Literature DB >> 35084946

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

Saritha Raman Kavalappara1, Hayley Milner2, David G Riley3, Sudeep Bag4.   

Abstract

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milošević et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

Entities:  

Keywords:  Cabbage; Georgia USA; Polerovirus; Solemoviridae; turnip yellows virus

Year:  2022        PMID: 35084946     DOI: 10.1094/PDIS-10-21-2174-PDN

Source DB:  PubMed          Journal:  Plant Dis        ISSN: 0191-2917            Impact factor:   4.438


  1 in total

1.  Persistent, and Asymptomatic Viral Infections and Whitefly-Transmitted Viruses Impacting Cantaloupe and Watermelon in Georgia, USA.

Authors:  Ismaila Adeyemi Adeleke; Saritha Raman Kavalappara; Cecilia McGregor; Rajagopalbabu Srinivasan; Sudeep Bag
Journal:  Viruses       Date:  2022-06-15       Impact factor: 5.818

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.