Overexpression of Eukaryotic translation initiation factor 3D induces stem cell-like properties and metastasis in cervix cancer by activating FAK through inhibiting degradation of GRP78.

Cervix cancer (CC) is the most common gynecological malignancy and the leading cause of morbidity among women worldwide. Previous study indicated that cancer stem cells (CSCs) existed in cervix cancer, and suppressing CSC characteristics of cervix cancer is needed to combat this disease. Eukaryotic translation initiation factor 3 (EIF3) is one of the most complex eukaryotic translation initiation factors containing 13 subunits (EIF3A-EIF3M) and it regulates eukaryotic translation. One member of EIF3, EIF3D, plays a role in the progression and development of multiple tumors. However, its possible role in cervix cancer progression is still unclear. In this study, we found the high EIF3D expression in human cervix cancer tissues. We further found that downregulation of EIF3D suppressed the proliferation and motility of cervix cancer cells. Furthermore, its downregulation restrained the stem cell-like properties of cervix cancer cells. Mechanically, we found that EIF3D promoted FAK activation through GRP78 in cervix cancer cells, thus contributing to the progression of cervix cancer. Therefore our results suggested that EIF3D could serve as a promising target of cervix cancer.

Introduction

Cervix cancer (CC) is the most common gynecological malignancy and the leading cause of morbidity and cancer death among women worldwide [1,2]. Although there are many clinical treatment options for cervix cancer, about two-thirds of patients are diagnosed with advanced cervix cancer, and their survival rate is low [3]. Cancer stem cells (CSCs) are characterized by self-renewal, pluripotency, and expression of stem cell markers, which can increase the malignant progression of the tumor [2,4]. Studies have shown that CSCs exist in cervix cancer, and their potential stem cell markers include CD133, ALDH1, CD49, OPN or SOX2 [5]. How to target stem cell markers and inhibit CSC characteristics of cervix cancer is an urgent problem needed to be addressed to improve the prognosis of patients with advanced cervix cancer [6].

Eukaryotic translation initiation factor 3 (EIF3) is one of the most complex eukaryotic translation initiation factors, which contains 13 subunits (EIF3A-EIF3m) and it plays an important role in the regulation of eukaryotic translation [7]. EIF3D, as a key member of EIF3, plays a role in tumorigenesis and development [8]. EIF3D is highly expressed in pancreatic cancer tissues and promotes the cell cycle progression and motility of cancer cells [9]. EIF3D could promote the stability of GRK kinase and activate the Akt signaling pathway, thus promoting the malignant process of bladder cancer [10]. Depletion of ELF3D could inhibit the proliferation and migration of breast cancer cells by inhibiting the Wnt/β-catenin pathway [11]. In addition, ELF3D was significantly associated with the poor prognosis of patients with multiple cancers [12,13]. Notably, TCGA database analysis showed that ELF3D was highly expressed in cervix cancer. However, its possible role in cervix cancer progression is still unclear.

Previous study also indicated that EIF3D could interact with GRP78 and inhibit the degradation of GRP78, thereby promoting drug resistance in renal cell carcinoma [14]. Importantly, GRP78 was one of the markers of CSCs, and its high expression promotes the dry characteristics of tumors [15,16]. Therefore, we speculated that EIF3D might affect the stem cell-like properties of cervix cancer cells through GRP78.

In this study, we investigated the role of EIF3D in cervix cancer. We found that EIF3D was highly expressed in cervix cancer cells, and knockdown of EIF3D inhibited the proliferation, migration, and stem cell-like properties of cervix cancer cells. Further mechanistic studies confirmed that EIF3D promoted FAK activation through GRP78 in cervix cancer cells, thereby promoting cervix cancer progression. Our results suggest that EIF3D could be a potential therapeutic target for cervix cancer.

Materials and methods

Antibodies, shRNAs, and agents

EIF3D (1:500 for Immunoblot, 1:50 for IHC, ab155419, Abcam), Ki67 (1:100 for IHC, ab15580, Abcam), CD44 (1:500, ab189524, Abcam), CD133 (1:500 for Immunoblot, 1:100 for IHC, ab222782, Abcam), SOX2 (1:500, ab92494, Abcam), ALDH1 (1:1000, ab177463, Abcam), FAK (1:1000, ab40794, Abcam), p-FAK (1:500 for Immunoblot, 1:50 for IHC, ab81298, Abcam), GRP78 (1:500 for Immunoblot, 1:50 for IHC, ab38449, Abcam, ab21685, Abcam), and β-actin (1:2000, ab8226, Abcam) were diluted in the indicated ratio and purchased from the indicated company.

