Literature DB >> 35071469

Vitamin D deficiency inhibits microRNA-196b-5p which regulates ovarian granulosa cell hormone synthesis, proliferation, and apoptosis by targeting RDX and LRRC17.

Ting Wan1, Huiting Sun2, Zhilei Mao1, Lina Zhang1, Xia Chen2, Yichao Shi2, Yuwei Shang2.   

Abstract

BACKGROUND: In polycystic ovary syndrome (PCOS), ovarian physiology is tightly linked to the metabolic disturbances observed in this disease. Vitamin D (VD) plays an important role in the regulation of ovulatory dysfunction and can influence genes involved in steroidogenesis in granulosa cells (GCs). However, its role in the proliferation and apoptosis of ovarian GCs is unclear. The present study aimed to investigate the role of microRNA-196-5p (miR-196b-5p) in the hormone synthesis, proliferation, and apoptosis of ovarian GCs.
METHODS: The abnormal expression of miRNAs in ovarian tissues of VD-deficient mice was analyzed using transcriptome sequencing. The direct target of miR-196b-5p was predict and confirmed by bioinformatics analysis and the dual-luciferase reporter assay. Reverse transcription-quantitative PCR (RT-qPCR) was used to detect the levels of miR-196b-5p, cell proliferation was detected via the CCK8 assay, and cell apoptosis and reactive oxygen species (ROS) were measured via flow cytometry. The levels of radixin (RDX), leucine rich repeat containing 17 (LRRC17), aromatase (CYP19A1), and glucose transporter 4 (GLUT4) were detected by performing RT-qPCR or western blot.
RESULTS: We found that miR-196b-5p was significantly downregulated among the 672 miRNAs that were differentially expressed (DE) in VD-deficient mice. In addition, the results demonstrated that downregulated expression of miR-196b-5p significantly increased the level of RDX and LRRC17, and reduced expression of miR-196b-5p significantly promoted ovarian GC apoptosis and inhibited cell proliferation. Downregulated expression of miR-196b-5p promoted cellular ROS production and inhibited sex hormone production and glucose uptake. Transfection with miR-196b-5p mimics significantly increased the expression of CYP19A1 and GLUT4 and decreased the RDX and LRRC17 levels in ovarian GCs.
CONCLUSIONS: This study shows that miR-196b-5p can regulate the oxidative stress (OS), glucose uptake, and steroid production pathway of GCs, thus promoting follicular development and maturation. This is a step towards a feasible treatment for PCOS. 2021 Annals of Translational Medicine. All rights reserved.

Entities:  

Keywords:  MicroRNA-196-5p (miR-196b-5p); ovarian granulosa cells (ovarian GCs); radixin and leucine rich repeat containing 17 (RDX and LRRC17); vitamin D (VD)

Year:  2021        PMID: 35071469      PMCID: PMC8756257          DOI: 10.21037/atm-21-6081

Source DB:  PubMed          Journal:  Ann Transl Med        ISSN: 2305-5839


Introduction

Polycystic ovary syndrome (PCOS) is the most common endocrine disease in premenopausal women, with a prevalence rate of about 6–7%. PCOS is characterized by clinical or biochemical hyperandrogenemia, polycystic ovary morphology, chronic anovulation, or less menstruation (1,2). PCOS is considered hereditary and is caused by a variety of factors, such as increased luteinizing hormone (LH), lack of androgen balance, inflammation, insulin resistance (IR), and oxidative stress (OS) (3). Vitamin D deficiency (VDD) is common in women with PCOS. It is estimated that serum 25-hydroxyvitamin D [25(OH)D] is less than 20 ng/mL in 65–85% of patients with PCOS (4). Notably, VDD may aggravate the symptoms of PCOS because lower concentrations of 25(OH)D are associated with irregular ovulation and menstruation, hyperandrogenemia, IR, hirsutism, low success rate of pregnancy, obesity, and increased risk factors for cardiovascular disease (5,6). There are several methods for the fertility treatment of patients with PCOS. Assisted reproductive technology (ART) is the most commonly used method. In this method, the ovaries are stimulated by exogenous gonadotropin to produce multiple follicles. A large amount of evidence suggests that vitamin D (VD) may have beneficial effects on metabolic/hormonal parameters in PCOS and endometriosis, and seems to be related to the results of in vitro fertilization (IVF) (7-9). In PCOS, ovarian physiology is tightly linked to the metabolic disturbances observed in this disorder. Thus, the beneficial effects of VD on metabolic alterations may translate into better and healthier ovarian physiology. Radixin (RDX) is a member of the Ezrin-Radixin-moesin (ERM) protein family. It plays the role of membrane cytoskeleton crosslinker in actin rich cell surface structures. Therefore, it is considered to be essential for the organization, cell movement, adhesion, and proliferation of the cortical cytoskeleton. They are also involved in regulating the transporter function of various organs. For example, RDX knockout mice showed binding hyperbilirubinemia and liver damage caused by loss of the bilirubin-secreting transporter multidrug resistance-associated protein 2 (MRP2) in the bile duct membrane (10). leucine rich repeat containing 17 (LRRC17) is a secretory protein containing 5 leucine-rich repeat domains. It was first characterized in bone metabolism as an inhibitor of receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast differentiation. Besides bone metabolism, Malcuit et al. found that LRRC17 was particularly high expressed in oocytes and granulosa cells (GCs) (11). Although human protein maps showed that LRRC17 is highly expressed in female tissues, but its role in GCs remains unclear. MicroRNAs (miRNAs) are a class of small non-coding RNAs. It is estimated that they regulate the mRNA translation of more than 70% of protein-coding genes and are widely involved in normal and disease states (12). In addition, miRNAs are involved in the regulation of GCs proliferation, apoptosis, and steroid production, and their imbalance may play an important role in the pathogenesis of PCOS (13,14). Some studies have determined that VD3 affects the expression of genes involved in steroid production in normal ovarian GCs (15-17). However, there are no studies showing the effects of miRNAs on GC proliferation, apoptosis, OS, glucose uptake, or the steroid production pathway under VDD conditions. In this study, for the first time, we analyzed the transcriptome of the ovaries in a VDD mouse model and evaluated the effect of miR-196b-5p on the hormone synthesis, proliferation, and apoptosis of GCs by targeting RDX and LRRC17. We present the following article in accordance with the ARRIVE reporting checklist (available at https://dx.doi.org/10.21037/atm-21-6081).

