Literature DB >> 35085258

Nicotine treatment regulates PD-L1 and PD-L2 expression via inhibition of Akt pathway in HER2-type breast cancer cells.

Masanori A Murayama1,2, Erika Takada1, Kenji Takai1, Nagisa Arimitsu1, Jun Shimizu1, Tomoko Suzuki1, Noboru Suzuki1.   

Abstract

The immune checkpoint molecules such as PD-L1 and PD-L2 have a substantial contribution to cancer immunotherapy including breast cancer. Microarray expression profiling identified several molecular subtypes, namely luminal-type (with a good-prognosis), HER2-type (with an intermediate-prognosis), and triple-negative breast cancer (TNBC)-type (with a poor-prognosis). We found that PD-L1 and PD-L2 mRNA expressions were highly expressed in TNBC-type cell lines (HCC1937, MDA-MB-231), moderately expressed in HER2-type cell line (SK-BR-3), and poorly expressed in luminal-type cell lines (MDA-MB-361, MCF7). The PD-L1 and PD-L2 expression in SK-BR-3 cells, but not those in HCC1937 and MDA-MB-231 cells, decreased by nicotine stimulation in a dose-dependent manner. In addition, nicotine treatment decreased the phosphorylation of Akt in SK-BR-3 cells, but not in other cell lines. These results show that nicotine regulates the expression of immune checkpoint molecules, PD-L1 and PD-L2, via inhibition of Akt phosphorylation. This findings may provide the new therapeutic strategies for the treatment of breast cancer.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35085258      PMCID: PMC8794171          DOI: 10.1371/journal.pone.0260838

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Immune-checkpoint molecules, such as programmed cell death protein 1 (PD-1), programmed death ligand 1 (PD-L1) and PD-L2 are outstanding targets for cancer immunotherapy [1]. PD-1 is particularly expressed on cytotoxic T cells. PD-L1 is ubiquitously expressed in many tissues and cells including dendritic cells and PD-L2 expression is restricted to macrophages and dendritic cells [2]. The binding of PD-1 on T cells to PD-L1 and PD-L2 on antigen-presenting cells negatively regulates T cell effector function [3]. The PD-L1 and PD-L2 expressed on tumor cells cause tumor immune escape [4]. Recently, breast cancer was categorized into several subtypes such as luminal-type (estrogen receptor (ER) and progesterone receptor (PR) positive, good-prognosis), HER2-type (human epidermal growth factor receptor 2 positive, intermediate prognosis), and triple-negative breast cancer-type (TNBC, ER, PR and HER2 negative, poor-prognosis) [5]. The levels of PD-L1 expression were different in each subtype of breast cancer cell lines [6]. The PD-L1 expression was associated with histological grade, pathological stage, tumor infiltrating lymphocytes (TILs), better disease-free survival (DFS), and overall survival (OS) in breast cancer patients. Based on the intrinsic subtype, PD-L1 expression associates with the levels of TILs in HER2- and TNBC-type patients [7]. Another report also showed that the PD-L1 expression associates with histological grade, TILs, and DFS in HER2-type breast cancer [8]. As with PD-L1 expression in breast cancer patients, PD-L2 expression is positive in half of the breast cancer patients. However, the PD-L2 expression is not associated with better OS [9]. Smoking is one of risk factors in breast cancer [10]. Nicotine is a natural compound in tobacco plants, which is a highly addictive. Nicotine exerts biological effects on excitable and non-excitable cells via nicotinic acetylcholine receptors (nAChRs) [11]. The expression levels of nAChR subunits are different on breast cancer cell lines [12]. It is reported that nicotine acts on breast cancer cells such as luminal- and TNBC-type via some nAChRs [13-21]. However, the nicotine-mediated biological effects including the regulation of immune-check point molecules on HER2-type breast cancer cells are largely unknown. In this study, we focused on the nicotine-mediated expression of immune-check point molecules, PD-L1 and PD-L2, on breast cancer cells using luminal-, HER2-, and TNBC-type breast cancer cell lines.

Materials and methods

Cell lines

Human breast cancer cell lines; luminal-type (MDA-MB-361 and MCF7), HER2-type (SK-BR-3) and TNBC-type (HCC1937, MDA-MB-231) were purchased from American Type Culture Collection (ATCC, Rockville, MD, USA). According to manufacturer’s instructions, MDA-MB-361 cells were cultured in in Leibovitz’s L-15 medium (ATCC) containing 20% FBS (without heat inactivation) without CO2 aeration. MCF7 cells were cultured in Eagle’s Minimum Essential Medium (ATCC) containing 10% FBS (without heat inactivation) and 0.01 mg/ml of human recombinant insulin under the 5% CO2 aeration. SK-BR-3 cells were cultured in McCoy’s 5a Medium (ATCC) containing 10% FBS (without heat inactivation) under the 5% CO2 aeration. HCC1937 cells were cultured in RPMI-1640 medium (ATCC) containing 10% FBS (without heat inactivation) under the 5% CO2 aeration. MDA-MB-231 cells were cultured in Leibovitz’s L-15 medium (ATCC) containing 10% FBS (without heat inactivation) without CO2 aeration.

Nicotine treatment

All cell lines (6 x 104 cells/well) were seeded in 24-well plate (Iwaki, Shizuoka, Japan) and cultured with or without nicotine (SIGMA, St. Louis, MO, USA) for 24 h.