EIF3D shRNA and control shRNA were bought from Addgene. The sequence of shEIF3D was: 5ʹ -

GCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTT-3ʹ

GRP78 siRNA was bought from Riobio (China).

Patients and samples

Patients diagnosed with cervix cancer in Linyi Cancer Hospital were included in this study and the tumor tissues and corresponding normal tissues were collected. This study was approved by the Ethics Committee of Linyi Cancer Hospital. The clinical characteristics of patients have been provided in Table 1.

Table 1.

Clinical Information

Clinicopathological factor	Number of case	High EIF3D expression	Low EIF3D expression	P value
Total	60	32	28
Age (years)				0.382
< 60	25	15	10
≥ 60	35	17	18
HPV 16/18 infection				0.299
Positive	41	20	21
Negative	19	12	7
Tumor size				0.035*
< 4 cm	28	19	9
≥ 4 cm	32	13	19
TNM stage				0.006**
I/II	36	14	22
III/IV	24	18	6
Lymph node metastasis				0.664
Positive	21	12	9
Negative	39	20	19

*p < 0.05.

Immunohistochemistry (IHC) staining

Tumor specimens were fixed with 10% formalin solution, embedded in paraffin, then cut into 5-μm sections and baked at 70°C for 45 min. Immunohistochemistry kit (Biotin-Streptavidin, Beijing ZSGB-BIO Technologies) was used based on manufacturer’s guidelines. Then, sections were put into a microwave oven for antigen repairment and cooled at room temperature. Endogenous peroxidase was then blocked, and sections were incubated by antibodies at 4°C for 2 h, followed by a secondary antibody at 37°C for another 2 h. Sections were stained with 3,3-diaminobenzidin (DAB) for 10 min and images were observed by a microscopy (Olympus).

Cell culture

3 types of human cervix cancer cell lines HeLa, CaSKi, and SiHa, and 1 type of normal cervix cell line H8, were purchased from ATCC. These cells were all cultured in RPMI-1640 medium containing 1% penicillin-streptomycin and 10% FBS. Both cell lines were grown at 37°C with 5% CO2.

qPCR

The total RNA was extracted at 2 µg and then reversely transcribed to cDNA template by the M-MuLV cDNA Synthesis Kit (Sangon Biotech, China). RT-qPCR was performed on a Smart Cycler using FastSYBR Mixture (Sangon Biotech, China). The relative EIF3D mRNA levels were normalized to GAPDH levels by using 2− deltaCT method. The sequences of primer are listed as follow: EIF3D (Forward) 5ʹ-CTGGAGGAGGGCAAATACCT – −3ʹ, and (Reverse) 5ʹ- CTCGGTGGAAGGACAAACTC −3ʹ; GAPDH (Forward) 5ʹ-TGATGACATCAAGAAGGTGGTGAAG −3ʹ, and (Reverse) 5ʹ-TCCTTGGAGGCCATGTGGGCCAT −3ʹ.

Immunoblotting

Samples were lysed by RIPA buffer (Beyotime, China), and the concentrations of total proteins were detected using the BCA kit (Beyotime, China). Lysates were then isolated by 8% SDS-PAGE and transferred onto PVDF membrane (Thermo, American). Membranes were blocked by 5% fat-free milk and incubated with the primary antibodies at 4°C for another 1.5 h. The membranes were incubated with secondary antibodies for 1.5 h and visualized by chemiluminescence.

MTT assay

1000/well of HeLa cells were plated in 96-well plates and cultured at 37°C. At 24, 48, and 72 h time point, we used 10 μl of MTT for each well for 4 h. After washing with PBS twice, the stained cells were isolated with 150 μl DMSO. The absorbance was measured at 490 nm wavelength.

Transwell assay

HeLa cells were transfected and then re-suspended in medium without serum. The upper chambers of 8.0 µm membrane pore transwell filters with (invasion assays) or without (migration assays) 20% matrigel in RPMI-1640 and maintained at 37°C for 30 min. Then HeLa cells with the volume of 80 µL were added to the upper chambers to induce the migration or invasion. After 24 hours, the cells in top were removed, and the remaining cells were then fixed by 4%PFA and stained with 0.1% crystal violet. The OD value was measured at 450 nm wavelength.

Mammosphere-forming efficiency (MSFE) assay

The freshly isolated MECs were plated in triplicate on 6-well ultra-low attachment plates (Corning) in RPMI-1640 medium without serum. MECs were then seeded at 10,000 cells/well and maintained for 7 days to allow for primary sphere formation.

