Literature DB >> 35095959

Select and Sequence of a Segregating Sugar Beet Population Provides Genomic Perspective of Host Resistance to Seedling Rhizoctonia solani Infection.

Paul Galewski1,2, Andrew Funk2,3, J Mitchell McGrath4.   

Abstract

Understanding the genetic basis of polygenic traits is a major challenge in agricultural species, especially in non-model systems. Select and sequence (SnS) experiments carried out within existing breeding programs provide a means to simultaneously identify the genomic background of a trait while improving the mean phenotype for a population. Using pooled whole genome sequencing (WGS) of selected and unselected bulks derived from a synthetic outcrossing sugar beet population EL57 (PI 663212), which segregates for seedling rhizoctonia resistance, we identified a putative genomic background involved in conditioning a resistance phenotype. Population genomic parameters were estimated to measure fixation (He), genome divergence (F ST ), and allele frequency changes between bulks (DeltaAF). We report on the genome wide patterns of variation resulting from selection and highlight specific genomic features associated with resistance. Expected heterozygosity (He) showed an increased level of fixation in the resistant bulk, indicating a greater selection pressure was applied. In total, 1,311 biallelic loci were detected as significant FST outliers (p < 0.01) in comparisons between the resistant and susceptible bulks. These loci were detected in 206 regions along the chromosomes and contained 275 genes. We estimated changes in allele frequency between bulks resulting from selection for resistance by leveraging the allele frequencies of an unselected bulk. DeltaAF was a more stringent test of selection and recovered 186 significant loci, representing 32 genes, all of which were also detected using FST. Estimates of population genetic parameters and statistical significance were visualized with respect to the EL10.2 physical map and produced a candidate gene list that was enriched for function in cell wall metabolism and plant disease resistance, including pathogen perception, signal transduction, and pathogen response. Specific variation associated with these genes was also reported and represents genetic markers for validation and prediction of resistance to Rhizoctonia. Select and sequence experiments offer a means to characterize the genetic base of sugar beet, inform selection within breeding programs, and prioritize candidate variation for functional studies.
Copyright © 2022 Galewski, Funk and McGrath.

Entities:  

Keywords:  Beta vulgaris; Rhizoctonia resistance; gene discovery; sugar beet; synthetic populations

Year:  2022        PMID: 35095959      PMCID: PMC8793884          DOI: 10.3389/fpls.2021.785267

Source DB:  PubMed          Journal:  Front Plant Sci        ISSN: 1664-462X            Impact factor:   5.753


Introduction

The characterization of resistance sources for the genetic improvement of beet (Beta vulgaris) is a long-standing challenge. The USDA sugar beet germplasm is enriched for important traits such as resistance to disease and adaptation to local production regions. The pedigrees of this material suggest many of these traits can be traced back to wide hybridizations between sugar beet and wild beet (Beta maritima) (Doney, 1995; Panella et al., 2015). Beet is an outcrossing species, wind pollinated and generally self-incompatible. As a result, beet populations are highly heterozygous. Historically, crop improvement has been carried out via recurrent phenotypic selection and sib mating (Doney and Theurer, 1978). Commercial sugar beets are hybrid, and the production of hybrid seed relies on a narrow but well characterized genetic base where the frequencies of cytoplasmic male sterility (CMS) and CMS restorers are well understood. The need to maintain the genetic backgrounds required for hybrid seed production while breeding for multiple disease resistance traits, local adaptation, and yield makes the utilization of novel genetic variation a slow and resource-intensive process. Beet reference genomes and sequencing technologies have increased our ability to characterize genome variation within diverse beet lineages and breeding lines (Funk et al., 2018; Galewski and McGrath, 2020). The use of whole genome sequencing (WGS) to inform traditional beet breeding programs provides a system for “select and sequence” (SnS) experiments. These methods are a powerful tool for detecting the genetic basis of phenotypic selection in experimental populations (Schlötterer et al., 2015; Burghardt et al., 2018) and is an efficient way to prioritize candidate variation for functional studies and marker validation in the future (Burny et al., 2020). Advances in genomic resources, population genomic methods and experimental design have improved the process of gene discovery in agricultural species. Reference genomes provide an anchor to link genetic variation with coding sequences underlying phenotypic variation (Hufford et al., 2012). Accurate gene models determined from ab-initio gene prediction, transcript evidence, and gene ontology can help to infer gene function and provide hypotheses for biological mechanisms (Salzberg, 2019). The genome EL10.2 is a contiguous chromosome level assembly (McGrath et al., 2020) with high homology to other beet reference genomes such as RefBeet (Dohm et al., 2014). Reference genomes have increased our ability to rapidly catalog and compare variation within and between populations using genome scans (Nielsen et al., 2005), bulk segreant analysis (BSA) (Michelmore et al., 1991) and mapping by sequencing approaches (Schneeberger et al., 2009). WGS has also been used to provide a complete picture of genetic variation within a population including structural variants (SV) and presence-absence variation (PAV) (Pinosio et al., 2016; Wang et al., 2018). Recent research has demonstrated the impact of SV and PAV on important phenotypic variation observed between cultivars and adaptative trait variation including disease resistance (Zhou et al., 2019; Hämälä et al., 2021). SnS experiments show potential to detect genetic variation linked to selection and adaptation in experimentally generated populations (Schlötterer et al., 2015). Additionally, numerous methods to detect positive selection within populations have been established (reviewed in Weigand and Leese, 2018) which facilitates the adoption of SnS experiments within breeding programs for agricultural crops such as beet. Phenotypic variation in beets is often measured at the level of the population due to difficulties inbreeding and fixing variation in single plants, fostering comparisons between populations rather than comparisons between individuals. Pooled sequencing of populations is an effective way to capture and compare causal genetic variation in beet, either by partitioning variation according to phenotypes within a segregating population, or by comparing different populations. The utility of pooled data has been demonstrated (Schlötterer et al., 2014) and can provide accurate estimates of allele frequency (Lynch et al., 2014) and population genetic parameters (Ferretti et al., 2013). Pooled sequencing increases the effective number of assayed recombination events, improving our ability to resolve causal variation vs. traditional mapping approaches. In beets, pooled sequencing has been utilized to understand how diversity is distributed in crop type lineages (Galewski and McGrath, 2020) and within selected breeding populations (Ries et al., 2016). The later research used pooled data and a mapping by sequencing approach to discover causal variation associated with hypocotyl color, a monogenic trait. Our hypothesis is that pooled sequencing could also be effective for resolving polygenic traits with continuous phenotypes, which are more difficult to detect with traditional marker-based approaches. For example, disease resistance traits have been a major target of sugar beet breeding for more than a century and the application of pooled sequence data to inform polygenic traits such as Rhizoctonia resistance is warranted. Rhizoctonia solani Kühn is a soil borne pathogen which can cause seedling dampening off and crown and root rot, both of which can severely impact sugar yield for growers (Gaskill et al., 1970). Various management practices are used to mitigate R. solani infection in the field and maintain crop profitability. This includes crop rotation, seed treatments and fungicide applications (Bolton et al., 2010). Genetic resistances have been identified but appear to be derived from relatively few sources (Panella, 2005) which highlights the need for identifying new sources. Unfortunately, genetic resistance to rhizoctonia is poorly characterized, and while no single germplasm source can be attributed to Rhizoctonia resistance in beet, the long history of selection for resistance to crown and root rot from the USDA-ARS Ft. Collins, CO, United States germplasm enhancement program likely represents the major resistance source in commercial materials. Seedling resistance was identified from these materials and from the USDA-ARS East Lansing, MI, United States germplasm enhancement program (Panella et al., 2015). Early reports describe resistance as polygenic with many small-effect alleles (Hecker and Ruppel, 1975). Some major resistance quantitative trait loci (QTL) have been described in greenhouse studies (Lein et al., 2008) but the added complexity of field conditions and year effects (Strausbaugh et al., 2013a), host growth stage (Nagendran et al., 2009; Liu et al., 2019), cultivar and pathogen interactions (Strausbaugh et al., 2013b), and confounding infections from bacterial pathogens (Strausbaugh et al., 2013a) suggest many genes contribute to rhizoctonia resistance in sugar beet. Other research suggests the involvement of additional compounds and proteins in rhizoctonia resistance, such as reactive oxygen species (Taheri and Tarighi, 2010), polygalacturonase-inhibiting proteins (Li and Smigocki, 2018), and major latex protein-like proteins (Holmquist et al., 202). Newly sequenced rhizoctonia genomes have further detailed the complexity of host-pathogen interactions resulting from different anastomosis groups, putative genes, enzymes, and effectors molecules (Wibberg et al., 2016). This research is focused on understanding plant host resistance to seedling Rhizoctonia by sequencing bulks of phenotypically distinct individuals derived from a synthetic outcrossing population, EL57 (PI 663212). Using WGS, existing reference genomes, and selection for resistance we highlight a genomic background associated with seedling Rhizoctonia resistance. In identifying the genetic determinants underlying resistance we show how these methods can be used to characterize polygenic traits in beet (B. vulgaris), inform future experiments, and provide genetic solutions to long standing challenges faced by sugar beet producers.