Real-time PCR

Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, Valencia, CA, USA) from 1 x 105 cells of breast cancer cell lines in 24-well plate and reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). We performed real-time PCR using TaqMan Gene Expression Master Mix (Applied Biosystems) or THUNDERBIRD SYBR qPCR Mix (TOYOBO) and 7300 Real-Time PCR System (Applied Biosystems) with a set of primers which were purchased from Thermo Fisher Scientific (Waltham, MA, USA, ACTB: Hs01060665_g1, PDL1: Hs00204257-m1, and PDL2: Hs00228839-m1) and were described in Table 1 [22-24].
Table 1

The real-time PCR primers sets.

Gene nameForward primerReverse primer
CHRNA1 GCTCTGTCGTGGCCATCAA CCGGAAAGCGACCAGCCAGA
CHRNA2 GTGGAGGAGGAGGACAGA CTTCTGCATGTGGGGTGATA
CHRNA3 CAGAGTCCAAAGGCTGCAAG AGAGAGGGACAGCACAGCAT
CHRNA4 CTCACCGTCCTTCTGTGTC CTGGCTTTCTCAGCTTCCAG
CHRNA5 CTTCACACGCTTCCCAAACT CTTCAACAACCTCACGGACA
CHRNA6 TCCATCGTGGTGACTGTGT AGGCCACCTCATCAGCAG
CHRNA7 GTACGCTGGTTTCCCTTTGA CCACTAGGTCCCATTCTC
CHRNA9 GAAAGCAGCCAGGAACAAAG GCACTTGGCGATGTACTCAA
CHRNA10 ACACAAGTGCCCTGAGACCT TCCCATCGTAGGTAGGCATC
CHRNB1 CTACGACAGCTCGGAGGTCA GCAGGTTGAGAACCACGACA
CHRNB2 GGCATGTACGAGGTGTCCTT CACCTCACTCTTCAGCACCA
CHRNB3 AACAGTTCCGTTTGATTTCACGAT CCCTGATGACCAAGGTCATC
CHRNB4 TCCCTGGTCCTTTTCTTCCT TGCAGCTTGATGGAGATGAG
CHRNG CGCCTGCTCTATCTCAGTCA GGAGACATTGAGCACAACCA
CHRND CAGATCTCCTACTCCTGCAA CCACTGATGTCTTCTCACCA
CHRNE TCAAGGTCACCCTGACGAAT GTCGATGTCGATCTTGTTGA
KLF4 GAAATTCGCCCGCTCCGATGA CTGTGTGTTTGCGGTAGTGCC
WNT5A CTTCGCCCAGGTTGTAATTGAAGC CTGCCAAAAACAGAGGTGTTATCC

Immunohistochemistry

Cytospin slides (2 x 104 cells/slide) were prepared using NewSilane II Micro Slides (Muto Pure Chemicals, Tokyo, Japan), fixed with 4% PFA at room temperature for 10 min, blocked with Blocking One Histo (Nacalai Tesque, Kyoto, Japan) at room temperature for 2 h, and then stained with primary antibodies to human PD-L1 (1:200 dilution, #ab205921, Abcam, Cambridge, MA, USA), PD-L2 (1:500, #MAB1224, R&D Systems, Minneapolis, MN, USA), Akt (1:200, #9272, Cell Signaling, Danvers, MA, USA) and phospho-Akt (1:200, #ab105731, Abcam) at 4°C for overnight, coupled with secondary antibodies to Alexa Fluor® 594 goat anti-rabbit IgG (1:300, #A11072, Thermo Fisher Scientific) and anti-mouse IgG (1:300, #A11005, Thermo Fisher Scientific) at room temperature for 3h. For nucleus staining, we used DAPI (0.4 μg/ml, #D9564, SIGMA). The immunofluorescence was examined with a confocal microscope (LSM-800, Zeiss, Oberkochen, Germany) and staining intensity was quantitated using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Cell viability assay

SK-BR-3 cells were seeded at a density of 1 x 104 cells/well on 96-well plate. After 24 h culture, the cells were treated with nicotine (0, 1, 10, and 100 nM) for 24 h. Cell viability was measured by MTT (3-[4, 5-dimethylthiazol-2-yl]-2, 5 diphenyl tetrazolium bromide) assay reagent (Nacalai, Japan) according to manufacturer’s protocol.

Statistical analysis

Two-sided Student’s t-test was performed for all statistical evaluation. P<0.05 was considered as statistically significant. Data are expressed as mean ± standard error of the mean (SEM).

Results

PD-L1 and PD-L2 mRNA expressed in HER2-type and TNBC-type cell lines

PD-L1 and PD-L2 expressions were found in about half of breast cancer cases [9]. Consistent with previous report [6], we found that PD-L1 mRNA highly expressed in HER2-type SK-BR-3 cells, TNBC-type HCC1937 cells, and MDA-MB-231 cells (Fig 1A).
Fig 1

The mRNA expression of PD-L1 and PD-L2 in breast cancer cell lines.

The relative mRNA expressions of PD-L1 (A) and PD-L2 (B) on breast cancer cell lines were measured by qPCR (n = 4 each). The values were relative to the mRNA expressions of SK-BR-3. Each mean ± SEM is shown. N.D: Not detected.

The mRNA expression of PD-L1 and PD-L2 in breast cancer cell lines.

The relative mRNA expressions of PD-L1 (A) and PD-L2 (B) on breast cancer cell lines were measured by qPCR (n = 4 each). The values were relative to the mRNA expressions of SK-BR-3. Each mean ± SEM is shown. N.D: Not detected. It is reported that TNBC-type cell lines expressed PD-L1 and PD-L2 [25]. In addition to TNBC-type cells (HCC1937 and MDA-MB-231), we found that PD-L2 mRNA was expressed in SK-BR-3 cells (Fig 1B).

