten in human RMS, we then analyzed their alterations at genomic levels using cBioPortal database (https://www.cbioportal.org/). Kras mutations were found in 6.9% RMS while Pten loss is genomically rare, though it can be found in other types of sarcomas (). Collectively, these results indicated that the lumps developed in our model were RMSs.

Figure 4

The soft tissue sarcomas (STSs) displayed properties of rhabdomyosarcoma. (A) Immunohistochemical staining for desmin (left) and α-SMA (right) in the tumor. (B) Transcriptional levels of myoD1 and myogenin in the published data via Oncomine. The numbers in the round brackets represent the specific number of cases. (C) IHC staining of MyoD1 and myogenin in the STSs. (D) The genetic alterations of Kras and Pten as given in published data. Scale bar represents 50 µm.

Reduced leakage of AdCre-eGFP decreased the formation of the subcutaneous lumps

The anatomical location and course of the lumps were different from ovarian cancer; therefore, we hypothesized that the accidental exposure of the adjacent tissues to AdCre-eGFP is responsible for the lump development. To improve our mouse model work great, we replicated the genetic manipulations while modifying several methods to significantly decrease the incidence rate of the subcutaneous lumps. First, the syringes we initially used were too large to easily control the volume injected, which frequently resulted in injecting >5 µL of the Adcre-eGFP solution, which is the maximum volume recommended in the previous reports (19,22,23). Second, the medium containing AdCre-eGFP was transparent, making it difficult to track the intrabursal injection and to ensure that there is no spillage or leakage. Thus, we added trypan blue to the medium for tracking the spread of the injected solution. Additionally, we were not sufficiently skillful to perform the intrabursal injection in our early attempts, which likely increased the chance for AdCre-eGFP leakage. In addition, we also performed a peritoneal lavage with saline to decrease the accidental exposure of AdCre-eGFP to other normal tissues. With the above improvements to our genetic manipulation protocols, the incidence of RMS was significantly decreased (1/10, 10%). This makes our mouse model as a practical tool for investigations of ovarian cancer.

Discussion

In this study, we demonstrated that subcutaneous lumps unexpectedly develop around the surgical incision during the establishment of a mouse model of ovarian cancer driven by Kras activation and Pten deletion. Cre-mediated recombination of Kras and Pten were confirmed in the tumor, and the activation of downstream pathways was consistent with the specific genetic events. Histological and histopathological analysis determined these subcutaneous tumors as RMSs. We confirmed that the malignant transformation of non-target tissues due to the accidental exposure to adenovirus contributed to the RMS development.

Activation of oncogenes and/or the loss of tumor suppressing genes causes alteration of healthy tissues into malignancies. Tissue-specific context, that is, the cells of origin of tumors, have been considered as important determinants of the susceptibility to oncogenic transformation (24,25). Herein, transformation of non-specific cell types can occur upon in vivo genetic manipulations during establishment of the mouse model, which has been indicated in previous reports. Low specificity of cell/tissue-specific promoters in these genetically modified mouse models partially explains the non-specific genetic alterations (26-29). However, in these models that are dependent on genetic manipulations by virtue of adenovirus or lentivirus infections, direct exposure of adjacent tissues and/or the accidental exposure due to indefinite borderlines contribute to such unexpected results. According to previous reports, AdCre-mediated conditional mutations in Kras and p53 in skeletal muscle tissues induce high-grade sarcomas with myofibroblastic differentiation (30), whereas dual Pten and p53 suppression in the smooth muscle lineage promotes the progression of sarcoma (31). In addition, simultaneous Kras activation and p53 inactivation induces sarcoma formation in the soft tissues due to accidental leakage of recombinant AdCre from the suture site; Further, it leads to urothelial hyperplasia in the bladder (32). In an effort to establish ovarian cancer mouse model, simultaneous inactivation of p53 and Rb1 in OSECs induced epithelial ovarian cancer (33,34), whereas conditional inactivation of Brca1, p53, and Rb by intrabursal administration of AdCre unexpectedly transforms the bursal membrane cells to develop leiomyosarcomas (23). In our study, the exposure of OSECs and abdominal muscle tissues to AdCre-eGFP induced ovarian cancer and RMS, respectively, in mice harboring conditional alleles of LSL-KrasG12D and PtenFl/Fl. We postulated that the leakage from the pin hole was mainly responsible for the accidental development of RMS. Development of RMS was remarkably reduced after improvement in technique, which facilitated this mouse model to be used as a practical model for investigations of ovarian cancer.

RMS is an aggressive subtype of STSs with vague etiology and vast heterogeneity (35). Although it is thought to arise from a skeletal muscle lineage, RMS is a malignant tumor with mesenchymal origin (36). Owing to the diversity of clinicopathologic characteristics, morphologic patterns, and histologic categories, molecular markers identified using IHC, such as desmin, α-SMA, myoD1 and myogenin, are considered an important tool for the positive diagnosis of STSs (37). Importantly, myogenin is a specific and an independent marker of poor survival for patients with RMS (38-40). From a genomic perspective, 3.9% of human RMS samples carry Pten mutations, whereas 0% to 44% samples carry Ras mutations, suggesting the haploinsufficiency of Ras or Pten mutations alone. Nevertheless, the coordinated genetic alterations of Kras and Pten in RMS are poorly unknown. Recently, integrated genetic and epigenetic analyses of human RMS have unveiled the prevalence of the receptor tyrosine kinase/Ras/Pik3ca axis and Pten methylation, which are reported in up to 93% and 70% of cases, respectively (41). Therefore, simultaneous Kras activation and Pten inactivation may be essential for the development of RMS, which complicates the establishment of a stable model of OEA in mice harboring conditional alleles of LSL-KrasG12D and PtenFl/Fl.

In conclusion, non-specific genetic alterations induce development of RMS in the mouse model of KrasPten-driven ovarian cancer, indicating the importance of carefully avoiding inappropriate exposure of genetic manipulations to non-specific tissues.