Materials and Methods

Populations and Sequencing

The population EL57 is a unique synthetic population combining mostly Eastern US germplasm traits in a self-fertile genetic background, and is diploid, multigerm, and biennial. EL57 is a very broad genetic base diploid combining genetics of 660 mother roots with the unique feature that 98% of the 133 parental used lines are self-fertile due to a dominant gene (Sf) introgressed from C869 (PI 628754) or C869 CMS (PI 628755). 21% of the parents were derived from C869 CMS and thus have the S-cytoplasm. Male sterility, both nuclear male sterility from C869 and CMS, was used to capture pollen from open-pollinated increases of a wide variety of pollinators from 1997 through 2007. Traits expected to be segregating in the population include Aphanomyces seedling disease and Cercospora leaf spot resistances contributed by sugar beet germplasms SP7622 (aka SP6822, 20% of original pollinators), USH20 (8% of original pollinators), and SP85303 (PI 590770, 6% of original pollinators), Rhizoctonia resistance derived from EL51 (PI 598074, 13% of original pollinators), curly top and rhizomania resistance selections from C931 (PI 636340) and EL0204 (PI 655951) (5% of original pollinators), a series of Aphanomyces resistant or salt-tolerant germination breeding lines and selections (derived from PI 165485, PI 271439, PI 518160, PI 546409, PI 562591, PI 562599, and PI 562601) (20% of original pollinators in total), a series of 17 nematode resistant breeding lines from the Salinas, CA USDA-ARS breeding program (13% of original pollinators), and a mixture of released and unreleased breeding lines derived from high sucrose, smooth-root selections (23% of original pollinators). EL57 was planted in the SVREC seedling Rhizoctonia nursery on May 15, 2017, as a large selection block of 161 plots and inoculated with Rhizoctonia isolate RG2-2 on June 6. Seven plots of EL57 were not inoculated as a control. Approximately 8 weeks later leaves were harvested from non-inoculated and inoculated plots, representing three bulks. Resistant and susceptible bulks were chosen from the inoculated plots, and an unselected bulk was taken from non-inoculated plots. Leaf material from 25 plants was harvested and pooled for each of the three bulks. Pooled leaf material was homogenized, and DNA was extracted using the Macherey-Nagel NucleoSpin Plant II Genomic DNA extraction kit (Bethlehem, PA). One microgram of DNA for each population was submitted to Admera Health, LLC, where NGS libraries were constructed using TruSeq bar-code adapters. The sequencing reactions were carried out on the Illumina Hi-Seq 2500 in a 2 × 150 bp paired-end format with a target coverage of 80x relative to the predicted 758 Mb genome size of beet (Arumuganathan and Earle, 1991). Post-sequencing read quality was assessed using FastQC (Andrews, 2010). Library bar-code adapters were removed and reads were trimmed according to a quality threshold using TRIMMOMATIC (Bolger et al., 2014) invoking the following options (ILLUMINACLIP:adapters.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36). These filtered reads were used for downstream analysis.