Nicotine treatment decreased PD-L1 and PD-L2 expressions via inhibition of Akt pathway in a HER2-type cell line

To elucidate the role of nicotine in the expressions of PD-L1 and PD-L2 in breast cancer cells, the mRNA expressions were evaluated after nicotine treatment in the molecule positive cell lines. The PD-L1 mRNA expressions in HCC1937 and MDA-MB-231 cells were not affected by nicotine treatment (Fig 2A and 2B). We found that nicotine treatment decreased PD-L1 mRNA (Fig 2C) and protein (Fig 2D and 2E) expressions in SK-BR3 cells in a dose dependent manner.
Fig 2

The effect of nicotine treatment for PD-L1 expressions on breast cancer cell lines.

(A-C) Breast cancer cell lines, HCC1937 cells (A), MDA-MB-231 cells (B), and SK-BR-3 cells (C) were stimulated with nicotine (0–100 nM) and the relative mRNA expressions of PD-L1 to those without the stimulations (nicotine 0 nM: Relative expression = 1) were measured by qPCR (n = 4 each). (D, E) SK-BR-3 cells were cultured in the absence and presence of nicotine (1, 10 and 100 mM) and were stained with anti-PD-L1 antibody. DAPI was used for detecting nuclei. (D) One of the representative figures is shown. (E) The relative expression of PD-L2 was determined by using ImageJ (n = 5 each). Each mean ± SEM is shown. *p < 0.05 and ***p < 0.001.

The effect of nicotine treatment for PD-L1 expressions on breast cancer cell lines.

(A-C) Breast cancer cell lines, HCC1937 cells (A), MDA-MB-231 cells (B), and SK-BR-3 cells (C) were stimulated with nicotine (0–100 nM) and the relative mRNA expressions of PD-L1 to those without the stimulations (nicotine 0 nM: Relative expression = 1) were measured by qPCR (n = 4 each). (D, E) SK-BR-3 cells were cultured in the absence and presence of nicotine (1, 10 and 100 mM) and were stained with anti-PD-L1 antibody. DAPI was used for detecting nuclei. (D) One of the representative figures is shown. (E) The relative expression of PD-L2 was determined by using ImageJ (n = 5 each). Each mean ± SEM is shown. *p < 0.05 and ***p < 0.001. PD-L2 mRNA expressions in HCC1937 and MDA-MB-231 cells were not affected by nicotine treatment (Fig 3A and 3B). We found that nicotine treatment decreased PD-L2 mRNA (Fig 3C) and protein (Fig 3D and 3E) expressions in SK-BR3 cells in a dose dependent manner.
Fig 3

The effect of nicotine treatment for PD-L2 expressions on breast cancer cell lines.

(A-C) Breast cancer cell lines, HCC1937 cells (A), MDA-MB-231 cells (B), and SK-BR-3 cells (C) were stimulated with nicotine (0–100 nM) and the relative mRNA expressions of PD-L2 to those without the stimulations (nicotine 0 nM: Relative expression = 1) were measured by qPCR (n = 4 each). (D, E) SK-BR-3 cells were cultured in the absence and presence of nicotine (1, 10 and 100 mM) and were stained with anti-PD-L2 antibody. DAPI was used for detecting nuclei. (D) One of the representative figures is shown (n = 5 each). (E) The relative expression of PD-L2 was determined by using ImageJ. Each mean ± SEM is shown. *p < 0.05 and **p < 0.01.

The effect of nicotine treatment for PD-L2 expressions on breast cancer cell lines.

(A-C) Breast cancer cell lines, HCC1937 cells (A), MDA-MB-231 cells (B), and SK-BR-3 cells (C) were stimulated with nicotine (0–100 nM) and the relative mRNA expressions of PD-L2 to those without the stimulations (nicotine 0 nM: Relative expression = 1) were measured by qPCR (n = 4 each). (D, E) SK-BR-3 cells were cultured in the absence and presence of nicotine (1, 10 and 100 mM) and were stained with anti-PD-L2 antibody. DAPI was used for detecting nuclei. (D) One of the representative figures is shown (n = 5 each). (E) The relative expression of PD-L2 was determined by using ImageJ. Each mean ± SEM is shown. *p < 0.05 and **p < 0.01. Cell proliferation, cell migration, and maintenance of cancer stem cell features are important for tumorigenesis. We found that nicotine treatment did not affect the cell viability of SK-BR-3 cells (Fig 4A). Next, we investigated the expression of KLF4, which is important for the maintenance of breast cancer stem cell features and the promotion of the cell migration and invasion [22]. Nicotine stimulation did not influence KLF4 mRNA expression in SK-BR-3 cells (Fig 4B). Wnt5a is important for cell migration [26]. Nicotine treatment decreased Wnt5a mRNA expression in SK-BR-3 cells in a dose-dependent manner (Fig 4C). It suggests that nicotine treatment inhibits breast cancer cell migration.
Fig 4

Nicotine decreased Wnt5a expressions in SK-BR-3 cells.

(A) Cell viability of SK-BR-3 cells with nicotine treatment (0–100 nM) was measured by MTT assay (n = 4 each). (B, C) KLF4 (B) and Wnt5a (C) mRNA expressions in SK-BR-3 cells at 24 h after nicotine treatment were measured by qPCR (n = 4 each). Each mean ± SEM is shown. ***p < 0.001.

Nicotine decreased Wnt5a expressions in SK-BR-3 cells.

