Yonghuan Mao1, Ling Xi2, Quan Li3, Xinhua Zhang4, Chunzhao Yu3. 1. Department of General Surgery, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, China. 2. Department of Gerontology, Jiangsu Province Official Hospital, Nanjing, China. 3. Department of General Surgery, the Second Affiliated Hospital of Nanjing Medical University, Nanjing, China. 4. Department of Pediatric Medicine, Jiangsu Province Hospital, Nanjing, China.
Abstract
BACKGROUND: Polo-like kinase 1 (Plk1) is overexpressed in different types of carcinomas, and it is widely pursued as a novel target for treatment of neoplasms. However, the role of Plk1 in invasion and metastasis of pancreatic cancer has not been reported. METHODS: In order to evaluate whetherPlk1 can potentially serve as a therapeutic target in pancreatic cancer, we herein explore and discuss the relationship between the inhibition of Plk1 by RNA interference (RNAi) and invasion and metastasis of pancreatic cancer cells. For this, three pancreatic cancer cell lines (AsPC-1, BxPC-3, and PANC-1) were studied. Plk1-specific short hairpin RNAs (shPlk1) were introduced into these cell lines by viral transduction. RESULTS: We found that Plk1 mRNA and protein levels were significantly reduced in the shPlk1 group. Moreover, knockdown of Plk1 expression by shPlk1 promoted apoptosis, while cell invasion and metastasis potentials were significantly reduced. CONCLUSIONS: Plk1 expression levels were closely correlated with proliferation, invasion, and metastasis of pancreatic cancer, and inhibition of Plk1 expression by RNAi could promote cell apoptosis and suppress metastasis and invasion of pancreatic cancer cells in vitro. Furthermore, Plk1 might constitute novel target for treatment of pancreatic cancer, with inhibition of Plk1 potentially providing a new strategy for the prevention of pancreatic cancer invasion and metastasis. 2020 Translational Cancer Research. All rights reserved.
BACKGROUND: Polo-like kinase 1 (Plk1) is overexpressed in different types of carcinomas, and it is widely pursued as a novel target for treatment of neoplasms. However, the role of Plk1 in invasion and metastasis of pancreatic cancer has not been reported. METHODS: In order to evaluate whetherPlk1 can potentially serve as a therapeutic target in pancreatic cancer, we herein explore and discuss the relationship between the inhibition of Plk1 by RNA interference (RNAi) and invasion and metastasis of pancreatic cancer cells. For this, three pancreatic cancer cell lines (AsPC-1, BxPC-3, and PANC-1) were studied. Plk1-specific short hairpin RNAs (shPlk1) were introduced into these cell lines by viral transduction. RESULTS: We found that Plk1 mRNA and protein levels were significantly reduced in the shPlk1 group. Moreover, knockdown of Plk1 expression by shPlk1 promoted apoptosis, while cell invasion and metastasis potentials were significantly reduced. CONCLUSIONS: Plk1 expression levels were closely correlated with proliferation, invasion, and metastasis of pancreatic cancer, and inhibition of Plk1 expression by RNAi could promote cell apoptosis and suppress metastasis and invasion of pancreatic cancer cells in vitro. Furthermore, Plk1 might constitute novel target for treatment of pancreatic cancer, with inhibition of Plk1 potentially providing a new strategy for the prevention of pancreatic cancer invasion and metastasis. 2020 Translational Cancer Research. All rights reserved.