Alignment and Variant Detection

Reads from each population were aligned to the B. vulgaris reference genome assembly EL10.2 (McGrath et al., 2020) using BWA mem (Li, 2013). The resulting alignment files were sorted and merged using SAMtools (Li et al., 2009). Variants for each population were called simultaneously on all three populations using the program Freebayes (Garrison and Marth, 2012). Variants were filtered for mapping quality, number of variants detected and depth across sites. After the initial variant detection step, the vcf file was filtered for genotype quality, GQ ≥ 20, and read depth, N < 300. Variants were then partitioned into those that were detected as biallelic and those that were multi-allelic. The biallelic sites were used for the estimation of population genetic parameters and the multiallelic sites were retained for consequence on phenotype after significant regions were determined. In addition, structural variants were cataloged in each sample using the program Manta (Chen et al., 2016).

Genome Divergence—Allele Frequency, FST and DeltaAF

A python program was used to count alleles for all biallelic variants within the three populations. Allele frequency was estimated for the resistant, susceptible, and unselected EL57 populations. Population genetic parameters were estimated using the allele frequency within each population such that (p + q = 1). The variable p was designated as the reference allele of the EL10.2 reference genome and q as the alternate state. The degree of fixation was estimated at all biallelic sites using the expected heterozygosity (He) or 2pq. Global levels of fixation with respect to selection were calculated as the average of He across all sites. FST was used to calculate differentiation between the resistant and susceptible populations at each locus (Eq. 1). The parameter FST24 was estimated by calculating FST within a sliding window of 25 biallelic variant sites, or 12 variant sites flanking a single biallelic locus across the genome. Significant regions along chromosomes were determined by loci that showed a significant FST value at a given locus. Significance thresholds were defined by P-values < 0.01, calculated using the empirical distribution of all FST values. Equation 1: shows F Delta allele frequency was calculated by using a series of Boolean operators to determine the loci which pass allele frequency thresholds in selected populations relative to the unselected population. This provided a null distribution from which to derive the genomic locations of large changes in allele frequency with respect to selection for resistance. Equation 2: determines sites where the relative change in allele frequency between resistant and susceptible bulks is > 0.8 and the allele frequency change between susceptible and unselected bulks is low, >0.15.

Genome Visualization

Visualization of significant genomic regions was carried out by plotting FST24 along chromosomes with a density plot of all significant FST values. Python was used for the manipulation of data sets and estimation of population genetic parameters, while R libraries were used for plotting the final data matrixes. DeltaAF was also plotted across the genome, highlighting only those regions where divergence in allele frequency between the resistant and susceptible bulk was high and the susceptible and unselected population was low. Regions along the chromosome of high significance were determined by investigating a significant locus and searching within a 50 kb window upstream to determine the size and significance of a region with respect to selection. All regions with significant FST or DeltaAF were visualized using R. The density and distribution of variation was also considered by plotting data relative to the physical map provided by the EL10.2 genome assembly along with EL10 gene models and annotations. SNPeff (Cingolani et al., 2012) was used to annotate variants based on physical position and determine functional consequences in terms of protein coding changes.

Determination of Resistance Genes Involved in Resistance to Rhizoctonia solani

A combination of statistical analysis and genome resources were leveraged to identify targets within or adjacent to significant regions across the genome (e.g., FST, FST24, and DeltaAF). Determination of putative gene loci involved in resistance were based on all previous analysis as well as significant homology to functional validated candidates in other species. Markers were derived for use in predicting seedling rhizoctonia resistance by extracting significant variation from .vcf files.

Results

Nearly 3,500 plants from the synthetic, outcrossing sugar beet population EL57 (PI 663212) were sown, inoculated with Rhizoctonia solani isolate RG2-2, and allowed to grow for 8 weeks before being evaluated for seedling dampening off. Rhizoctonia symptoms became progressively worse throughout the growing season: average stand counts prior to inoculation were 21.3 plants/plot (SD = 3.33) and post-inoculation at the end of the season (October 17) were 4.9 plants/plot (SD = 1.74), or approximately 77% plant death. This suggested that the disease nursery provided a strong selection pressure for resistance to Rhizoctonia solani infection and an opportunity to identify a genetic basis for this important trait. Three bulks were sampled for WGS each representing 25 plants (0.7% of the total population). Susceptible individuals (S bulk) were selected with respect to leaf symptoms and confirmed as showing root symptoms as well. Resistant individuals (R bulk) showed no visual leaf or root symptoms (Figure 1). An unselected bulk was also sampled which helped to identify allele frequency changes resulting from selection vs. historical population dynamics and/or genetic drift.
FIGURE 1

Phenotypic selection of EL57 bulks segregating for resistance to seedling Rhizoctonia.

Phenotypic selection of EL57 bulks segregating for resistance to seedling Rhizoctonia. An average of 259,888,506 reads were generated for each of the three bulks, representing an average coverage of 80.3X per sample. The raw reads were trimmed and mapped to the EL10.2 reference genome: 98.1% of bases were retained after filtering and 95% of reads successfully aligned. The aligned reads were used to identify sequence variation across the three populations. A total of 3,235,162 variants were detected, consisting of biallelic, multi-allelic, and structural variants (SV). Biallelic variation accounted for 2,812,301 loci (86.93%) of the total variation and multi-allelic variation accounted for 249,045 (7.70%). Biallelic and multi allelic variation was further categorized by type, including insertions, deletions, single nucleotide polymorphisms (SNP), multi nucleotide polymorphisms (mnp) and complex substitutions (Table 1). The biallelic variation was used for statistical analysis due to its ease in estimating allele frequency and population genomic parameters. Expected heterozygosity (He) showed the degree of fixation resulting from selection for a resistance phenotype. A reduction in He was observed between the unselected (0.304) and the resistant bulk (0.298). He for the susceptible bulk (0.305) was closer to the unselected bulk (Table 1). This is consistent with selection pressure applied and the frequency that resistance was observed in the base EL57 population. We also found 173,817 SVs (5.37%), which were subcategorized as insertions (26,837), deletions (68,922), and putative translocations (78,057) relative to the EL10.2 genome (Table 1).
TABLE 1

Summary of variant detection.