(A) Cell viability of SK-BR-3 cells with nicotine treatment (0–100 nM) was measured by MTT assay (n = 4 each). (B, C) KLF4 (B) and Wnt5a (C) mRNA expressions in SK-BR-3 cells at 24 h after nicotine treatment were measured by qPCR (n = 4 each). Each mean ± SEM is shown. ***p < 0.001. Wnt5a signaling induces cancer cell migration via Akt phosphorylation [27,28]. PD-L1 and PD-L2 was expressed via Akt pathway in cancer including breast cancer [29-31]. We examined the role of nicotine treatment for Akt phosphorylation in SK-BR-3 cells. The phosphorylation of Akt decreased at 30 min after nicotine treatment in the cell line (Fig 5A). On the other hand, we found that MCF7, HCC1937 and MDA-MB-231 cells did not express Akt protein and nicotine treatment did not affect Akt expression and the phosphorylation in these cells (Fig 5B–5D). As expected, an Akt inhibitor, MK-2206, suppressed PD-L1 and PD-L2 expressions in a dose-dependent manner (Fig 5E and 5F). Thus, these results show that nicotine treatment affects PD-L1 and PD-L2 expressions via inhibition of Akt pathway in a HER2-type cell line.
Fig 5

Nicotine decreased Akt phosphorylation in SK-BR-3 cells.

(A) Akt expressions and the phosphorylation in nicotine-treated SK-BR-3 cells were assayed by immunostaining. SK-BR-3 cells were stimulated with 100 nM nicotine for indicated time and the cells were stained with indicated antibodies (red). DAPI (blue) was used for detecting nuclei. Some of representative figures of total-Akt (upper), phosphorylated Akt (lower) are shown. The relative phosphorylation intensity of Akt was calculated using ImageJ (n = 5–7 each). (B-D) Akt expressions and the phosphorylation in nicotine-treated MCF8 (B), HCC1937 (C) and MDA-MB-231 (D) cells were assayed by immunostaining. SK-BR-3 cells were stimulated with 100 nM nicotine for indicated time and the cells were stained with indicated antibodies (red). DAPI (blue) was used for detecting nuclei. Some of representative figures of total-Akt (left), phosphorylated Akt (right) are shown (n = 3–4 each). (E, F) The PD-L1 (E) and PD-L2 (F) expressions in MK-2206, an Akt inhibitor, -treated SK-BR-3 cells are shown. SK-BR-3 cells were stimulated with MK-2206 (0–50 nM) for 24 h and the cells were stained with indicated antibodies (red). DAPI (blue) was used for detecting nuclei. Some of representative figures of PD-L1 or PD-L2 (left) and the relative expression levels (right) are shown. The relative expression levels of PD-L1 or PD-L2 are determined by using ImageJ (n = 5–7 each).

Nicotine decreased Akt phosphorylation in SK-BR-3 cells.

(A) Akt expressions and the phosphorylation in nicotine-treated SK-BR-3 cells were assayed by immunostaining. SK-BR-3 cells were stimulated with 100 nM nicotine for indicated time and the cells were stained with indicated antibodies (red). DAPI (blue) was used for detecting nuclei. Some of representative figures of total-Akt (upper), phosphorylated Akt (lower) are shown. The relative phosphorylation intensity of Akt was calculated using ImageJ (n = 5–7 each). (B-D) Akt expressions and the phosphorylation in nicotine-treated MCF8 (B), HCC1937 (C) and MDA-MB-231 (D) cells were assayed by immunostaining. SK-BR-3 cells were stimulated with 100 nM nicotine for indicated time and the cells were stained with indicated antibodies (red). DAPI (blue) was used for detecting nuclei. Some of representative figures of total-Akt (left), phosphorylated Akt (right) are shown (n = 3–4 each). (E, F) The PD-L1 (E) and PD-L2 (F) expressions in MK-2206, an Akt inhibitor, -treated SK-BR-3 cells are shown. SK-BR-3 cells were stimulated with MK-2206 (0–50 nM) for 24 h and the cells were stained with indicated antibodies (red). DAPI (blue) was used for detecting nuclei. Some of representative figures of PD-L1 or PD-L2 (left) and the relative expression levels (right) are shown. The relative expression levels of PD-L1 or PD-L2 are determined by using ImageJ (n = 5–7 each). Nicotine exerts biological effects via various combinations of nAChR subunits [11]. We examined mRNA expressions of several nAChR subunits in breast cancer cell lines by real-time PCR (Fig 6). We did not detect nAChRβ3, γ, δ and ε mRNA expressions in breast cancer cell lines. SK-BR-3 cells expressed substantially several nAChR subunits mRNA compared with other subtype breast cancer cells except for nAChRα1 and α4 subunits.
Fig 6

The expression of nAChR subunits in breast cancer cells.

The relative mRNA expressions of nAChR subunits in breast cancer cell lines was measured by qPCR. The values were relative to the mRNA expressions of MCF7 cells. N.D.: Not detected.

The expression of nAChR subunits in breast cancer cells.

The relative mRNA expressions of nAChR subunits in breast cancer cell lines was measured by qPCR. The values were relative to the mRNA expressions of MCF7 cells. N.D.: Not detected.