Methods

Animal procedure

Female C57BL/6J mice (age, 3 weeks; weight, 12–18 g) were obtained from Carvens, Inc. (Changzhou, China) [animal certificate No. SCXK(SU)2016-0010]. Mice were housed in a specific pathogen-free environment under standard housing conditions with controlled temperature (22±1 °C) and humidity (52%±5%). The mice were exposed to a 12 h light/dark cycle and were able to access a specified amount of food and water at will. All animal experiments in this study were carried out in strict accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals approved by the State Council of the People’s Republic of China (11-14-1988). The animal experimental design and protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of Nanjing Medical University (approval number: 2020-62). The experimental group and procedures of mice were described previously (18). In the present study, a total of 30 mice were used, of which 5 were the control group and 5 were VD deficient group, and repeat for 3 times independently to eliminate the difference between experiments at different batches. Briefly, after feeding for 8 weeks with a VD-deficient (25 IU VD3/kg; cat. no. D119289, Dyets) or control diet (5,000 IU VD3/kg; cat. no. D119290, Dyets), mice were sacrificed by cervical dislocation. Before analysis, the serum samples were centrifuged at 6,000 rpm for 5 minutes and stored at −20 °C. Serum 25(OH)D3 levels were measured using an enzyme-linked immunosorbent assay (ELISA) kit (cat. no. AC-57SF1; Immunodiagnostic Systems, Ltd.). Determination of serum levels of follicle stimulating hormone (FSH), LH, estradiol, and testosterone was performed using commercial ELISA kits (Tongwei Bio, Shanghai, China). Ovarian tissues were collected in 4% formalin for hematoxylin and eosin (H&E) staining or RNAlater (Invitrogen, USA) for RNA sequencing by Genewiz, Inc. (Suzhou, China), as described previously (19).

Cell culture

KNG cells were obtained from Nanjing Medical University and cultured in Dulbecco’s Modified Eagle’s Medium/F12 (DMEM/F12; Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) in an incubator with 5% CO2 at 37 °C. At the time of passage, the cells were first digested with 0.25% trypsin (containing EDTA). Subsequently, the cell suspension was evenly distributed into a cell culture flask, with the whole medium supplemented to 6 mL per flask. Cell culture was then continued for subsequent experiments.

Cell counting kit-8 (CCK-8) assay

KGN cells were cultured at a density of 0.3-1×105 cells/well in 24-well culture plates and transfected with 50 nM miR-196b-5p mimics/ mimics control and miR-196b-5p inhibitor/ inhibitor control using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to instruction of the manufacturer. After transfection, cells in log phase were trypsinized and resuspended in complete medium, and 100 μL of cell suspension was added to the culture plate at a density of 5×103 cells/per well. After culture for 0, 24, 48, and 72 h, 100 μL of DMEM solution containing 10% CCK-8 reagent (Solarbio, Beijing, China) was added to each well, followed by incubation in an incubator for 2 h in the dark. Lastly, absorbance at 450 nm was detected using a preheated microplate reader.