NumberPercent (%)
Total variants 3,235,162100.00%
Biallelic2,812,30186.93%
Multiallelic249,0457.70%
Structural variant (SV)173,8165.37%
SV insertion 26,837
SV deletion 68,922
SV translocations 78,057
Biallelic 2,812,301100.00%
Single nucleotide polymorphism (SNP)1,939,59068.97%
Insertion454,82916.17%
Deletion186,7906.64%
Complex substitution168,0535.98%
Multi nucleotide polymorphism (MNP)63,0392.24%

Population Expected heterozygocity (2pq)

EL57 unselected bulk0.304
EL57 resistant bulk0.298
EL57 susceptible bulk0.305
Summary of variant detection. Selection was investigated across the genome using the parameters FST and DeltaAF. FST estimated the apportionment of variation in allele frequency between bulks. The empirical distribution of FST allowed us to assign significance values (p-values) to all biallelic loci. At significance levels of p< 0.05, p< 0.01, and p< 0.001. FST values were equal to 0.22, 0.84, and 0.91 respectively. In total, 1,311 loci were detected with significant FST (p < 0.01). Since FST shows divergence at a single site, it can be hard to interpret if the divergence is the result of genetic drift or selection. To address this issue, FST was also calculated in a sliding window (FST24) which considered 24 adjacent variant sites as a single entity. This could reduce noise from genetic drift under the assumption that if selection was acting on a site, linkage disequilibrium would cause adjacent sites to diverge along with the causal variant. As expected, the FST24 analysis reduced the number of significant regions associated with divergence between the resistant and susceptible bulks (Figure 2 and Table 2). Divergence between resistant and susceptible bulks, measured by FST, occurred on all chromosomes but some chromosomes contained more divergent loci than others. It was also noted that divergent sites appeared to be within gene rich regions, and not associated with centromeric or telomeric sequences.
FIGURE 2

Effects of selection on allele frequency across B. vulgaris chromosomes. (A) Distribution of FST 24 and FST (B) Distribution of DeltaAF.

TABLE 2

Accumulation of significant loci among chromosomes.

FST (p < 0.01)FST24 (p < 0.01)DeltaAF
Chromosome 131415337
Chromosome 22041832
Chromosome 3145025
Chromosome 479413
Chromosome 51172614
Chromosome 65007
Chromosome 723511248
Chromosome 86905
Chromosome 9103525
Effects of selection on allele frequency across B. vulgaris chromosomes. (A) Distribution of FST 24 and FST (B) Distribution of DeltaAF. Accumulation of significant loci among chromosomes. Delta AF was used to test changes in allele frequency between populations selected for resistance and susceptibility to rhizoctonia vs. an unselected population. Our expectation for DeltaAF was that large differences in allele frequency detected between susceptible and resistant bulk would not be found between susceptible and unselected bulks, given the frequency of resistant individuals in the unselected bulk was estimated at 23%. In terms of significant sites, DeltaAF was a more stringent statistic. In total, 186 sites were detected as significant, representing 42 genes. The complete table of all DeltaAF loci are presented in Supplementary Table 2. Comparisons between significant loci produced by FST, FST 24, and DeltaAF across the chromosomes are present in Table 2. Significant genomic regions were defined by taking all 1311 FST values which passed the significance threshold of 0.84 (p < 0.01) and looking for physical clusters of significant FST values within 50 kb of a given locus. This produced a list of regions along the chromosome which were the most diverged between the resistant and susceptible bulks (Table 3). In total 206 regions were identified and the size and magnitude of significance for each region were evaluated. In total 83 of the regions were represented by only one locus with significant F. These appeared less likely to reflect a selective sweep but represent potential functional variants between pools and may contribute to the phenotype. The remaining 43 regions were represented by more than a single locus (3–17 loci) within 50 kb of another significant variant site. The average size of a significant region was 27,624 bp, with a range from 3 to 130,093 bp in length. The complete table with FST values is presented in Supplementary Table 1. Significant DeltaAF loci were associated with 136 regions across the chromosome and were determined the same way as FST.
TABLE 3

Comparison of regions derived from FST and Delta AF.

Number of regionsGenes associated with regionsPromoters associated with regionsAverage number of loci in regionsAverage size of region (bp)
FST 206275366.3914,998
DeltaAF 13632101.373,559
Comparison of regions derived from FST and Delta AF. Genes that were associated with significant FST and DeltaAF values were extracted by using a significance threshold and determining their physical position relative to gene boundaries (5′ URT and 3′ UTR) or the upstream promoter sequences, defined as 3 kb flanking the gene. In total, 1,316 loci with high FST were associated with 206 regions, containing 311 genes. These could be further subdivided into variants associated with the gene sequences (275) (Supplementary Table 3) and those associated promoter sequences of genes (36) (Supplementary Table 4). In total, DeltaAF recovered 42 genes, and 32 were identified as having high DeltaAF signals within the gene boundaries (Supplementary Table 5) and 10 were identified in putative promoter sequence (3 kb flanking the genes) (Supplementary Table 6). All of the genes associated with Delta AF genes were found within the larger FST gene set. The total biallelic variant set was analyzed using SNPeff and produced 56,451 annotations predicted to have high consequences on gene function. Only 11 of these coincide with loci determined to have significant FST or DeltaAF. We combined data from statistical tests for enrichment (e.g., FST and DeltaAF) with custom visualization tools to inspect regions of significance with respect to the EL10.2 physical map (Figure 3). A preliminary set of 41 candidate regions was generated based on their proximity and effect of genetic variation relative to gene models. We queried publicly available databases and the scientific literature to determine the functional identity of the candidate genes to prioritize targets of future research. This analysis revealed 18 genes with known or putative function in pathogen resistance and six genes likely involved in cell wall metabolism (Table 4). The pathogen defense related genes included multiple representatives from three classes: four chitinases (EL10Ac3g05998, EL10Ac3g06002, EL10Ac3g06003, EL10Ac3g05996), three putative pathogen-responsive Ser/Thr receptor kinases (EL10Ac4g07999, EL10Ac3g06055, EL10Ac3g06056), and two genes involved in defense-associated volatile ester catabolism (EL10Ac6g14646 and EL10Ac3g05812). The cell wall-related genes included five metabolic genes (EL10Ac6g13717, EL10Ac6g13257, EL10Ac5g13023, EL10Ac3g05157, and EL10Ac3g05159) as well as one Myb-related transcription factor EL10Ac1g00142. It is noteworthy that the Peroxidase 5 genes EL10Ac3g05157 and EL10Ac3g05159 are likely a single gene with a transposon inserted into the coding region in the EL10.2 reference genome (the transposon is recorded as EL10Ac3g05158 “Retrovirus-related Pol polyprotein from transposon TNT1–94” in the EL10.2 annotation). Unfortunately, the variant detection strategy employed in this report cannot determine if this peroxidase gene is intact in either the resistant or susceptible bulks. However, the combination of FST, DeltaAF, and visualization of variant positions was able to generate a plausible candidate gene list for further investigation. Potential markers and their significance were reported which could be used for the prediction of resistance (Table 5). Subsequent rounds of the “Select and Sequence” strategy would help to validate the markers generated and inform how genomic prediction might be applied to beet populations segregating for phenotypes of interest.
FIGURE 3

