| Literature DB >> 35076316 |
Wanxiang Li1, Jie Ma1, Xicai Sun2, Mi Liu1, Honggang Wang1.
Abstract
To investigate the antimicrobial resistance and molecular characterization of gene cassettes from class 1 integrons in Escherichia coli strains isolated from hospitalized patients. Bacterial identification was conducted using the Vitek-2 Compact system, and antimicrobial susceptibility analysis was performed using the Kirby-Bauer method. Class 1 integrons, integrase genes, the variable regions of integrons and promoters from the isolated E. coli were screened by polymerase chain reaction, and subjected to DNA sequencing. In total, 138 E. coli strains were collected from the hospitalized patients, most from urine specimens (41.30%, 57/138). Antimicrobial resistance to ampicillin (89.86%) was most prevalent, with 79.99% of strains being multidrug-resistant (MDR). The class 1 integron integrase intI1 gene was detected in 67.39% of the isolates (93/138). Three gene cassette arrays and 5 antimicrobial resistance gene cassettes were detected in 69 of the class 1 integron-positive strains. The most common gene cassette array was dfrA17-aadA5. Of the 93 intI1-positive strains, 5 different common promoters were detected. The most prevalent common promoter was PcH1, and most isolates contained the dfrA17-aadA5 gene cassette array. In summary, antimicrobial resistance and MDR were prevalent among E. coli isolates in our city Weifang in Shandong Provence China. Gene cassettes of the class 1 integron variable region mostly conferred resistance to traditional antimicrobials. Weak promoters in the variable regions were predominant in this study. Integrons pose a great threat to the treatment of MDR bacterial infections and further investigations are needed.Entities:
Keywords: Escherichia coli; antimicrobial resistance; antimicrobial-resistance mechanism; class 1 integrons
Mesh:
Substances:
Year: 2022 PMID: 35076316 PMCID: PMC9058876 DOI: 10.1089/mdr.2021.0172
Source DB: PubMed Journal: Microb Drug Resist ISSN: 1076-6294 Impact factor: 2.706
Polymerase Chain Reaction Primers Used in This Study
| Gene | Description | Sequence (5′–3′) | References |
|---|---|---|---|
|
| Screening primer for class 1 integrons | CCAAGCTCTCGGGTAACATC |
|
|
| Screening primer for class 1 integrons | GCCCAGCTTCTGTATGGAAC |
|
|
| Screening primer for the variable region of class 1 integrons | GGCATCCAAGCAGCAAG |
|
|
| Screening primer for the variable region of class 1 integrons | AAGCAGACTTGACCTGA |
|
Antimicrobial Resistance of Escherichia coli Isolates
| Antibiotic | Class 1 integrons positive strains ( | Class 1 integrons negative strains ( | Total ( | χ[ |
| |||
|---|---|---|---|---|---|---|---|---|
|
| Drug resistance rate (%) | number | Drug resistance rate (%) |
| Drug resistance rate (%) | |||
| AMK | 4 | 4.30 | 1 | 2.22 | 5 | 3.62 | 0.016 | 0.899 |
| AMP | 86 | 92.47 | 38 | 84.44 | 124 | 89.86 | 1.354 | 0.245 |
| ATM | 43 | 46.24 | 18 | 40.00 | 61 | 44.20 | 0.489 | 0.489 |
| CAZ | 33 | 35.48 | 10 | 22.22 | 43 | 31.16 | 2.486 | 0.115 |
| CIP | 74 | 79.57 | 28 | 62.22 | 102 | 73.91 | 4.733 | 0.03 |
| CRO | 62 | 66.67 | 25 | 55.56 | 87 | 63.04 | 1.607 | 0.205 |
| CSL | 7 | 7.53 | 7 | 15.56 | 14 | 10.14 | 1.354 | 0.245 |
| CTT | 7 | 7.53 | 4 | 8.89 | 11 | 7.97 | 0 | 1 |
| CTX | 62 | 66.67 | 26 | 57.78 | 88 | 63.77 | 1.037 | 0.407 |
| CXM | 61 | 65.59 | 29 | 64.44 | 90 | 65.22 | 0.795 | 0.373 |
| CZO | 67 | 72.04 | 29 | 64.44 | 96 | 69.57 | 2.808 | 0.094 |
| ETP | 3 | 3.23 | 1 | 2.22 | 4 | 2.90 | 0 | 1 |
| FEP | 24 | 25.81 | 8 | 17.78 | 32 | 23.19 | 1.098 | 0.295 |
| FOX | 18 | 19.35 | 7 | 15.56 | 25 | 18.12 | 0.295 | 0.587 |
| GEN | 40 | 43.01 | 10 | 22.22 | 50 | 36.23 | 5.672 | 0.017 |
| IPM | 3 | 3.23 | 1 | 2.22 | 4 | 2.90 | 0 | 1 |
| LVX | 66 | 70.97 | 25 | 56.56 | 91 | 65.94 | 3.207 | 0.073 |
| MEM | 3 | 3.23 | 1 | 2.22 | 4 | 2.90 | 0 | 1 |
| SXT | 71 | 76.34 | 6 | 13.33 | 76 | 55.07 | 48.81 | <0.001 |
| TOB | 21 | 22.58 | 3 | 6.67 | 24 | 17.39 | 5.346 | 0.021 |
| TZP | 3 | 3.23 | 1 | 2.22 | 4 | 2.90 | 0 | 1 |
| SAM | 62 | 66.67 | 23 | 51.11 | 85 | 61.59 | 3.102 | 0.078 |
| MDR | 82 | 88.17 | 27 | 60.00 | 109 | 79.99 | 14.501 | <0.001 |
AMK, amikacin; AMP, ampicillin; ATM, aztreonam; CAZ, ceftazidime; CIP, ciprofloxacin; CRO, ceftriaxone; CSL, cefoperazone/sulbactam; CTT, cefotetan; CTX, cefotaxime; CXM, cefuroxime; CZO, cefazolin; ETP, ertapenem; FEP, cefepime; FOX, cefoxitin; GEN, gentamicin; IPM, imipenem; LEV, levofloxacin; MDR, multidrug resistant; MEM, meropenem; SAM, ampicillin/sulbactam; SXT, trimethoprim/sulfamethoxazole; TOB, tobramycin; TZP, piperacillin/tazobactam.
FIG. 1.Genetic environment of the variable regions of the class 1 integrons.
Promoters of the Class 1 Integron Variable Region
| Variable region gene box | GenBank code | Variable region promoter type | ||||
|---|---|---|---|---|---|---|
| PcH1 | PcWTGN-10 | PcH1-P2 | PcS | PcW | ||
|
| MH847634 | 55 | ||||
|
| MH523448 | 9 | ||||
|
| AB434537 | 5 | ||||
|
| 9 | 4 | 2 | 6 | 3 | |
|
| 64 | 13 | 7 | 6 | 3 | |