Flow cytometry

Cells were first cultured in 0.5% Roswell Park Memorial Institute-1640 (RPMI-1640) medium (HyClone, South Logan, UT, USA) for 48 h. Then, the medium was replaced with 10% RPMI-1640 medium for another 48 h. Subsequently, the cells were collected in 3 mL tubes with approximately 2×106 cells per tube. After washing twice with phosphate-buffered saline (PBS) solution, the cells were fixed with 70% alcohol and placed in a refrigerator at −20 °C for 24–48 h. After routine PI staining, DNA content was measured by AttuneNxT flow cytometry (Thermo, USA). Finally, the percentage of each stage of the cell cycle was analyzed by CytExpert software.

Reverse transcription‑quantitative PCR (RT-qPCR)

Total RNA was extracted from KGN cells by Trizol reagent (Invitrogen, Carlsbad, CA, USA). Using 100 ng of total RNA as a template, cDNA was obtained through the TaqMan microRNA reverse transcription kit (Applied Biosystems, Carlsbad, CA, USA). According to the manufacturer’s instructions, the qPCR reaction was performed using the ABI7900 real-time PCR system (ABI, Carlsbad, CA, USA). PCR primers () were designed and synthetized by Sangon Biotech (Shanghai, China). Actin served as the internal reference (U6 served as the internal reference for endonuclear RNA and miR-196b-5p). The threshold was selected at the lowest point of each logarithmic magnification curve to obtain the threshold cycle (Ct) value of each reaction tube, and the data were analyzed by the 2−ΔΔCt method.
Table 1

Primers used for real-time PCR analysis

GeneSequences (5'-3')
U6 RGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATA
U6 FAGAGAAGATTAGCATGGCCCCTG
MiR-196b-5p RCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCAACAA
MiR-196b-5p FACACTCCAGCTGGGTAGGTAGTTTCCTGTT
Actin FTGGACTTCGAGCAAGAGATG
Actin RGAAGGAAGGCTGGAAGAGTG
RDX FCACCTCCACCACCACCAGTC
RDX RTTCAGCATTATTCTCATCGTGTTCATC
LRRC17 FTAAACAAACTCACCACCCTCTTACTG
LRRC17 RTGGACTTTCACACTTGGCGTAG
CYP19A1 FGACACCTCTAACACGCTCTTCTTG
CYP19A1 RAGTCCATACATTCTTCCAGTTTCTCTTC
GLUT4 FGTATCATCTCTCAGTGGCTTGGAAG
GLUT4 RTAGGAGGCAGCAGCGTTGG

R, reverse; F, forward; miR, microRNA; RDX, radixin; LRRC17, leucine rich repeat containing 17; CYP19A1, aromatase; GLUT4, glucose transporter 4.

R, reverse; F, forward; miR, microRNA; RDX, radixin; LRRC17, leucine rich repeat containing 17; CYP19A1, aromatase; GLUT4, glucose transporter 4.

Western blot assay

First, 200 μL protein lysate (including 2 μL protease inhibitor and 2 μL phosphatase inhibitor) was added to each well. The mixture was stirred well on ice until the cells were completely lysed. A 5× loading buffer containing β-mercaptoethanol was added and mixed, the mixture was boiled for 15 minutes, then stored at −20 °C for use. The extracted protein samples were separated by 10% polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA, USA). After blocking with 5% bovine serum albumin (BSA) for 2 h, the membrane was incubated with a primary antibody overnight. Antibodies for LRRC17, RDX, glucose transporter 4 (GLUT4), aromatase (CYP19A), and GAPDH were obtained from Abmart Inc. (Shanghai, China). The next day, the membranes were incubated with the corresponding secondary antibody for 1 h. Finally, immunoreactive bands were visualized by the enhanced chemiluminescence (ECL) method.

Luciferase reporter assay

The binding sites of miR-196b-5p were predicted by a bioinformatics website (http://www.targetscan.org). The 293T cells were cultured at a density of (0.3–1)×105 cells/well in 24-well culture plates and transfected with 2μg of dual-luciferase reporter construct pmirGLO-LRRC17/RDX-wt/mut, and co-transfected with 50 nM miR-196b-5p mimics/mimics control using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. At 4 h post-transfection, the transfection medium was removed and replenished with medium containing 10% FBS (Gibco, Rockville, MD, USA). At 48 h post-transfection, luciferase activity was measured using the Dual-Luciferase Reporter Gene Assay Kit (Beyotime, Shanghai, China).

Statistical analysis

All experiments were repeated at least 3 times. The data were expressed as mean ± standard deviation (SD) and analyzed by GraphPad Prism software using the t-test or one-way analysis of variance (ANOVA). P<0.05 was considered to be statistically significant.