Visualization of chromosome regions on the basis significant F (p-value<0.01).

TABLE 4

Candidate genes derived from FST, DeltaAF and proximity to chromosomal regions of high significance.

DataChrGeneScaffoldStartStopStrandIdentity
FSTG1EL10Ac1g00142lcl| Scaffold_46228898862293643Myb-related protein Zm1
Region3EL10Ac3g05118lcl| Scaffold_725055142508049+Mitochondrial metalloendopeptidase OMA1
DAF/FSTG3EL10Ac3g05157lcl| Scaffold_729644652988432+Peroxidase 5 {ECO:0000250| UniProtKB:P22195}
Region3EL10Ac3g05158lcl| Scaffold_729753942980297Retrovirus-related Pol polyprotein from transposon TNT1-94
Region3EL10Ac3g05159lcl| Scaffold_729868172992340Peroxidase 5 {ECO:0000250| UniProtKB:P22195}
FSTG3EL10Ac3g05812lcl| Scaffold_71144752411463930Probable carboxylesterase 1
FSTG3EL10Ac3g05814lcl| Scaffold_71147827211491769+Putative disease resistance protein RGA1
FSTG3EL10Ac3g05956lcl| Scaffold_71379635813808136Cytosolic sulfotransferase 15
Region3EL10Ac3g05996lcl| Scaffold_71449989314502240+Endochitinase CH25
Region3EL10Ac3g05998lcl| Scaffold_71452419814525516+Endochitinase
Region3EL10Ac3g06002lcl| Scaffold_71455356514555809+Endochitinase A
FSTG3EL10Ac3g06003lcl| Scaffold_71455382214558536Chitinase 9
FSTG3EL10Ac3g06012lcl| Scaffold_714703412147140933beta-hydroxysteroid-dehydrogenase/decarboxylase isoform 3
FSTG3EL10Ac3g06014lcl| Scaffold_71474439714756713Calreticulin-3
Region3EL10Ac3g06055lcl| Scaffold_71564387715645017+Wall-associated receptor kinase 1
FSTP3EL10Ac3g06056lcl| Scaffold_71566622315687673+Wall-associated receptor kinase 2
Region4EL10Ac4g07999lcl| Scaffold_367861086793448Probable leucine-rich repeat receptor-like serine/threonine-protein kinase At5g15730
Region5EL10Ac5g12121lcl| Scaffold_21653141116538896+zinc-binding in reverse transcriptase
FSTG5EL10Ac5g13023lcl| Scaffold_2787508799504Oxysterol-binding protein-related protein 2A
FSTG6EL10Ac6g13257lcl| Scaffold_16964435269648601Endo-1,4-beta-xylanase F1
FSTP6EL10Ac6g13717lcl| Scaffold_16282174162829006+Anthocyanidin 3-O-glucoside 2”-O-glucosyltransferase
NA6EL10Ac6g14646lcl| Scaffold_12217676922179875Valencene synthase
FSTG6EL10Ac6g15325lcl| Scaffold_174867627502133+transmembrane protein 184A
FSTG6EL10Ac6g15331lcl| Scaffold_174096667416329Probable E3 ubiquitin-protein ligase HERC2
Region6EL10Ac6g15568lcl| Scaffold_131243963127216+hypothetical protein
FSTG8EL10Ac8g19585lcl| Scaffold_53009638930106598+Cationic amino acid transporter 1
FSTG3EL10Ac9g21282lcl| Scaffold_94142947341431399Vacuolar amino acid transporter 1
Region5EL10As14g24073lcl| Scaffold_21427109514272339+Protein SLE2 {ECO:0000303| Ref.3}
FSTP5EL10As14g24074lcl| Scaffold_21428834114294899+Dynamin-related protein 1E

FSTG, significant FST loci within gene; FSTP, significant FST loci within promoter sequence; DAF, significant DeltaAF loci; Region, gene found within significant region; NA, gene found within significant region.

TABLE 5

Marker variation-high consequence (SNPeff), FST, and DeltaAF.