Discussion

In this study, we found that immune-check point molecules, PD-L1 and PD-L2, were highly expressed in TNBC-type HCC1937 and MDA-MB-231 cells and were moderately expressed in HER2-type SK-BR-3 cells. The PD-L1 and PD-L2 expressions were decreased by nicotine treatment via inhibition of Akt phosphorylation in SK-BR-3 cells, but not in HCC1937 and MDA-MB-231 cells. Thus, nicotine and related molecules can be useful therapeutic targets in HER2-type breast cancer for the cancer immunotherapy. Nicotine exerts biological effects on excitable and non-excitable cells via various combinations of nAChR subunits [11]. 16 homologous genes encode the subunits of nAChR. Muscle-type nAChRs include nAChR(α1)2β1δε (adult receptor) or nAChR(α1)2β1δγ (fetal receptor). Neuronal-type nAChRs are homo- or hetero-pentamers composed of some of nine α subunits (α2-α10) and some of three β subunits (β2–4) [11]. Each combination of nAChR subunits has distinct and specific roles in the biological processes of muscles and neurons. The expression profile of nAChR subunits is different in subtypes of breast cancer [12]. The nAChRα5 associates with cell cycle, apoptosis, and DNA damage response of luminal-type breast cancer cells [13]. The nAChRα7 promotes cell proliferation and apoptosis in a panel of breast cancer cell lines [14]. The nAChRα9 promotes invasion ability, apoptosis resistance, and growth of luminal-type breast cancer cells [15-18]. The nAChRα9 promotes growth and transformation of TNBC-type breast cancer cells [19,20]. The nonselective nAChR antagonist inhibits nicotine-induced TNBC-type breast cancer cell growth [21]. Thus, nicotine causes negative effects for cancer immunotherapy on luminal- and TNBC-type breast cancers via nAChRα5, α7 and α9 subunits. Furthermore, nAChRα9 mediates nicotine-induced PD-L1 expression in melanoma cells [32]. However, nicotine treatment decreased PD-L1 and PD-L2 expression in HER2-type breast cancer cells in this study. We found that SK-BR-3 cells expressed substantially several nAChR subunits mRNA compared with other subtype breast cancer cells except for nAChRα1 and α4 subunits. It suggested that these nAChR subunits mediated nicotine-induced cancer immunotherapy on HER2-type breast cancer cells. The expression of PD-L1 and PD-L2 is regulated by Akt pathway on cancer cells including breast cancer [29-31]. Furthermore, interaction of PD-1 and PD-L1 causes resistance to chemotherapy via activation of Akt pathway [33]. Thus, Akt-targeted therapy is important to overcome multi-drug resistance in breast cancer [34]. We found that nicotine decreased Akt phosphorylation on HER2-type cells. In contrast, luminal- and TNBC cells did not express Akt and nicotine treatment did not affect Akt expressions in these cells. These results suggest that nicotine may exert positive effects for the cancer immunotherapy of HER2-type cancers through different mechanisms from the negative effects on the luminal- and TNBC-type breast cancers. This finding suggests that nicotine treatment could develop useful therapeutic methods for HER2-type breast cancer. 17 Jun 2021 PONE-D-21-09905 Nicotine treatment regulates PD-L1 and PD-L2 expression via inhibition of Akt pathway in HER2-type breast cancer cells PLOS ONE Dear Dr. Suzuki, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. From the reviews provided, it can be seen that a significant amount of additional molecular/mechanistic data is needed for this to be of interest to PLOS One.  As indicated by both the reviewers, the study is premature and does not fully support the conclusions or provide a cohesive, complete story.  A significant amount of additional molecular data would be necessary to make this a convincing story and this would be the expectation, if you were to submit a revised version. Please submit your revised manuscript by Jul 30 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:  http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at  https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols . We look forward to receiving your revised manuscript. Kind regards, Srikumar Chellappan Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: "This work was supported in part by Smoke Research Foundation (SRF, Tokyo, Japan, https://www.srf.or.jp/) to NS . The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "NO" Please include your amended statements within your cover letter; we will change the online submission form on your behalf. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: No Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript, authors investigated the expression patterns of immune checkpoint molecules PDL1 and PDL2 in different subtypes of breast cancer cell lines. Authors show that nicotine treatment was able to reduce the expression of PDL1 and PDL2 in HER2 positive breast cancer cell line SK-BR-3 and showed no inhibitory effect in TNBC cell line HCC1937 and MDA-MB-231. Further, authors have observed that nicotine mediated inhibitory effect on PDL1 and PDL2 in HER2 positive breast cancer cell line SK-BR-3 was dependent on the regulation of Akt pathway and may provide the new therapeutic strategies for the treatment of breast cancer. The data reported here appears to be very preliminary and more in-depth work is required to improve the scope of this manuscript. 1. It is important to investigate the effect of nicotine treatment mediated changes in the PD-L1/L2 expression and the impact on cancer stem cell like properties, proliferation, and migration. 2. nAChR subunits expression levels in these cell lines should be included and its correlation with PD-L1 and PD-L2 needs to be investigated. 3. In addition to qRT-PCR data of mRNA expression, authors should validate the PD-L1 surface expression of PD-L1 and PD-L2 by flow cytometry in all cell lines before and after nicotine treatment. 4. Figure 2D, please provide better quality of immunofluorescence images for PDL1 and also provide immunofluorescence images for PDL2 in figure 2E. 5. Overall, the quality of immunofluorescence images is not convincing 6. AKT phosphorylation with one cell line is not enough. Authors need to perform in multiple cell lines. It also lacks proper positive control with AKT inhibitor to look at PDL1 and PDL2 expression. Or consider knocking down of Akt expression by siRNA experiments. Reviewer #2: Reviewer’s Comment: The present study by Murayama MA et al titled “Nicotine treatment regulates ………. Breast cancer cells” ineptly demonstrated a very preliminary rather a qualitative observation where an active natural tobacco ingredient, nicotine suppresses immune checkpoint molecules, PD-L1 and PD-L2 expression in HER2+ type breast cancer cells which in turn might correlate directly or indirectly with the dephosphorylation status of AKT molecules in these types of cells. Given that the basic concept of AKT phosphorylation depends on the status of the immune checkpoint molecule, PD-Ls expression that majorly studied in the field of gastric cancers, nevertheless, in-depth molecular analysis in the field of breast cancer, especially on this particular subtype (HER2+ in this case) might be of tremendous interest in the field and warrants more comprehensive and mechanistic studies. In a nutshell, the current study is a premature and trivial piece of work without much in-depth molecular analysis and hence does not attract this reviewer in favor of publication. The areas to improve in the study are listed below, 1. How PD-L expressions directly regulate AKT phosphorylation that could be investigated in the breast cancer cells, especially in the context of HER2+ subtypes followed by the modulation upon nicotine administration. Authors should investigate the molecular insight of it. The presented data is just the tip of the iceberg! 