Results

Clinical parameters, endocrine parameters, and transcriptome sequencing analysis of VD-deficient mice

To illustrate the effect of VDD, mouse serum 1,25-(OH)2D3 levels were measured by the ELISA method and mouse ovaries were sectioned and stained with H&E. The ovarian sections of the control group showed that the peripheral cortex had a large number of follicles at different developmental stages. The structure of the ovarian medulla was normal (). In contrast, the ovaries obtained from VD-deficient mice showed a distorted shape (). VD-deficient mice (n=5) had 1,25-(OH)2D3 levels of 19.56±1.51 ng/mL compared with control mice (n=5) that had 1,25-(OH)2D3 levels of 62.34±2.70 ng/mL (P<0.01; ). For the measurement of ovarian function in the pathology of cyst formation, the levels of serum estradiol, progesterone, and testosterone were evaluated by ELISA. The results showed that the testosterone level of VD-deficient mice was significantly higher than that of the control group, while the estradiol level was significantly lower than that of the control group (P<0.05). However, there was no significant difference in terms of LH and FSH levels between the two groups (P>0.05; ).
Figure 1

Morphological appearance, endocrine parameters, and transcriptome sequencing analysis of control and of VD-deficient mouse ovaries. (A) Control ovaries revealed several follicles (arrow) in various developmental stages stained with H&E. (B) VD-deficient mouse ovaries showed atretic folli and follicular cysts (arrows) on the ovary surface stained with H&E. Scale bar: 50 µm. (C) The serum 25(OH)D3 and hormone levels in control and VD-deficient mice (*P<0.05, **P<0.01). (D) MiRNA clustering analysis of VD-deficient mice using a heat map to show the significantly downregulated genes. (E) MiR-196b-5p expression levels were significantly upregulated in the VD-deficient group compared with the control group (***P<0.001). (F) GO functional enrichment analysis. VD, vitamin D; H&E, hematoxylin and eosin; 25(OH)D3, 25-hydroxyvitamin D3; miRNA, microRNA; miR, microRNA; GO, Gene Ontology; LH, luteinizing hormone; FSH, follicle stimulating hormone; T, testosterone; E2, estradiol.

Morphological appearance, endocrine parameters, and transcriptome sequencing analysis of control and of VD-deficient mouse ovaries. (A) Control ovaries revealed several follicles (arrow) in various developmental stages stained with H&E. (B) VD-deficient mouse ovaries showed atretic folli and follicular cysts (arrows) on the ovary surface stained with H&E. Scale bar: 50 µm. (C) The serum 25(OH)D3 and hormone levels in control and VD-deficient mice (*P<0.05, **P<0.01). (D) MiRNA clustering analysis of VD-deficient mice using a heat map to show the significantly downregulated genes. (E) MiR-196b-5p expression levels were significantly upregulated in the VD-deficient group compared with the control group (***P<0.001). (F) GO functional enrichment analysis. VD, vitamin D; H&E, hematoxylin and eosin; 25(OH)D3, 25-hydroxyvitamin D3; miRNA, microRNA; miR, microRNA; GO, Gene Ontology; LH, luteinizing hormone; FSH, follicle stimulating hormone; T, testosterone; E2, estradiol. In order to explore the mechanism of 1,25-(OH)2D3 in improving ovarian function, RNA was extracted from the ovaries and sequenced, and the gene expression levels of the VD-deficient group and control group were analyzed. RNA-seq showed that the expression of 6,543 genes changed in VD-deficient ovaries. A total of 672 differentially expressed (DE) miRNAs were identified, while transcripts per million (TPM) values of >4 in both libraries were retained for further analysis (, available online: https://cdn.amegroups.cn/static/public/atm-21-6081-01.xlsx). Among them, 33 miRNAs were reported to have log2-fold change and false discovery rate ≤0.05 in upregulation or downregulation, regardless of miRNA abundance. Furthermore, 17 miRNAs were significantly upregulated while 16 miRNAs were downregulated in the ovarian tissue of VD-mice compared with controls (, available online: https://cdn.amegroups.cn/static/public/atm-21-6081-02.xlsx). RNA-seq demonstrated that miR-196b-5p was significantly downregulated in the ovaries of VD-deficient mouse models. MiR-196b-5p expression in VD-deficient mouse ovarian tissue was verified via qPCR, which showed significantly lower expression compared with the control group (P<0.001; ). These data showed that the transcriptional spectrum changed significantly in the absence of 1,25-(OH)2D3 to change ovarian function.
Table 2

Top 10 miRNAs and their target genes with significant differences in the ovaries of VD-deficient and control mice