According to statistics from America and Europe, the prognosis of pancreatic cancer (PC) is very poor, ranking it the fourth leading cause of cancer deaths (1). Pancreatectomy is the only effective method to cure this disease, but only 20% of patients are provided with the opportunity to resect the cancer tissue (2). Despite all these efforts, most of the patients are known to relapse (3). Distant metastasis is a major cause of death in cancer patients, especially with respect to PC. Only few cases do not show resistance to chemo- or radiation therapy (4). Patients with metastatic disease have a median survival of 6 months and a 5-year survival rate of 1%, whereas treatment with surgical resection and other therapeutic approaches is associated with 12–22 months of median survival and a 5-year survival rate of 20–25% (5). Hence, PC poses one of the greatest challenges in cancer research. Nevertheless, our increasing knowledge on the development of PC will help us find a cure for this debilitating disease (6-12). Nowadays, several signaling pathways were found as targets in PC, for examples, NF-κB is recognized as a key mediator of inflammation and has been frequently observed to play the crucial role in PC (13). Also, Hippo pathway, a key regulator of organ size, tissue hemostasis and regeneration, was reported to regulate the chemoresistance and prognosis in PC (14).Polo-like kinase 1 (Plk1) is an important serine/threonine kinase involved in the process of mitosis. Plk1 is highly expressed in most neoplastic tissues compared to healthy tissues (15-18), and its deregulation affects the occurrence and development of tumors (19,20). It is reported that Plk1 could enhance efficacy of Olaparib in castration-resistant prostate cancer (21). Cervical cancer growth was also regulated via c-ABL-Plk1 axis (22). Our previous reports showed that down-regulating Plk1 can activate apoptosis-related pathways, such as caspase-related and Bcl-2 family-mediated pathways, leading to cell death. Furthermore, our findings confirm that suppression of PI3K/Akt and Plk1 combined with gemcitabine could be a potential therapeutic regimen for PC patients, but further efforts are needed (23).A limited number of studies have demonstrated the possible relationship between the negative regulation of Plk1 and the development of tumors (24-28). Some cancers, like colorectal carcinoma and lung cancer, are caused by K-RAS mutations. Cells with high expression of K-RAS can be selectively killed without hurting normal cells by silencing Plk1 expression. In vitro and in vivo experiments have highlighted different ways to influence the activity and/or function of Plk1 for induction of tumor cell apoptosis (29,30). A lot of research is committed to using Plk1 as a means for targeted cancer treatment, especially through the development of small molecule inhibitors, which could be used as drugs for the treatment of various cancers (31-35). Knockdown of Plk1 using RNA interference technologies, like small interfering RNAs (siRNAs), led to cell cycle arrest and apoptosis of tumor cells, but had no effect on normal cells (36-38). Of note, 47.7% of invasive PCs are Plk1 positive, highlighting that Plk1 expression is closely related to malignancy of PC in some cases (39). In this study, we report that suppression of Plk1 expression in PC results in inhibition of cell invasion and migration, and induces apoptosis. We present the following article in accordance with the MDAR checklist (available at http://dx.doi.org/10.21037/tcr-20-1019).
Methods
Construction of recombinant adenovirus (rAd)-Plk1-shRNAs (rAd-shPlk1)
We selected different regions of the Plk1 transcript according to its gene sequence, and synthesized four shRNAs using the pYr-1.1 vector (hU6/EGFP/Neo) (Changsha Yingrun Biotechnology Co. Ltd, China) (). After gene sequence analysis, pYr-1.1-Plk1-shRNA2 and pYr-1.1-Plk1-shRNA4 () were introduced into the adenoviral vector pAd/PL-DEST (Changsha Yingrun Biotechnology Co. Ltd, China) through homologous recombination in vitro. HEK 293 cells were used for packing in to rAd (). By restructuring, both Plk1-sh2 and -sh4 could work effectively, and Plk1-sh4 proved superior to Plk1-sh2 (). Plk1-sh4 was finally selected for the following study, and was set as rAd-shPlk1, while rAd-EGFP (empty vector) served as experimental control.
Information on the targeting different regions of the Plk1 transcript
Number
Target sequences (5'-3')
Target region
PLK1-shRNA1
CGAGCTGCTTAATGACGAGTT
CDS
PLK1-shRNA2
CCCGAGGTGCTGAGCAAGAAA
CDS
PLK1-shRNA3
GCTCATCTTGTGCCCACTGAT
CDS
PLK1-shRNA4
GCAGCGTGCAGATCAACTTCT
CDS
Figure 1
Construction of rAd-shPlk1. (A) Structure of pYr-1.1-Plk1-shRNA4. (B) Accumulation of rAd in HEK 293 cells. (C) Verification and validation of rAd-shPlk1 using HeLa cells through qRT-PCR.
Construction of rAd-shPlk1. (A) Structure of pYr-1.1-Plk1-shRNA4. (B) Accumulation of rAd in HEK 293 cells. (C) Verification and validation of rAd-shPlk1 using HeLa cells through qRT-PCR.