Xenograft assay

The animal experiments protocol was approved by the ethics committee of Linyi Cancer Hospital. 12 female 6-week-old BALB/c nude mice were purchased from Vital River. Cells stably transfected with shRNAs were inoculated into the upper back of mice. Tumor volume was monitored every 7 days. After 28 days, tumors were harvested, and mice were sacrificed. The tumor tissues were used for subsequent IHC experiments.

Statistical analysis

All the data were analyzed by Graphpad 7.0. The quantitative data were assessed as mean ± SEM, and student’s t-test was used to analyze the two groups. P < 0.05 was considered statistically significant.

Results

EIF3D had high expression in human cervix cancer tissues and cells

EIF3D plays a role in the progression and development of multiple tumors, but its possible role in cervix cancer progression is still unclear. To uncover the possible effects of EIF3D on cervix cancer, we first detected its expression levels in human cervix cancer tissues and normal tissues. Through qPCR assays, we found the high mRNA levels of EIF3D in cervix cancer tissues, compared with normal tissues (Figure 1a). We also analyzed the clinical features of patients with cervix cancer. We found that the expression of EIF3D was correlated with the clinical features including tumor size (p = 0.035*), and TMN stage (p = 0.006**), and there were no significant correlations between EIF3D expression and age, HPV 16/16 infection, and lymph node metastasis (Table 1). Subsequently, we conducted immunoblot assays and found the high EIF3D expression in three representative tumor tissues compared with the corresponding normal tissues (Figure 1b). We then detected the expression of EIF3D in cervix cancer cell lines including HeLa, CaSKi, and SiHa, and normal cervix cell line H8. Through qPCR assays, we noticed that the mRNA level of EIF3D was upregulated in these three types of cervix cancer cell lines (Figure 1c). Similarly, the immunoblot assays also revealed the high EIF3D protein levels in cervix cancer cell lines (Figure 1d). Through IHC assays, we further confirmed the high EIF3D expression in human cervix cancer tissues compared with normal tissues (Figure 1e). These results suggested that EIF3D was highly expressed in human cervix cancer tissues and cells.

Figure 1.

EIF3D had high expression in human cervix cancer tissues and cells. (a). qPCR assays showed the mRNA levels of EIF3D in cervix cancer tissues and normal tissues (b). Immunoblot assays showed the protein levels of EIF3D in three representative cervix cancer tissues and corresponding normal tissues (c). qPCR assays showed the mRNA levels of EIF3D in cervix cancer cell lines including HeLa, CaSKi, and SiHa, and normal cervix cell line H8. (d). Immunoblot assays showed the protein levels of EIF3D in cervix cancer cell lines and normal cervix cell line. (e). IHC assays showed EIF3D expression in tumor tissues and normal tissues from cervix cancer patients. Data are shown as mean ± SEM, ** p < 0.01.

Downregulation of EIF3D suppressed the proliferation of cervix cancer cells

To further explore the effects of EIF3D on the progression of cervix cancer cells, we first detected its effects on cervix cancer cell proliferation. The expression of EIF3D was altered in cervix cancer cells, HeLa cells, by the transfection of EIF3D overexpression plasmids and shRNA plasmids. Immunoblot assays results showed that transfection of EIF3D overexpression plasmid increased its expression in HeLa cells, whereas the transfection of its shRNA plasmids decreased EIF3D expression (Figure 2a). MTT assays results indicated that EIF3D overexpression significantly promoted the viability of cervix cancer cells, whereas its downregulation suppressed the cell viability (Figure 2b). These results showed that downregulation of EIF3D suppressed the proliferation of cervix cancer cells.

Figure 2.

Downregulation of EIF3D suppressed the proliferation of cervix cancer cells. (a). Immunoblot assays showed the protein levels of EIF3D in HeLa cells upon the indicated transfection. (b). MTT assays showed the OD value at 490 nm wavelength of HeLa cells upon the indicated transfection. Data are shown as mean ± SEM, ** p < 0.01 EIF3D vs Control, ## p < 0.01 shEIF3D vs shNC. NC, negative control.

Knockdown of EIF3D restrained the motility of cervix cancer cells

Subsequently, we detected the effects of EIF3D on the migration and invasion of cervix cancer cells through transwell assays. The results showed that overexpression of EIF3D promoted migration and invasion of HeLa cells, whereas its downregulation suppressed the migration and invasion of HeLa cells, with the decreased cell numbers (Figure 3a and b). We also found that H8 cells had lower migration and invasion degree compared with other groups (Figure 3a and b). Collectively, downregulation of EIF3D restrained the motility of cervix cancer cells.

Figure 3.