MiRNATarget genes
DownregulationUpregulation
   Novel miRNA-84 Arfgef1, Adgrb3, Khdrbsz, Aff3, Ankrd44, Vwc2l, Fn1, Tns1, Wdfy1, Dock10
   Novel miRNA-7 Slc13a3, Rbak, Ascc1, Timeless, Inpp46
   mmu-miR-200c-5p Nxph1, Cox10, Ifrd1
   mmu-miR-196b-5p Nsmf, Ctdc1, Katna1, Map3k5, Plazg6, Rpgr
   Novel miRNA-142 Zc3hc1, Trip4, Arhgap12
UpregulationDownregulation
   mmu-miR-378d Sntg1, Sgk3, Ppp1r42, Cspp1, A830018L16Rik, Slco5a1, Ncoa2, Eya1, Terf1, Stua2
   mmu-miR-669o-5p Sntg1, Sgk3, Adgr63, Fam168b, Ankrd44, Dpp10, Nckap5, Tem163, Zranb3, Brinp3
   Novel miRNA-118 Cspp1, Adgrb3, Slc39a10, Abi2, Vwc2l, Smarcal1, Pid1, Nckap5, Nav1, Colgalt2
   Novel miRNA-54 Ntm, Afhgap42
   mmu-miR-466i-5p Arhgef4, Cdk15, Zfp142, Clgt1a9, Lrrfip1, Clasp1, Nckap5, Zranb3, Kgl1, Astn1

MiRNA, microRNA; VD, vitamin D.

MiRNA, microRNA; VD, vitamin D. In order to explore the effects of 1,25-(OH)2D3 on the intracellular functions and signaling pathways of ovarian cells, we used Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis to determine the biological functions and signal pathways of DE mRNAs enrichment. DE mRNAs were significantly enriched in biological processes (BPs), including various developmental processes, migration processes, and small molecular catabolism processes (). Among the top 20 items of significant enrichment, 11 items belonged to the BP category [the first 10 items were biological regulation, cellular process, single cell BP, metabolic process, localization, development process, cellular component (CC) tissue or biogenesis, stimulus response, multicellular BP, immune system process], 7 items belonged to the CC category (cell part, organelle, membrane part, membrane part, extracellular region part, macromolecular complex), while two items belonged to the molecular function (MF) category (binding, catalytic activity). Thus, most of the differentially expressed genes (DEGs) were related to cell metabolism and development in BPs. DE mRNAs also exhibited significant involvement in various pathways, primarily including the PI3K-Akt signal pathway, MAPK signal pathway, HTLV-I infection, RAS signal pathway, endocytosis, proteoglycan in cancer, regulation of actin cytoskeleton, insulin signal pathway, tight junction, and GnRH signal pathway (, available online: https://cdn.amegroups.cn/static/public/atm-21-6081-03.xlsx).
Table 3

Top 10 KEGG metabolic pathways of miRNA target genes

Pathway IDPathwayDEGs with pathway annotation (n=9,509), n (%)All genes with pathway annotation (n=17,443), n (%)P value
ko04912GnRH signaling pathway192 (2.02)269 (1.54)3.85E-09
ko04020Calcium signaling pathway349 (3.67)497 (2.85)1.33E-13
ko04014Ras signaling pathway462 (4.86)689 (3.95)3.22E-12
ko04310Wnt signaling pathway258 (2.71)400 (2.29)1.70E-05
ko04910Insulin signaling pathway288 (3.03)448 (2.57)8.81E-06
ko04010MAPK signaling pathway563 (5.92)785 (4.50)1.67E-24
ko04911Insulin secretion207 (2.18)285 (1.63)7.88E-11
ko04114Oocyte meiosis221 (2.32)306 (1.75)4.74E-11
ko04210Apoptosis156 (1.64)254 (1.46)1.07E-02
ko04151PI3K-Akt signaling pathway610 (6.41)960 (5.50)2.36E-09

KEGG, Kyoto Encyclopedia of Genes and Genomes; DEGs, differentially expressed genes.

KEGG, Kyoto Encyclopedia of Genes and Genomes; DEGs, differentially expressed genes.

MiR-196b-5p promoted cell proliferation and suppressed cell apoptosis

In order to verify the hypothesis that miR-196b-5p may be involved in GC proliferation, KGN cells were transiently transfected with miR-196b-5p mimics, miR-196b-5p inhibitor, or controls. As illustrated in , the CCK-8 assays revealed that upregulation of miR-196b-5p resulted in a promotion of KGN cell proliferation. Flow cytometry assays revealed that low expression of miR-196b-5p could significantly inhibit KGN cell apoptosis ().
Figure 2

Overexpression of miR-196b-5p promoted KGN cell proliferation and inhibited KGN cell apoptosis. (A) The proliferation ability of KGN cells transfected with miR-196b mimics or miR-196b inhibitor was determined by CCK-8 assays (n=3). (B,C) Flow cytometry was used to determine cell apoptosis, and overexpression of miR-196b-5p could significantly inhibit apoptosis (n=3). The results were representative of 3 independent experiments. Statistical analysis was performed by Student’s t-test. Data were shown as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001 vs. control group. MiR, microRNA; CCK-8, cell counting kit-8; SD, standard deviation; NC, negative control.