Cell culture, adenovirus transduction, and RNAi
We selected the PC cell lines AsPC-1, BxPC-3, and PANC-1as research objects. The cells were cultured at 37 °C and 5% CO2 in RPMI 1640 supplemented with 10% fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 U/mL). They were divided into three groups: control group (untransduced cells), rAd-EGFP group (transduced with the empty vector control), and rAd-shPlk1 group (transduced with rAd-shPlk1). The cells were seeded on 6-well plates and cultured to 60% confluence prior to adenoviral transduction. For this, they were incubated with adenoviruses carrying vectors for expression of either EGFP or shPlk1 at a multiplicity of infection of approximately 106. Cells were collected for quantitative real-time PCR (qRT-PCR) and western blotting at 12 and 24 hours after transduction.
Detection of changes in Plk1 mRNA levels by qRT-PCR
TRIzol reagent was used for isolation of total RNA, and cDNA was synthesized according to the manufacturer’s instructions (Promega, Madison, WI, US). Afterwards, we employed the same amount of cDNA for each of the samples for analysis by qRT-PCR. Specific forward (5’-GCTGGGCAACCTTTTCCTG-3’) and reverse (5’-GCAGTGGGATCTGTCTGAAGC-3’) primers were used to detect Plk1gene expression in cells of the different groups. GAPDH served as internal standard, using the following primers: 5’-ATCCCATCACCATCTTCCAGG-3’ (forward) and 5’-CCATCACGCCACAGTTTCC-3’ (reverse). Plk1 and GAPDH gene amplifications were carried out for30 and 25 cycles, respectively.
Analysis of changes in Plk1 protein levels by western blotting
Cells were washed three times with phosphate buffered saline (PBS, 4 °C), and cellular protein was subsequently collected by lysis in 80 µL of RIPA buffer at 4 °C for 20 minutes. Removal of cell debris was performed by centrifugation at 12,000×g and 4 °C for 15 minutes, and the supernatant was collected for subsequent analyses. Afterwards, the Bio-Rad protein assay was used to determine the protein concentrations, and the same amount of protein (40 µg) per group was separated by electrophoresis, and subsequently transferred to polyvinylidene fluoride membranes (Amersham, USA). The membranes were blocked by incubation in 5% non-fat milk in Trisbuffered saline for 1 hour, followed by incubation with primary antibodies overnight at 4 °C. Anti-Plk1 monoclonal antibody (Cell Signaling Technology, Inc., USA) was used at 1 µg/mL. The membranes were then incubated for 1 h with horseradish peroxidase-conjugated goat anti-rabbit antibody (Santa Cruz Biotechnology, Inc., USA) at a 1:30,000 dilution. Electrochemiluminescence was detected on a ChemiDoc XRS+ Gel Imaging System. Next, in order to ensure that the same amount of protein had been loaded, the membranes were washed three times with Trisbuffered saline and re-incubated with an antibody directed against GAPDH.
Apoptosis analysis by flow cytometry
We collected the cells transduced with adenovirus at different time points, after which they were washed twice with PBS (4 °C), and re-dissolved in 1× binding buffer (BD Pharmingen, USA) to obtain a concentration of 1×106 cells/mL. Afterwards, 100 µL of the suspension (1×105 cells) were transferred to a 5 mL tube. After addition of 5 µL of APC AnnexinV (BD Pharmingen, USA) and 7-AAD (BD Pharmingen, USA) each, 400 µL of 1× binding buffer were added to each tube, after which the cells were incubated at 25 °C in the dark for 15 minutes. Cells were subsequently analyzed by flow cytometry (BD FACSCalibur equipped with CellQuest Pro) within 1 hour.