2. A single cell line data can always be deceptive and therefore, needs supplementation and/or recapitulation in few more cell lines under a particular subtype before drawing any major conclusion. 3. What is the nicotinic acetylcholine receptor(s) status under the different subtypes of breast cancer cells utilized in the study? A comprehensive RT-PCR panel would have been interesting to correlate the effect of nicotine in these subtypes under the study. 4. To establish the real correlation between PD-L1 and PD-L2 expression with phospho-AKT and nAChRs expression, authors could have done comprehensive ICC/IHC studies on commercially available BC tissue microarrays (TMAs) and could have expanded their analysis on the different subtypes in BC! 5. How nicotine differentially modulates the AKT phosphorylation via modulation of PD-L expression between HER2+ versus TNBC cells though they both express these same set of immune checkpoint molecules? This fundamental question also remains unanswered in the manuscript. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Krithika Kodumudi Reviewer #2: Yes: SahaB [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 28 Aug 2021 Correspondence to Editor Thank you for reviewing our manuscript entitled "Nicotine treatment regulates PD-L1 and PD-L2 expression via inhibition of Akt pathway in HER2-type breast cancer cells". Now we are submitting the revised manuscript. We really appreciate your kind comments and, according to your suggestion, we have revised the manuscript as follows. [Journal Requirements] When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf Thank you for your comments. We revised manuscript at your style requirements. 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: "This work was supported in part by Smoke Research Foundation (SRF, Tokyo, Japan, https://www.srf.or.jp/) to NS . The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "NO". Please include your amended statements within your cover letter; we will change the online submission form on your behalf. Thank you for your comments. We removed the funding-related text from the manuscript and we described the statement in the cover letter according to your comment. Correspondence to Reviewer #1 In this manuscript, authors investigated the expression patterns of immune checkpoint molecules PDL1 and PDL2 in different subtypes of breast cancer cell lines. Authors show that nicotine treatment was able to reduce the expression of PDL1 and PDL2 in HER2 positive breast cancer cell line SK-BR-3 and showed no inhibitory effect in TNBC cell line HCC1937 and MDA-MB-231. Further, authors have observed that nicotine mediated inhibitory effect on PDL1 and PDL2 in HER2 positive breast cancer cell line SK-BR-3 was dependent on the regulation of Akt pathway and may provide the new therapeutic strategies for the treatment of breast cancer. The data reported here appears to be very preliminary and more in-depth work is required to improve the scope of this manuscript. Thank you for reviewing our manuscript. We revised our manuscript according to your comments and suggestions as follows. 1. It is important to investigate the effect of nicotine treatment mediated changes in the PD-L1/L2 expression and the impact on cancer stem cell like properties, proliferation, and migration. We evaluated PD-L1 (Fig. 2)/PD-L2 (Fig. 3) expressions with/without nicotine treatment by qPCR and IHC. And according to your suggestions, we investigated the impact of nicotine treatment on the cell proliferation using MTT assay. We found that nicotine treatment did not alter the proliferation rates of SK-BR-3 cells (Fig. 4A). We investigated the expression of KLF4, which is important for the maintenance of breast cancer stem cell features and the promotion of the cell migration and invasion (Ref. 22:Oncogene. 2011 May 5;30(18):2161-72.). The mRNA expression of KLF4 did not change by nicotine stimulation (Fig. 4B). Wnt5a is important for cell migration (Ref 26: Oncotarget. 2018 Apr 20;9(30):20979-20992.). Nicotine stimulation decreased the mRNA expression of Wnt5a in SK-BR-3 cells (Fig. 4C). These results suggested that nicotine treatment had impacts on the cell migration, but not on the cell proliferation and stem cell-like property in SK-BR-3 cells. 2. nAChR subunits expression levels in these cell lines should be included and its correlation with PD-L1 and PD-L2 needs to be investigated. According to your suggestion, we investigated several nAChR subunit expressions by qPCR. We observed substantial expressions of several nAChR subunits in SK-BR-3 cells compared with other subtypes of cancer cells. We suggest that nicotine treatment may reduce the expressions of PD-L1 and PD-L2 through these nAChR subunits. 3. In addition to qRT-PCR data of mRNA expression, authors should validate the PD-L1 surface expression of PD-L1 and PD-L2 by flow cytometry in all cell lines before and after nicotine treatment. We performed flow cytometry analyses with several antibodies mainly in SK-BR-3 cells and found that the frequencies of PD-L1 expressing cells were 2.0 - 20%. However, the reproducibility of the cell frequencies was limited. Alternatively, we assessed mRNA expressions by qPCR and protein expressions by IHC and demonstrated the results in Fig2 and 3. 4. Figure 2D, please provide better quality of immunofluorescence images for PDL1 and also provide immunofluorescence images for PDL2 in figure 2E. 5. Overall, the quality of immunofluorescence images is not convincing. According to your suggestion, we provided better quality images in the revised Figures (Fig. 2D, Fig. 3D, and Fig. 5). 