Overexpression of miR-196b-5p promoted KGN cell proliferation and inhibited KGN cell apoptosis. (A) The proliferation ability of KGN cells transfected with miR-196b mimics or miR-196b inhibitor was determined by CCK-8 assays (n=3). (B,C) Flow cytometry was used to determine cell apoptosis, and overexpression of miR-196b-5p could significantly inhibit apoptosis (n=3). The results were representative of 3 independent experiments. Statistical analysis was performed by Student’s t-test. Data were shown as the mean ± SD. *P<0.05, **P<0.01, ***P<0.001 vs. control group. MiR, microRNA; CCK-8, cell counting kit-8; SD, standard deviation; NC, negative control.

MiR-196b-5p reduced OS and promoted glucose uptake and steroidogenesis

Some studies have shown that apoptosis of various cell types, including GCs, may be related to increased levels of reactive oxygen species (ROS) (20). We determined the effect of miR-196b-5p on the total ROS content. As shown in , miR-196b-5p mimics significantly decreased the amount of ROS in KGN cells compared to NC mimics (P<0.001). In contrast, miR-196b-5p inhibitor treatment increased the ROS in KGN cells compared to negative control (NC) inhibitor treatment (P<0.05). The energy requirement of normal folliculogenesis mainly depends on GC glucose uptake in the surrounding tissue through the GLUT on the cell membrane and the production of pyruvate and lactic acid through glycolysis as the main energy source. Next, we studied the glucose uptake capacity of miR-196b-5p-overexpressed KGN cells. The glucose content in the supernatants of the cells was examined after the cells were cultured for 24, 48, and 72 h. There was no significant difference in glucose content among all groups at 24–48 h. At 72 h, glucose uptake became stronger in the miR-196b-5p mimics group (P<0.01) and weaker in the miR-196b-5p inhibitor group (P<0.05; ).
Figure 3

Effect of miR-196b-5p overexpression on ROS production, glucose uptake, and sex steroid production in KGN cells. (A,B) Overexpression of miR-196b-5p inhibits ROS production and interferes with miR-196b-5p to promote ROS production. (C) Overexpression of miR-196b-5p promotes KGN cell glucose uptake. (D,E) Overexpression of miR-196b-5p promotes estradiol and progesterone production. *P<0.05, **P<0.01, ***P<0.001 vs. control group. MiR, microRNA; ROS, reactive oxygen species; NC, negative control.

Effect of miR-196b-5p overexpression on ROS production, glucose uptake, and sex steroid production in KGN cells. (A,B) Overexpression of miR-196b-5p inhibits ROS production and interferes with miR-196b-5p to promote ROS production. (C) Overexpression of miR-196b-5p promotes KGN cell glucose uptake. (D,E) Overexpression of miR-196b-5p promotes estradiol and progesterone production. *P<0.05, **P<0.01, ***P<0.001 vs. control group. MiR, microRNA; ROS, reactive oxygen species; NC, negative control. Next, we investigated the effect of miR-196b-5p overexpression on the production of progesterone and estradiol by KGN cells. Cells were incubated with certain concentrations of miR-196b-5p mimics or inhibitor for 24, 48, and 72 h. Secretions of both estradiol () and progesterone () were increased by miR-196b-5p mimics in KGN cells at 48–72 h (P<0.01). There were no significant differences in estradiol and progesterone among the miR-196b-5p inhibitor and NC inhibitor groups at 24–72 h. To strengthen these data, we investigated the effect of miR-196b-5p on the mRNA expression of LRRC17, RDX, GLUT4 and CYP19A gene. RT-PCR results identified that the miR-196b-5p expression levels were significantly upregulated in the miR-196b-5p mimics group compared with the NC group (P<0.01). Moreover, miR-196b-5p expression was significantly downregulated in the miR-196b-5p inhibitor group compared with the inhibitor NC group (P<0.05). These results indicated the successful overexpression or knockdown of miR-196b-5p in KGN cells (). As shown in , we found similar effects of miR-196b-5p mimics on mRNA LRRC17 and RDX expression in KGN cells. GLUT4 mRNA expression was significantly increased in the miR-196b-5p mimic group and significantly increased in the inhibitor group (). The results of western blotting are consistent with those of RT-PCR. The expression levels of LRRC17 and RDX were decreased after miR-196b-5p overexpression, while the expression levels of GLUT4 and CYP19A were increased after miR-196b-5p overexpression (). These results further verified that miR-196b-5p directly regulated LRRC17 or RDX and promoted glucose uptake and sex steroid production by GLUT4 and CYP19A in KGN cells.
Figure 4