Transwell methods to detect cell migration and invasion
Sub-culturing of the cells in the upper chamber was performed until reaching 90% confluence. Next, 5×106 cells were suspended in 1 mL of serum-free culture medium. Half of the cell suspension (500 µL) was cultured in the upper chamber of the 24-welltranswell chamber, and 800 µL of culture medium mixed with 2% fetal bovine serum were added to the lower chamber. The Transwell cultures were cultured at 37 °C and 5% CO in an incubator for 12 hours to detect cell migration. Different from migration assays, matrix (Corning Matrigel) mixed with serum-free RPMI 1640 medium at a 1:5 ratio was added to the upper chamber, and the cells were then added and incubated at 37 °C and 5% CO for 24 hours before being used to detect cell invasion. The remaining liquid was removed before use. The cells were sub-cultured in the invasion chamber until reaching 80% confluence. As for the cell migration assay, 2.5×105 cells in 500 µL were cultured within one invasion chamber on a 24-well plate, and 800 µL culture medium mixed with 5% fetal bovine serum were added to the lower chamber. Subsequently, the cells were cultured under the aforementioned conditions for 24 hours to detect cell invasion. Following this, the cells on the upper surface of the membrane were cleared, and the cells on the underside of the membrane were stained with 0.1% crystal violet for 15 minutes. The samples were observed and imaged on a microscope at 10× to 20× total magnification, depending on the cell density. Crystal violet was rinsed off using 33% acetic acid, and the plate readout was performed on an ultraviolet spectrophotometer. Cell numbers were converted to OD values (except for AsPC-1 cells, which were counted at 100× magnification).
Statistical analysis
All of the experiments were repeated three to four times, and the data are presented as mean ± SD. Statistical analysis was performed using SPSS 21.0 software. Comparisons between two groups were conducted using Welch’s t-test. ANOVA was used for more than two groups, followed by Bonferroni test among different groups. Differences were considered statistically significant at P<0.05. P values indicating statistically significant differences were set as *P<0.05, **P<0.01, and ***P<0.001.
Results
Transduction with shPlk1 down-regulates Plk1 mRNA and protein levels in human PC cell lines
To detect the effect of shPlk1 on mRNA and protein levels of Plk1 in PC cell lines, we used qRT-PCR and western blotting, respectively. Results obtained by qRT-PCR indicated that the Plk1 mRNA levels were significantly different in the three groups, while total RNA levels were equal. More specifically, expression in the rAd-shPlk1 group was markedly lower than in the rAd-EGFP group (P=0.0006) (). Western blotting results indicated that the total amount ofPlk1 protein in the rAd-shPlk1 group was lower than in the rAd-EGFP group (P=0.0009) (). According to the above results, we found that Plk1 was down-regulated by shPlk1 with regard to both mRNA and protein levels in all PC cell lines tested.
Figure 2
Plk1 expression was inhibited in the rAd-shPlk1 group in pancreatic cancer cells. (A) Quantified relative expression levels of Plk1 in AsPC-1, BxPC-3, and PANC-1 cells, with GAPDH serving as reference. (B) Western blotting (WB) assays for detection of Plk1 in AsPC-1, BxPC-3, and PANC-1 cells. (C) Relative Plk1 protein density normalized to GAPDH according to the WB results. rAd-EGFP vs. rAd-shPlk1 groups, ***P<0.001.
Plk1 expression was inhibited in the rAd-shPlk1 group in pancreatic cancer cells. (A) Quantified relative expression levels of Plk1 in AsPC-1, BxPC-3, and PANC-1 cells, with GAPDH serving as reference. (B) Western blotting (WB) assays for detection of Plk1 in AsPC-1, BxPC-3, and PANC-1 cells. (C) Relative Plk1 protein density normalized to GAPDH according to the WB results. rAd-EGFP vs. rAd-shPlk1 groups, ***P<0.001.
Knockdown of Plk1 by shPlk1 induces apoptosis in PC cells
To test the effect of shPlk1-mediated down-regulation of Plk1 in pancreatic tumor cell lines, we used flow cytometry for analyzing apoptosis in the three groups. The results of this experiment are shown in . Cytograms of APC Annexin V binding (abscissa) versus 7-AAD uptake (ordinate) show three distinct populations: (I) viable cells (low APC and low 7-AAD signals) in gate LL; (II) early apoptotic cells (high APC and low 7-AAD signals) in gate LR, and (III) cells that have lost membrane integrity as a result of very late apoptosis (high APC and high 7-AAD signals) in gate UR. According to these data, we can conclude that within 24 hours, there is no significant difference in the three groups with regard to their apoptosis rates (P=0.058); however, after 48 hours, the apoptosis rate in the rAd-shPlk1 group was higher than in the other two groups (P=0.007). In line with this, the viable cell number in the rAd-shPlk1 group was significantly lower than in the rAd-EGFP group at all time points analyzed (P=0.003) (). Therefore, we inferred that shPlk1 could induce apoptosis of PC cells.