Allele Frequency
DataEL10.2 ScaffoldPositionRefAltUnseletedResistantSuceptibleFSTEL10.1 Gene IDGene Annotation
SNPefflcl| Scaffold_110,879,102TGGTGGG0.000.001.001.00EL10Ac6g15089RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
SNPefflcl| Scaffold_126,110,683CAACAAA1.000.000.920.85EL10Ac6g14526Zinc finger CCHC domain-containing protein 8
SNPefflcl| Scaffold_256,034,911GGGCA0.881.000.160.72EL10Ac5g11051NEP1-interacting protein-like 2;TMhmm_ExpAA:32.25
SNPefflcl| Scaffold_462,342,250CTCCTTG1.000.001.001.00EL10Ac1g00136Carboxymethylenebutenolidase homolog
SNPefflcl| Scaffold_752,713,203TATGG0.920.001.001.00EL10Ac3g07219Nucleolar protein 10
SNPefflcl| Scaffold_8452,635TTTAGGA0.880.000.840.72EL10Ac2g02429Histidine kinase 5
SNPefflcl| Scaffold_948,328,478AGAAGGG0.920.001.001.00EL10Ac9g21727Probable receptor-like serine/threonine-protein kinase At4g34500;TMhmm_ExpAA:23.97
SNPefflcl| Scaffold_952,891,057TATGGC0.800.001.001.00EL10Ac9g22099GATA transcription factor 12
SNPefflcl| Scaffold_953,136,509GAGGAAC0.681.000.160.72EL10Ac9g22117MADS-box transcription factor 27
DAF/FSTlcl| Scaffold_463,029,953CT0.081.000.001.00EL10Ac6g15080Protein FAR-RED ELONGATED HYPOCOTYL 3
DAF/FSTlcl| Scaffold_463,029,962AG0.081.000.001.00EL10Ac6g14731Probable inactive receptor kinase At5g10020;TMhmm_ExpAA:41.51
DAF/FSTlcl| Scaffold_453,504,844TC0.001.000.001.00EL10Ac6g14670Replication factor C subunit 1
DAF/FSTlcl| Scaffold_440,900,804TGGGGGGGG GGGGGGGATGGGGGGGGGG GGGGGGA0.040.960.000.92EL10Ac6g14562Importin-9;TMhmm_ExpAA:27.48
DAF/FSTlcl| Scaffold_41,904,674CAAG0.000.840.000.72EL10Ac6g13913Sugar transport protein 14
DAF/FSTlcl| Scaffold_41,904,696TA0.000.880.000.79EL10Ac5g12073Putative disease resistance protein RGA3
DAF/FSTlcl| Scaffold_82,814,345AG0.001.000.001.00EL10Ac5g12061Transcription factor MYB39
DAF/FSTlcl| Scaffold_83,930,082GA0.000.880.000.79EL10Ac5g11572Metallothionein
DAF/FSTlcl| Scaffold_71,850,367AT0.161.000.120.79EL10Ac4g08331Putative ribonuclease H protein At1g65750
DAF/FSTlcl| Scaffold_72,965,251ATATACAGT0.001.000.001.00EL10Ac4g09188Guanine deaminase
DAF/FSTlcl| Scaffold_72,965,294CT0.001.000.001.00EL10Ac4g09998Protein kri1
DAF/FSTlcl| Scaffold_714,304,193GAAGA0.001.000.001.00EL10Ac1g02366Heptahelical transmembrane protein 4;TMhmm_ExpAA:151.43
DAF/FSTlcl| Scaffold_715,181,123GTAAACTAGTAACGGCCAG0.001.000.001.00EL10Ac1g02366Heptahelical transmembrane protein 4;TMhmm_ExpAA:151.43
DAF/FSTlcl| Scaffold_715,643,326AG0.081.000.001.00EL10Ac1g02366Heptahelical transmembrane protein 4;TMhmm_ExpAA:151.43
DAF/FSTlcl| Scaffold_715,665,864GA0.001.000.001.00EL10Ac1g01440Small RNA degrading nuclease 5
DAF/FSTlcl| Scaffold_715,665,870GTAAGAAAGTGACATGTAAGAAAGTGACATA AGAAAGTGACAT0.001.000.001.00EL10Ac1g00071ABC transporter E family member 2
DAF/FSTlcl| Scaffold_716,724,330GGATCAGATT0.001.000.001.00EL10Ac1g00071ABC transporter E family member 2
DAF/FSTlcl| Scaffold_716,724,391TATCAATT0.001.000.001.00EL10Ac8g18254BNR repeat-like domain
DAF/FSTlcl| Scaffold_716,724,418AC0.001.000.001.00EL10Ac8g18254BNR repeat-like domain
DAF/FSTlcl| Scaffold_725,250,059AGTGGTTGTGGTTGTG GTTGTGGTTGTGGTTG TGGTTGTGGTTGTGGT TGTGGTTGTGGTTGTGG TTGTGGTTGAGTGGTTGTGGTTGTGG TTGTGGTTGTGGTTGTG GTTGTGGTTGTGGTTGT GGTTGTGGTTG0.080.920.040.78EL10Ac8g20189U4/U6.U5 tri-snRNP-associated protein 2
DAF/FSTlcl| Scaffold_752,512,965TGGG0.001.000.001.00EL10Ac7g17584Major allergen Pru ar 1
DAF/FSTlcl| Scaffold_319,694,86GA0.001.000.040.92EL10Ac3g05987Lysine–tRNA ligase;TMhmm_ExpAA:77.60
DAF/FSTlcl| Scaffold_315,282,274GGGAAA0.001.000.001.00EL10Ac3g06032Hypothetical protein;TMhmm_ExpAA:36.46
DAF/FSTlcl| Scaffold_348,281,437AC0.001.000.001.00EL10Ac3g06055Wall-associated receptor kinase 1
DAF/FSTlcl| Scaffold_356,318,571TTATATATATATATATATATA TATATATATATATATATATATATA TATATATATATATATATTTATATATATATATATA TATATATATATAT0.041.000.080.85EL10Ac3g06056Wall-associated receptor kinase 2;TMhmm_ExpAA:46.88
DAF/FSTlcl| Scaffold_360,769,635GC0.000.840.000.72EL10Ac3g06056Wall-associated receptor kinase 2;TMhmm_ExpAA:46.88
DAF/FSTlcl| Scaffold_235,363,747GTTTTTTTTTTTTTTGGTTTTTTTTTTTTTTTTTTTG0.160.960.080.78EL10Ac3g06056Wall-associated receptor kinase 2;TMhmm_ExpAA:46.88
DAF/FSTlcl| Scaffold_218,141,331AT0.001.000.001.00EL10Ac3g06056Wall-associated receptor kinase 2;TMhmm_ExpAA:46.88
DAF/FSTlcl| Scaffold_217,790,729TA0.001.000.001.00EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_215,093,093CT0.001.000.001.00EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_154,208,817AAGGGTTAGGGTTTAAGGGTTAGGGTTAGGGTTT0.081.000.080.85EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_124,987,470CGGGGGGGGGGGGTCGGGGGGGGGGGGGGT0.161.000.120.79EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_121,263,551TAAAAAGTAAAAAAG0.000.880.000.79EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_119,398,911CA0.001.000.001.00EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_119,217,784GA0.001.000.001.00EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_111,698,071CA0.121.000.120.79EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_111,468,948AT0.001.000.001.00EL10Ac3g06102Protein FAM136A
DAF/FSTlcl| Scaffold_12,848,411GAAGAAA0.001.000.001.00EL10Ac3g05053Hypothetical protein
DAF/FSTlcl| Scaffold_633,124,391AATATATATATATATAT ATATATATATATAAATATATATATATATATA TATATATATATATA0.000.920.080.71EL10Ac3g06365Light-mediated development protein DET1
DAF/FSTlcl| Scaffold_561,709,065GTAC0.001.000.001.00EL10Ac3g05157Peroxidase 5 {ECO:0000250| UniProtKB:P22195}
DAF/FSTlcl| Scaffold_561,709,075GA0.081.000.001.00EL10Ac3g05157Peroxidase 5 {ECO:0000250| UniProtKB:P22195}
DAF/FSTlcl| Scaffold_548,904,484CT0.001.000.080.85EL10Ac3g07201Two-component response regulator ARR9
DAF/FSTlcl| Scaffold_542,132,982CA0.041.000.001.00EL10Ac2g02580Cytochrome b-c1 complex subunit 7
DAF/FSTlcl| Scaffold_57,244,134GCCGC0.080.880.000.79EL10Ac2g02645Hypothetical protein
DAF/FSTlcl| Scaffold_934,647,812GCTGGACTGGACGCTGGACTGGACTGGAC0.121.000.120.79EL10Ac9g21035Exosome component 10
DAF/FSTlcl| Scaffold_945,146,825GT0.001.000.001.00EL10Ac9g21479Calmodulin-binding transcription activator 1
Visualization of chromosome regions on the basis significant F (p-value<0.01). Candidate genes derived from FST, DeltaAF and proximity to chromosomal regions of high significance. FSTG, significant FST loci within gene; FSTP, significant FST loci within promoter sequence; DAF, significant DeltaAF loci; Region, gene found within significant region; NA, gene found within significant region. Marker variation-high consequence (SNPeff), FST, and DeltaAF.