Knockdown of EIF3D restrained the motility of cervix cancer cells. (a). Transwell migration assays showed the migration capacity of HeLa cells or H8 cells upon the indicated transfection. The number of migrate cells was quantified. (b). Transwell invasion assays showed the invasive HeLa cells or H8 cells upon the indicated transfection. The number of invasive cells was quantified. Data are shown as mean ± SEM, ** p < 0.01 EIF3D vs Control, ## p < 0.01 shEIF3D vs shNC. NC, negative control.

Downregulation of EIF3D restrained the stem cell-like properties in cervix cancer cells

Since previous study indicated that EIF3D could interact with GRP78, which was a CSC marker, we next detected the effects of EIF3D on the stem cell-like properties of cervix cancer cells [14,15]. We detected the expression of several CSC markers, including CD44, CD133, SOX2, and ALDH1, in HeLa cells upon the transfection of EIF3D overexpression and shRNA plasmids by immunoblot assays. We found that overexpression of EIF3D increased the expression of these CSC markers, whereas EIF3D knockdown decreased their expression in HeLa cells (Figure 4a). However, normal H8 cells had the lower expression of these markers (Figure 4a). Further, we noticed that the diameter of spheres of EIF3D overexpression HeLa cells was significantly higher than control, whereas EIF3D depletion decreased the diameter and number of spheres through mammosphere-forming efficiency (MSFE) assay assays (Figure 4b and c). However, normal H8 cells had the lower diameter and number of spheres (Figure 4b and c). These results indicated that downregulation of EIF3D restrained the stem cell-like properties in cervix cancer cells.

Figure 4.

EIF3D ablation restrained the stem cell-like properties in cervix cancer cells. (a). Immunoblot assays showed the expression of CD44, CD133, SOX2, and ALDH1 in HeLa cells or H8 cells upon the indicated transfection. (b, c). Mammosphere-forming efficiency (MSFE) assay assays showed the mean diameter (b) and number (c) of spheres of HeLa cells or H8 cells upon the indicated transfection. Data are shown as mean ± SEM, * p < 0.05, ** p < 0.01 EIF3D vs Control, ## p < 0.01 shEIF3D vs shNC. NC, negative control.

EIF3D promoted FAK activation through GRP78 in cervix cancer cells

Subsequently, we explored the possible mechanisms. FAK could regulate adhesion spot formation and promotes stem cell activity [17]. Therefore, we detected the effects of EIF3D on FAK phosphorylation levels in cervix cancer cells. We noticed that EIF3D overexpression upregulated the phosphorylation levels of FAK, and its depletion decreased FAK phosphorylation levels in HeLa cells by immunoblot assays (Figure 5a). Another study revealed that GRP78 could increase the metastasis and invasion of pancreatic cancer by activating FAK. We then investigated the effects of EIF3D on GRP78 expression and FAK activity. Through Immunoblot assays, we found that EIF3D overexpression increased the expression of GRP78 and FAK phosphorylation, and its knockdown decreased GRP78 and FAK phosphorylation in HeLa cells (Figure 5b). However, downregulation of GRP78 suppressed the FAK phosphorylation levels in HeLa cells transfected the EIF3D overexpression plasmids, compared with the corresponding control (Figure 5b). These results suggested that EIF3D promoted FAK activation through GRP78 in cervix cancer cells.

Figure 5.

EIF3D promoted FAK activation through GRP78 in cervix cancer cells. (a). Immunoblot assays showed the expression of phosphorylated FAK (p-FAK) and FAK in HeLa cells upon the indicated transfection. (b). Immunoblot assays showed the expression of GRP78, phosphorylated FAK, and FAK in HeLa cells upon the indicated transfection. Data are shown as mean ± SEM, ** p < 0.01 EIF3D + siNC vs Control + siNC, ## p < 0.01 EIF3D + siGRP78 vs EIF3D + siNC. & p < 0.05, shEIF3D + siNC vs shNC + siNC. $ p < 0.05, $ p < 0.01, shEIF3D + siGRP78 vs shEIF3D + siNC. NC, negative control.

Downregulation of EIF3D suppressed tumor growth of cervix cancer cells via GRP78-FAK axis

We then detected the effects of EIF3D on cervix tumor growth in vivo. HeLa cells transfected with EIF3D or control shRNA were inoculated subcutaneously into the upper back of nude mice. Tumor volumes were calculated every 7 days to generate the growth curve. After 28 days, tumors were harvested, and mice were sacrificed. The results showed that tumor growth in the EIF3D shRNA group was slower than that of the control (Figure 6a). Subsequently, the IHC assays were performed using the tumor tissues from mice. We found that downregulation of EIF3D suppressed Ki67 staining levels in tumor tissues, suggesting the inhibition of tumor cell proliferation (Figure 6b). In addition, downregulation of EIF3D also decreased the expression of EIF3D, CD133, GRP78, and phosphorylated FAK, in tumor tissues, further confirming the previous findings (Figure 6c). Therefore, downregulation of EIF3D suppressed tumor growth of cervix cancer cells via GRP78-FAK axis.