Figure 3
Analysis of apoptosis in control, rAd-EGFP, and rAd-shPlk1 groups at 24, 48, 72, and 96 hours through flow cytometry. AsPC-1 (A), BxPC-3 (B), and PANC-1 (C) were transduced with vectors carryingrAd-shPlk1, rAd-EGFP (vector control), and control constructs. Apoptosis induction in the three cell lines was determined at 24, 48, 72, and 96 hours after the treatment, respectively. (D,E,F) There was no significant difference among the three separate treatments after 24 hours. Compared to control and rAd-EGFP groups, the number of viable cells of the rAd-shPlk1 group was significantly decreased after 48 hours (***, P<0.001).
Analysis of apoptosis in control, rAd-EGFP, and rAd-shPlk1 groups at 24, 48, 72, and 96 hours through flow cytometry. AsPC-1 (A), BxPC-3 (B), and PANC-1 (C) were transduced with vectors carryingrAd-shPlk1, rAd-EGFP (vector control), and control constructs. Apoptosis induction in the three cell lines was determined at 24, 48, 72, and 96 hours after the treatment, respectively. (D,E,F) There was no significant difference among the three separate treatments after 24 hours. Compared to control and rAd-EGFP groups, the number of viable cells of the rAd-shPlk1 group was significantly decreased after 48 hours (***, P<0.001).
Down-regulation of Plk1 can inhibit PC cell invasion and migration
In order to detect whether down-regulation of Plk1 could affect PC cell invasion and migration, we transduced PC cells with rAd-shPlk1, and then evaluated cell migration and invasion capacities through transwell assays. Thereby, we showed that the number of cells that had migrated through the artificial basement membrane or/and Matrigel matrix from the rAd-shPlk1 group was significantly reduced compared the other two groups (P=0.004) ().
Figure 4
Effect of rAd-shPlk1 on pancreatic cancer cell migration and invasion. Images of migrating and invading AsPC-1 (A), BxPC-3 (B), and PANC-1 (C) cell lines taken on a microscope at a magnification of 100× (crystal violet staining). (D,F,H) Compared to the rAd-EGFP group, the migration ability of the rAd-shPlk1 group was markedly decreased (**, P<0.01; ***, P<0.001). (E,G,I) Comparison of the invasion capacities of the three groups, highlighting a significant reduction in the invasion capacity of the rAd-shPlk1 group (**, P<0.01; ***, P<0.001).
Effect of rAd-shPlk1 on pancreatic cancer cell migration and invasion. Images of migrating and invading AsPC-1 (A), BxPC-3 (B), and PANC-1 (C) cell lines taken on a microscope at a magnification of 100× (crystal violet staining). (D,F,H) Compared to the rAd-EGFP group, the migration ability of the rAd-shPlk1 group was markedly decreased (**, P<0.01; ***, P<0.001). (E,G,I) Comparison of the invasion capacities of the three groups, highlighting a significant reduction in the invasion capacity of the rAd-shPlk1 group (**, P<0.01; ***, P<0.001).