Discussion

Identifying the genetic basis of quantitative traits is a longstanding challenge in crop improvement. In this report, we used a select and sequence (SnS) approach to identify contrasting genetic variants between resistant and susceptible bulks drawn from a synthetic breeding population segregating for resistance to seedling rhizoctonia infection. Using pooled sequencing, we estimated population genetic parameters to investigate fixation (He), genome divergence (F) and changes in allele frequency (DeltaAF) resulting from selection and identified candidate genomic variation underlying Rhizoctonia resistance. We generated a list of putative candidate genes by visualizing the population genetic data with respect to the EL10.2 physical map. The candidate gene list was enriched for genes associated with pathogen defense and cell—wall biosynthesis, both of which are plausible components of rhizoctonia resistance. Additional rounds of selection within the EL57 base population or the advancement of generations in the presence of divergent selection could further resolve causal genetic variation and validate the genetic basis of Rhizoctonia resistance in beet. SnS experiments using segregating populations provide a system to study the underlying genetics of polygenic traits as part of ongoing selection activities within a breeding program. Here we show how pooled sequencing could be used for discovery of key genetic variation when applied to polygenic traits within a population with an extremely broad genetic base. In this case, Rhizoctonia resistance stored within the synthetic EL57 population was derived from EL51, which can be traced to FC701 as the likely source (Panella et al., 2015). Significant signals of divergence as the result of selection were distributed across the genome indicative of a polygenic trait. This is consistent with previous reports of trait heritability (Hecker and Ruppel, 1975). Expected heterozygosity (He) estimated using all biallelic sites showed a greater level of fixation in the resistant bulk, suggesting that the genetic background that conditions resistance to Rhizoctonia could be selected and identified within a highly heterozygous population. The fact that only a few resistance sources have been identified even with considerable effort suggests genome informed approaches may be key to characterizing the source under study here as well as identifying new sources for Rhizoctonia resistance in other diverse populations. FST and DeltaAF are complementary statistics that were both able to identify the effects of selection across the genome. DeltaAF was a more stringent statistic in terms of the number of significant loci and putative genes detected, as evidenced by all significant DeltaAF loci appearing as a subset of significant FST loci. It has been shown that generating a null distribution of allele frequency in an unselected population is important for separating signal from noise when detecting selection (Galtier and Duret, 2007). Therefore, DeltaAF could have an advantage in identifying causal variation due to its ability to leverage unselected allele frequencies to further distinguish significant loci resulting from selection, as opposed to differences resulting from historical population dynamics or genetic drift. The final candidate gene list was strongly enriched for disease resistance genes and cell wall biosynthesis genes, suggesting complementary mechanisms involved in host resistance. To better define the genomic background associated with the putative EL51/FC701 resistance source, we specifically focused on genes which can explain resistance and are documented in the literature with known disease resistance functions, such as pathogen perception, signal transduction and cellular response to pathogens. The wide array of obvious defense genes such as Ser/Thr kinases, resistance gene analogs, chitinases, and peroxidases is in line with our expectations of how plants could defend themselves against a generalist pathogen such as Rhizoctonia. Other members of the candidate gene list do not have established roles in plant defense. These are genes with plausible but speculative roles, such as transcription factors and putative cell membrane-associated proteins. The combination of known defense genes along with additional genes of unknown function provides direction for developing testable hypotheses regarding the mechanisms of defense. In addition to genes involved in host-pathogen interactions, variation in cell wall biosynthesis could make some plants more resistant to infection. Previous studies have identified seedling resistance in comparisons between susceptible (USH20) and resistant (EL51) varieties (Nagendran et al., 2009). Resistant plants showed a durable resistance including the ability to limit the spread of infection beyond the epidermis, including maintenance of cell wall integrity in the presence of pathogen-derived enzymes that varied with respect to plant age. For this reason, identifying numerous cell wall-related genes among our significant loci adds evidence to the importance of cell wall biosynthesis in limiting Rhizoctonia infection, especially at the seedling stage. In conclusion, this research provides a genomic perspective to seedling Rhizoctonia resistance in beets, a complex polygenic trait with agricultural importance. We think it is a useful exercise to develop methods and generate lists of candidate genes involved with important traits in order to validate results and prioritize candidate variation for functional studies. A better understanding of the limitations of these experiments and our ability to detect significant variation is warranted. The detection of PAV in pooled data is perhaps the most visible limitation of this experiment. If PAV is causal and not represented in the genomic data then we rely on linkage, which is not a strength of pooled sequencing designs. Future experiments should address the ability of pooled assemblies to represent the genomes of populations under investigation with respect to PAV, and whether PAV frequency can be measured. Starting with the best possible catalog of variants for population genetic parameters represents the highest degree of resolution for the identification of causal variation. Select and sequence experiments have the potential to explore the genetic base of beet through the identification of alleles in wild material as well as characterize existing germplasm for agriculturally important traits. Using this approach, beet breeding programs can simultaneously generate markers and improve the genetic base of populations using phenotypic selection.