6. AKT phosphorylation with one cell line is not enough. Authors need to perform in multiple cell lines. It also lacks proper positive control with AKT inhibitor to look at PDL1 and PDL2 expression. Or consider knocking down of Akt expression by siRNA experiments. We assessed Akt phosphorylation in SK-BR-3, MCF8, HCC1937, and MDA-MB-231 cells (Figs. 5A-D). We observed the phosphorylation only in SK-BR-3 cells. We used an Akt inhibitor, MK-2206, to reduce the expression of PD-L1 and PD-L2 in SK-BR-3 cells (Figs. 5E, F). As expected, the inhibitor suppressed PD-L1 and PD-L2 expression of the cells. Wnt5a signaling was reported to enhance Akt phosphorylation. We found that nicotine treatment decreased Wnt5a mRNA expression (Fig. 4C). Wnt5a may associate with Akt phosphorylation in SK-BR-3 cells. Reviewer #2: Reviewer’s Comment: The present study by Murayama MA et al titled “Nicotine treatment regulates ………. Breast cancer cells” ineptly demonstrated a very preliminary rather a qualitative observation where an active natural tobacco ingredient, nicotine suppresses immune checkpoint molecules, PD-L1 and PD-L2 expression in HER2+ type breast cancer cells which in turn might correlate directly or indirectly with the dephosphorylation status of AKT molecules in these types of cells. Given that the basic concept of AKT phosphorylation depends on the status of the immune checkpoint molecule, PD-Ls expression that majorly studied in the field of gastric cancers, nevertheless, in-depth molecular analysis in the field of breast cancer, especially on this particular subtype (HER2+ in this case) might be of tremendous interest in the field and warrants more comprehensive and mechanistic studies. In a nutshell, the current study is a premature and trivial piece of work without much in-depth molecular analysis and hence does not attract this reviewer in favor of publication. The areas to improve in the study are listed below, Thank you for reviewing our manuscript. We revised our manuscript according to your comments and suggestion as follows. 1. How PD-L expressions directly regulate AKT phosphorylation that could be investigated in the breast cancer cells, especially in the context of HER2+ subtypes followed by the modulation upon nicotine administration. Authors should investigate the molecular insight of it. The presented data is just the tip of the iceberg! Wnt5a was reported to induce breast cancer cell migration via Akt phosphorylation (Ref. 26: Oncotarget. 2018; 9: 20979-92.). And the Akt pathway is suggested to be a therapeutic target for tumor immunity. We found that nicotine treatment decreased Wnt5a mRNA expression and Akt phosphorylation in SK-BR-3 cells. However, MCF7, HCC1937 and MDA-MB-231 cells did not express Akt regardless of the presence and absence of nicotine treatment. These results suggested that nicotine treatment inhibited PD-L1 and PD-L2 expression via inhibition of Akt phosphorylation in SK-BR-3 cells. 2. A single cell line data can always be deceptive and therefore, needs supplementation and/or recapitulation in few more cell lines under a particular subtype before drawing any major conclusion. According to your suggestion, we investigated Akt phosphorylation using other cell lines in Fig.5. We did not find Akt expressions or the phosphorylation regardless of the presence and absence of nicotine treatment in MCF7, HCC1937 and MDA-MB-231 cells in this study. We found clear differences in terms of the Akt pathway activation between SK-BR-3 cells and other types of cancer cells. 3. What is the nicotinic acetylcholine receptor(s) status under the different subtypes of breast cancer cells utilized in the study? A comprehensive RT-PCR panel would have been interesting to correlate the effect of nicotine in these subtypes under the study. In this review process, we investigated several nAChR subunit mRNA levels in the breast cancer cell lines (Fig. 6). We observed substantial expressions of several nAChR subunits in SK-BR-3 cells compared with other subtypes of cancer cells. We suggest that nicotine treatment may reduce the expressions of PD-L1 and PD-L2 through these nAChR subunits. 4. To establish the real correlation between PD-L1 and PD-L2 expression with phospho-AKT and nAChRs expression, authors could have done comprehensive ICC/IHC studies on commercially available BC tissue microarrays (TMAs) and could have expanded their analysis on the different subtypes in BC! We performed IHC of Akt and phopho-Akt and demonstrated the results in Fig. 5. We did not find Akt expressions or the phosphorylation regardless of the presence and absence of nicotine treatment in MCF7, HCC1937 and MDA-MB-231 cells. In this study, we would like to discuss the distinct features of the SK-BR-3 cell line in the immune check-point regulation, especially through the Akt pathway, compared with other types of breast cancer cell lines. 5. How nicotine differentially modulates the AKT phosphorylation via modulation of PD-L expression between HER2+ versus TNBC cells though they both express these same set of immune checkpoint molecules? This fundamental question also remains unanswered in the manuscript. We found that TNBC cells expressed strongly mRNA of PD-L1 and PD-L2. Nicotine treatment did not affect the expressions. The TNBC cells did not express Akt and phopho-Akt regardless of the presence and absence of nicotine treatment in this study. We found that SK-BR-3 cells expressed moderately mRNA of PD-L1 and PD-L2. Nicotine treatment reduced the expressions. The HER2 type cancer cells expressed phospho-Akt and nicotine treatment decreased the expression. An Akt inhibitor reduced PD-L1 and PD-L2 expressions in SK-BR-3 cells. Nicotine treatment decreased Wnt5a mRNA expression in SK-BR-3 cells. Reduced Wnt5a signaling may regulate Akt phosphorylation in the cells. These results suggested that nicotine treatment suppressed PD-L1 and PD-L2 expression via inhibition of Akt phosphorylation only in SK-BR-3 cells. Submitted filename: Point by point response to reviewers.docx Click here for additional data file. 18 Nov 2021 Nicotine treatment regulates PD-L1 and PD-L2 expression via inhibition of Akt pathway in HER2-type breast cancer cells PONE-D-21-09905R1 Dear Dr. Suzuki, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Srikumar Chellappan Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: No ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: All comments were addressed by authors satisfactorily. Revised manuscript has included all the key experiments suggested. Reviewer #2: The revised manuscript did not address all the questions raised by this reviewer, satisfactorily! 1. A single cell line data under a specific subtype of BC which also determines the mechanistic insights, can always be deceptive. This reviewer is skeptical about it. 2. Further, this reviewer is not convinced with the answers made by the authors against question numbers 2, 4, and 5. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Krithika Kodumudi Reviewer #2: No 18 Jan 2022 PONE-D-21-09905R1 Nicotine treatment regulates PD-L1 and PD-L2 expression via inhibition of Akt pathway in HER2-type breast cancer cells Dear Dr. Suzuki: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Srikumar Chellappan Academic Editor PLOS ONE
  34 in total