Discussion
As mentioned above, the high mortality rate of PC patient urgently requires us to find the factors associated with cell proliferation, invasion, metastasis, and apoptosis, as well as the molecular mechanisms underlying these processes. Plk1, an indispensable factor in the process of cell proliferation, is highly expressed in a great proportion of PC cases, and in many other tumors (40). Lots of researches showed that metastasis in cancer patients and overall survival rates are associated with high Plk1 expression (41-43). Our previous study indicated that forced Plk1overexpression promoted cell proliferation and an increase in the percentage of cells in the G1/S phase, but a reduction in the G2/M phase cell population. We also found that siRNA-mediated knockdown of Plk1 caused cell cycle arrest in G2/M and proliferation inhibition (42). This research was devised to investigate the effect of Plk1 in apoptosis, invasion, and migration of human PC cell lines.There are several strategies available, like anti-sense oligonucleotides (ASO), siRNAs, and small molecules, which can be employed to deplete or inhibit expression of Plk1 (43-46). However, in our present study, an shRNA against Plk1 was our method of choice on account of the same interference efficiency, but with a longer interference time compared to the siRNA-based strategy.This was our first time to construct an adenoviral vector for introduction of shPlk1. In order to exclude that apoptosis induced by shPlk1 had an impact on invasion and migration, we examined PC cell apoptosis at different time points, and found that there was no significant difference in apoptosis induction among the three different conditions tested at 24 hours. Together, our data suggest that suppression of Plk1 expression caused an inhibition of invasion and migration capacities of PC cells. This finding powerfully supports the idea that Plk1 is a significant, decisive factor for invasion and metastasis of PC cells. Although our study showed that down-regulation of Plk1 exerts this effect on invasion and migration in PC cells, lower levels of Plk1 are not necessarily beneficial. The treatment effect of Plk1 in pancreatic cancer was still unknown. We need further study in vivo and vitro to verify the effect of Plk1 on pancreatic cancer. It was reported that down-regulating the expression of Plk1 could still lead to aneuploidy and tumorigenesis (47). Therefore, it is important to maintain endogenous levels of Plk1 for mitosis to proceed normally, and attention should be paid to side effects, such as tumorigenesis, should Plk1 inhibitors be used in clinical trials.At present, it is believed that Plk1 leads to epithelial-mesenchymal transition and affects the invasion and metastasis of tumor tissues (48). Cai et al. found that Plk1 regulates both metastasis and epithelial-mesenchymal transition of gastric cancer cells through regulation of the AKT pathway, and Wu et al. showed Plk1 to be involve directly in the phosphorylation of CRAF, with subsequent stimulation of the MEK1/2-ERK1/2-Fra1-ZEB1/2 signaling pathway, thus leading to epithelial-mesenchymal transition, which in turn regulates invasion and metastasis of metastatic prostate cancer (49,50). During this study, the exact molecular mechanisms underlying the effects of Plk1on invasion and metastasis of PC were not investigated, and this will be addressed in future studies.
Conclusions
In conclusion, our study shows that the expression of Plk1 is closely related to invasion and metastasis of PC, and that shRNA-dependent down-regulation of Plk1 can lead to inhibition of PC cell migration and invasion in vitro. Further studies using animal models will pave the way for future clinical trials for the development and implementation of Plk1 inhibitors or RNAi-mediated Plk1 gene silencing strategies to complement current therapeutic approaches for PC. Certainly, further efforts to investigate the mechanisms behind PC development and progression induced by Plk1are warranted.
Authors: Yongzhen Qian; Emily Hua; Kheem Bisht; Stephan Woditschka; Konstantine W Skordos; David J Liewehr; Seth M Steinberg; Edi Brogi; Muzaffar M Akram; J Keith Killian; Daniel C Edelman; Marbin Pineda; Stephanie Scurci; Yan Y Degenhardt; Sylvie Laquerre; Thomas A Lampkin; Paul S Meltzer; Kevin Camphausen; Patricia S Steeg; Diane Palmieri Journal: Clin Exp Metastasis Date: 2011-09-21 Impact factor: 5.150
Authors: Jie Li; Ruixin Wang; Yifan Kong; Meaghan M Broman; Colin Carlock; Long Chen; Zhiguo Li; Elia Farah; Timothy L Ratliff; Xiaoqi Liu Journal: Mol Cancer Ther Date: 2017-01-09 Impact factor: 6.261
Authors: Peter J Campbell; Shinichi Yachida; Laura J Mudie; Philip J Stephens; Erin D Pleasance; Lucy A Stebbings; Laura A Morsberger; Calli Latimer; Stuart McLaren; Meng-Lay Lin; David J McBride; Ignacio Varela; Serena A Nik-Zainal; Catherine Leroy; Mingming Jia; Andrew Menzies; Adam P Butler; Jon W Teague; Constance A Griffin; John Burton; Harold Swerdlow; Michael A Quail; Michael R Stratton; Christine Iacobuzio-Donahue; P Andrew Futreal Journal: Nature Date: 2010-10-28 Impact factor: 49.962
Authors: W Weichert; C Denkert; M Schmidt; V Gekeler; G Wolf; M Köbel; M Dietel; S Hauptmann Journal: Br J Cancer Date: 2004-02-23 Impact factor: 7.640