Data Availability Statement

The original contributions presented in the study are publicly available. This data can be found here: EL57 Illumina reads for the resistance, susceptible and unselected populations were deposited to NCBI under BioProject (PRJNA563463). The EL10.2 genome assembly (https://genomevolution.org/coge/GenomeInfo.pl?gid=57232). All variant files (.vcf) and files used for visualization are available at (Data Dryad - https://doi.org/10.5061/dryad.3j9kd51kg). All code is available at (https://github.com/BetaGenomeNinja/EL57). This includes bash scripts, Jupyter-note books for python code development, python scripts for data manipulation and pop gen estimators and R code for plotting and visualization of data.

Author Contributions

JM developed the synthetic EL57 population. PG, JM, and AF conceived and designed the experiments and edited reviewed and approved the final manuscript. JM and PG performed the experiments. PG and AF analyzed the data. PG wrote the draft manuscript. All authors contributed to the article and approved the submitted version.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
  30 in total

1.  A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.

Authors:  Pablo Cingolani; Adrian Platts; Le Lily Wang; Melissa Coon; Tung Nguyen; Luan Wang; Susan J Land; Xiangyi Lu; Douglas M Ruden
Journal:  Fly (Austin)       Date:  2012 Apr-Jun       Impact factor: 2.160

2.  Genomic scans for selective sweeps using SNP data.

Authors:  Rasmus Nielsen; Scott Williamson; Yuseob Kim; Melissa J Hubisz; Andrew G Clark; Carlos Bustamante
Journal:  Genome Res       Date:  2005-11       Impact factor: 9.043

3.  Nucleotide-binding resistance gene signatures in sugar beet, insights from a new reference genome.

Authors:  Andrew Funk; Paul Galewski; J Mitchell McGrath
Journal:  Plant J       Date:  2018-05-23       Impact factor: 6.417

4.  The population genetics of structural variants in grapevine domestication.

Authors:  Yongfeng Zhou; Andrea Minio; Mélanie Massonnet; Edwin Solares; Yuanda Lv; Tengiz Beridze; Dario Cantu; Brandon S Gaut
Journal:  Nat Plants       Date:  2019-09-09       Impact factor: 15.793

5.  Interaction of Sugar Beet Host Resistance and Rhizoctonia solani AG-2-2 IIIB Strains.

Authors:  Carl A Strausbaugh; Imad A Eujayl; Leonard W Panella
Journal:  Plant Dis       Date:  2013-09       Impact factor: 4.438

6.  Selection for Resistance to the Rhizoctonia-Bacterial Root Rot Complex in Sugar Beet.

Authors:  Carl A Strausbaugh; Imad A Eujayl; Paul Foote
Journal:  Plant Dis       Date:  2013-01       Impact factor: 4.438

7.  Population-genetic inference from pooled-sequencing data.

Authors:  Michael Lynch; Darius Bost; Sade Wilson; Takahiro Maruki; Scott Harrison
Journal:  Genome Biol Evol       Date:  2014-04-30       Impact factor: 3.416

8.  Next-generation genome annotation: we still struggle to get it right.

Authors:  Steven L Salzberg
Journal:  Genome Biol       Date:  2019-05-16       Impact factor: 13.583

Review 9.  Sequencing pools of individuals - mining genome-wide polymorphism data without big funding.

Authors:  Christian Schlötterer; Raymond Tobler; Robert Kofler; Viola Nolte
Journal:  Nat Rev Genet       Date:  2014-09-23       Impact factor: 53.242

10.  Secondary Evolve and Resequencing: An Experimental Confirmation of Putative Selection Targets without Phenotyping.

Authors:  Claire Burny; Viola Nolte; Pierre Nouhaud; Marlies Dolezal; Christian Schlötterer
Journal:  Genome Biol Evol       Date:  2020-03-01       Impact factor: 4.065

View more
  1 in total

1.  Cell-Wall-Degrading Enzymes-Related Genes Originating from Rhizoctonia solani Increase Sugar Beet Root Damage in the Presence of Leuconostoc mesenteroides.

Authors:  Rajtilak Majumdar; Carl A Strausbaugh; Paul J Galewski; Rakesh Minocha; Christopher W Rogers
Journal:  Int J Mol Sci       Date:  2022-01-25       Impact factor: 5.923

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.