Effect of miR-196b-5p overexpression on RDX/LRRC17 and GLUT4/CYP19A expression in KGN cells. (A) RT-PCR results showed that miR-196b-5p was significantly upregulated in the mimic group and significantly downregulated in the inhibitor group. (B-E) LRRC17 and RDX mRNA expression levels were decreased significantly in the mimic group and increased significantly in the inhibitor group, while GLUT4 and CYP19A mRNA expression levels increased significantly in the mimic group and decreased significantly in the inhibitor group. (F) Western blot analyses of LRRC17, RDX, GLUT4, and CYP19A expression levels in KGN cells transfected with miR-196b-5p mimics or inhibitors. Expression levels of LRRC17 and RDX were decreased after miR-196b-5p overexpression, and the expression levels of GLUT4 and CYP19A were increased after miR-196b-5p overexpression. *P<0.05, **P<0.01, ***P<0.001 vs. respective NC. MiR, microRNA; RDX, radixin; LRRC17, leucine rich repeat containing; GLUT4, glucose transporter 4; CYP19A, aromatase; NC, negative control.

Effect of miR-196b-5p overexpression on RDX/LRRC17 and GLUT4/CYP19A expression in KGN cells. (A) RT-PCR results showed that miR-196b-5p was significantly upregulated in the mimic group and significantly downregulated in the inhibitor group. (B-E) LRRC17 and RDX mRNA expression levels were decreased significantly in the mimic group and increased significantly in the inhibitor group, while GLUT4 and CYP19A mRNA expression levels increased significantly in the mimic group and decreased significantly in the inhibitor group. (F) Western blot analyses of LRRC17, RDX, GLUT4, and CYP19A expression levels in KGN cells transfected with miR-196b-5p mimics or inhibitors. Expression levels of LRRC17 and RDX were decreased after miR-196b-5p overexpression, and the expression levels of GLUT4 and CYP19A were increased after miR-196b-5p overexpression. *P<0.05, **P<0.01, ***P<0.001 vs. respective NC. MiR, microRNA; RDX, radixin; LRRC17, leucine rich repeat containing; GLUT4, glucose transporter 4; CYP19A, aromatase; NC, negative control.

Prediction of target genes and luciferase reporter assays

In order to study the mechanism of miR-196b-5p in inhibiting the proliferation of GCs, we used TargetScan to find its potential target genes. RDX and LRRC17, which are closely related to cell proliferation, have sparked our interest. To verify the prediction of TargetScan, we constructed a luciferase reporter vector containing predicted RDX and LRRC17 3'UTR binding sites (). The results showed that overexpression of miR-196b-5p resulted in a significant decrease in luciferase activity after co-transfection with RDX or LRRC17 WT 3'UTR, while there was no change in luciferase activity after co-transfection with RDX or LRRC17 MUT 3'UTR (P<0.001, P>0.05; ).
Figure 5

RDX and LRRC17 were target genes of miR-196b-5p. (A) Prediction of binding sites between RDX/LRRC17 and miR-196b-5p by TargetScan. (B) Dual-luciferase reporter assay results further verified the existence of a targeted relationship between miR-196b-5p and RDX/LRRC17. ***P<0.001 vs. NC group. RDX, radixin; LRRC17, leucine rich repeat containing; miR, microRNA; NC, negative control; ns, non significant.

RDX and LRRC17 were target genes of miR-196b-5p. (A) Prediction of binding sites between RDX/LRRC17 and miR-196b-5p by TargetScan. (B) Dual-luciferase reporter assay results further verified the existence of a targeted relationship between miR-196b-5p and RDX/LRRC17. ***P<0.001 vs. NC group. RDX, radixin; LRRC17, leucine rich repeat containing; miR, microRNA; NC, negative control; ns, non significant.