Review 1.  Smoking and survival of breast cancer patients: A meta-analysis of cohort studies.

Authors:  Wenhou Duan; Suyun Li; Xin Meng; Yanxin Sun; Chongqi Jia
Journal:  Breast       Date:  2017-03-31       Impact factor: 4.380

2.  Cigarette smoking during pregnancy regulates the expression of specific nicotinic acetylcholine receptor (nAChR) subunits in the human placenta.

Authors:  R Machaalani; E Ghazavi; T Hinton; K A Waters; A Hennessy
Journal:  Toxicol Appl Pharmacol       Date:  2014-03-04       Impact factor: 4.219

3.  Overexpression and activation of the alpha9-nicotinic receptor during tumorigenesis in human breast epithelial cells.

Authors:  Chia-Hwa Lee; Ching-Shui Huang; Ching-Shyang Chen; Shih-Hsin Tu; Ying-Jan Wang; Yu-Jia Chang; Ka-Wai Tam; Po-Li Wei; Tzu-Chun Cheng; Jan-Show Chu; Li-Ching Chen; Chih-Hsiung Wu; Yuan-Soon Ho
Journal:  J Natl Cancer Inst       Date:  2010-08-23       Impact factor: 13.506

4.  Expression of programmed death 1 ligands by murine T cells and APC.

Authors:  Tomohide Yamazaki; Hisaya Akiba; Hideyuki Iwai; Hironori Matsuda; Mami Aoki; Yuka Tanno; Tahiro Shin; Haruo Tsuchiya; Drew M Pardoll; Ko Okumura; Miyuki Azuma; Hideo Yagita
Journal:  J Immunol       Date:  2002-11-15       Impact factor: 5.422

5.  PI3K/Akt-dependent phosphorylation of GSK3β and activation of RhoA regulate Wnt5a-induced gastric cancer cell migration.

Authors:  Jiaojing Liu; Yujie Zhang; Rui Xu; Jun Du; Zhenzhen Hu; Ling Yang; Yongchang Chen; Yichao Zhu; Luo Gu
Journal:  Cell Signal       Date:  2012-10-31       Impact factor: 4.315

6.  A Tumor-Specific Super-Enhancer Drives Immune Evasion by Guiding Synchronous Expression of PD-L1 and PD-L2.

Authors:  Yuanpei Xu; Yingcheng Wu; Siliang Zhang; Panpan Ma; Xinxin Jin; Zhou Wang; Min Yao; Erhao Zhang; Baorui Tao; Yongwei Qin; Hao Chen; Aifen Liu; Miaomiao Chen; Mingbing Xiao; Cuihua Lu; Renfang Mao; Yihui Fan
Journal:  Cell Rep       Date:  2019-12-10       Impact factor: 9.423

Review 7.  PD-1 and PD-1 ligands: from discovery to clinical application.

Authors:  Taku Okazaki; Tasuku Honjo
Journal:  Int Immunol       Date:  2007-07-02       Impact factor: 4.823

8.  Programmed death-ligand 1 (PD-L1) expression in tumour cell and tumour infiltrating lymphocytes of HER2-positive breast cancer and its prognostic value.

Authors:  Ahrong Kim; So Jeong Lee; Young Keum Kim; Won Young Park; Do Youn Park; Jee Yeon Kim; Chang Hun Lee; Gyungyub Gong; Gi Yeong Huh; Kyung Un Choi
Journal:  Sci Rep       Date:  2017-09-15       Impact factor: 4.379

9.  Wnt5a promotes migration of human osteosarcoma cells by triggering a phosphatidylinositol-3 kinase/Akt signals.

Authors:  Ailiang Zhang; Shuanghua He; Xiaoliang Sun; Lianghua Ding; Xinnan Bao; Neng Wang
Journal:  Cancer Cell Int       Date:  2014-02-14       Impact factor: 5.722

10.  Wnt5a-induced cell migration is associated with the aggressiveness of estrogen receptor-positive breast cancer.

Authors:  Yoshie Kobayashi; Takayuki Kadoya; Ai Amioka; Hideaki Hanaki; Shinsuke Sasada; Norio Masumoto; Hideki Yamamoto; Koji Arihiro; Akira Kikuchi; Morihito Okada
Journal:  Oncotarget       Date:  2018-04-20
View more
  1 in total

1.  Expression, correlation, and prognostic significance of different nicotinic acetylcholine receptors, programed death ligand 1, and dopamine receptor D2 in lung adenocarcinoma.

Authors:  Krishnendu Pal; Tabish Hussain; Hao Xie; Shenduo Li; Ping Yang; Aaron Mansfield; Yanyan Lou; Shantanu Chowdhury; Debabrata Mukhopadhyay
Journal:  Front Oncol       Date:  2022-08-22       Impact factor: 5.738

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.