Figure 6.

Downregulation of EIF3D suppressed tumor growth of cervix cancer cells via GRP78-FAK axis. (a). Xenograft assay showed the tumor growth and weight difference between the indicated groups. (b). IHC assays showed the expression of Ki67 in tumor tissues from the indicated groups. (c). IHC assays showed the expression of CD133, EIF3D, GRP78, and phosphorylated FAK (p-FAK) in tumor tissues from the indicated groups. Data are shown as mean ± SEM, ** p < 0.01.

Discussion

Cervix cancer is a malignant tumor originating from the cervix, that is often caused by HPV infection, and is lack of significant symptoms in the early stage [18]. Most patients have been in the advanced stage at the time of treatment, with a high mortality rate [18]. To combat this disease, it is urgently needed to develop novel therapeutic methods and targets. Cancer stem cells (CSCs) play an important role in tumor survival, proliferation, metastasis and recurrence [19]. A large number of studies have shown that the occurrence and development of cervix cancer is related to CSCs [20]. Targeting CSCs for cervix cancer is a potentially effective therapeutic approach. Interestingly, we found here a member of eukaryotic translation initiation factor 3 (EIF3), EIF3D, had the potential to serve as a target of cervix cancer via mediating stem cell-like properties.

Through MTT and transwell assays, we revealed the effects of EIF3D on the proliferation and motility of cervix cancer cells. Further through MSFE and immunoblot assays, we found that EIF3D promoted the stem cell-like properties of cervix cancer cells. Therefore, our data demonstrated the involvement of EIF3D in the progression of cervix cancer. The effects of EIF3D on the progression of multiple types of cancers have been widely revealed. EIF3D overexpression in lung adenocarcinoma, bladder cancer, and gastric cancer was known as an independent prognostic factor [10,13,21]. It also promoted sunitinib-resistance of renal cell carcinoma (RCC) cells via interacting with GRP78 to inhibit its degradation [14]. Similarly, in cervix cancer, we also found that EIF3D could mediate the expression of GRP78, thereby promoting stem cell-like properties and metastasis. Another study indicated that the depletion of EIF3D restrained cell proliferation through the regulation of cell cycle in lung cancer [22]. We should next detect the effects of EIF3D on the cell cycle of cervix cancer.

GRP78, a stress-induced endoplasmic reticulum chaperone protein, can promote the progression of a variety of tumors [23]. The expression of GRP78 could promote the malignant process of cervix cancer and increase the resistance of chemotherapy drugs [24]. Importantly, GRP78 is one of the markers of cancer stem cells [15]. The high expression of GRP78 could promote the stem cell-like properties of cervix cancer [25]. Interestingly, we also noticed here that EIF3D could promote the stem cell-like properties of cervix cancer via GRP78. The precise mechanism needs further study.

In addition, GRP78 can increase the metastasis and invasion of pancreatic cancer by activating FAK [26]. FAK is a well-known kinase that regulates the formation of adhesion plaques and plays a major role in the regulation of tumor metastasis and invasion [27]. A previous study indicated that the stem cell-like properties of colon cancer cells could be inhibited by inhibiting the activity of FAK and its downstream proteins [17]. Therefore, the activity of FAK is not only related to the metastasis and invasion of tumors, but also can regulate the stem cell-like properties of cancer cells, thereby increasing the malignancy of tumors. In this study, we also revealed that EIF3D promoted stem cell-like properties and metastasis of cervix cancer cells via targeting GRP78-FAK axis. We therefore thought this axis could serve as a promising target for cervix cancer treatment. There are still limitations for this study. This study is lack of the precise molecular mechanism. It was still unclear how EIF3D mediates GRP78, and further affects FAK. We do not know its precise mechanism. In the future study we will further investigate the possible mechanism through many different dimensions. We will also detect the role of EIF3D in CSCs by growing HeLa in a non-adhesive culture system.

Conclusion

In conclusion, we noticed the high EIF3D expression in human cervix cancer tissues and cells. We further found the downregulation of EIF3D suppressed the proliferation, motility, and the stem cell-like properties of cervix cancer cells. Mechanically, we found EIF3D promoted FAK activation through GRP78 in cervix cancer cells, therefore contributing to the progression of cervix cancer.