Discussion

In this study, a mouse model of VDD was established as previously described (19), and transcriptome sequencing analysis revealed that miR-196b-5p was abnormally downregulated in the ovarian tissues of VD‑deficient mice, which was further confirmed using RT-qPCR of the extracted ovarian tissues from the mice. Functional experiments further demonstrated that overexpression of miR-196b-5p mimics facilitated cell proliferation and inhibited apoptosis in KGN cells. It is reported that increasing the level of miR-196b-5p can be achieved by downregulating type I collagen α 1 chain (COL1A1), which significantly inhibited proliferation and migration of MDA-MB-231 and MDA-MB-468 cells in breast cancer (21). In addition, miR-196b-5p is associated with some pathological changes, such as lung adenocarcinoma (22), hepatocellular carcinoma (23), keloid (24), and colorectal cancer (25), among others. It is also reported that mouse miR-196b can specifically target the 5' noncoding region of insulin 2 splicing isoforms. The RNA binding protein HUD, which inhibits insulin translation, was replaced by miR-196b, indicating that miR-196b upregulates insulin 2 translation (26). They found that increased miR-196b expression induced by glucose may be another mechanism by which glucose stimulates insulin synthesis. The role of miR-196b in ovarian GCs is worthy of further study. Our study showed that overexpression of miR-196b-5p resulted in a promotion of KGN cell proliferation and low expression of miR-196b-5p could significantly inhibit KGN cell apoptosis. MiR-196b-5p is a positive factor related to the proliferation of ovarian GCs. In addition, RDX and LRRC17 were direct targets of miR‑196b-5p in KGN cells. Overexpression of miR-196b-5p led to significantly decreased luciferase activity by co-transfection with RDX or LRRC17 WT 3'UTR, while there was no change with RDX or LRRC17 MUT 3'UTR. It has been reported that RDX is a direct target of miR‑196b-5p in human gastric cancer (27). Studies (28) have shown that miR-200b regulates the proliferation and invasion of breast cancer cells by targeting RAD expression. The overexpression of miR-200b inhibits the expression of RAD and reduces the proliferation and invasion of breast cancer cells. Chen et al. (29) demonstrated that silencing the expression of RAD in pancreatic cancer cells significantly inhibited cell proliferation and tumorigenicity in vivo. RDX seems to be a positive factor in cell proliferation, but this is not reflected in our experimental results. Decreased LRRC17 has been shown to be a serum risk marker for osteoporotic fracture in the spines of postmenopausal women (30). Song et al. (31) demonstrated that the modulation of the LRRC17 gene may delay or even restore the balance of osteogenic and adipogenic differentiation in autologous bone marrow mesenchymal stem cells derived from patients with idiopathic necrosis of the femoral head (INFH). There are few reports on the function of LRRC17 in ovarian GCs, though so far one study has demonstrated that LRRC17 could be a prognostic gene in ovarian cancer as it regulates cancer cell viability through the p53 pathway (32). Hyperinsulinemia and IR play a central role in the pathogenesis of PCOS. They can affect the severity of clinical features, though are not associated with the existence of obesity. GLUT4 is a member of the GLUT family, which is preferentially expressed in muscle and adipose tissue. GLUT4 is responsible for insulin-stimulated glucose uptake, which may lead to IR (33). Our study showed that overexpression of miR-196b-5p can significantly reduce the expression of GLUT4, resulting in a decrease in glucose uptake. PCOS is a highly prevalent endocrine-metabolic disorder associated with IR. The decrease of glucose uptake and utilization by skeletal muscle and adipocytes caused by the decrease of GLUT4 expression or activity is an important molecular basis of IR. A prospective cross-sectional study showed that IR secondary to PCOS insulin-mediated decreased glucose uptake and increased insulin secretion was partly due to decreased GLUT4 expression in adipocytes without a compensatory increase in GLUT1 expression (34). The analysis of signaling components of the IRS/PI3K/AKT pathway showed that the expression of GLUT4 was significantly decreased in PCOS patients and the IR control group (35). Their results point to a new mechanism by which miR-93 regulates insulin-stimulated glucose uptake and demonstrates that the upregulated expression of miR-93 in all women with IR with or without PCOS may be the cause of IR in this syndrome. The CYP19A gene responsible for aromatase P450 is located on chromosome 15q21.2 and is necessary for estrogen formation. It is reported that obese and lean women with PCOS have low aromatase activity. Studies have also shown that interruption of the steroid production pathway caused by androgen overdose is a key factor in abnormal follicle formation and dominant follicular selection failure in hyperandrogen-induced PCOS women. The key enzyme for the production of estradiol in the ovaries is CYP19A1, which is involved in the transformation of androgen to estradiol in GCs (36). In our study, secretions of both estradiol and progesterone were increased by miR-196b-5p mimics in KGN cells, as well as the expression of CYP19A. In addition, our study showed miR-196b-5p mimics significantly decreased the amount of ROS in KGN cells. OS is an important inducer of ovarian senescence, which leads to the decline of the reproductive ability of humans and different animals. We showed that miR-196b-5p reduced the ROS content. Unfortunately, we did not detect the expression of ROS-related proteins and the PI3K-Akt signaling pathway associated with IR. In fact, obesity or IR may increase the OS of these cells. It will be interesting to determine whether miR-196b-5p is an effective antioxidant molecule. Recent reports have identified a close interaction between VDD and OS in exacerbating the pathophysiology of PCOS (37,38). In conclusion, we found that miR-196b-5p was significantly downregulated in the ovaries of VDD mice. In KGN cells, after inhibiting the expression of miR-196b-5p, cell proliferation decreased and apoptosis increased. At the same time, it was found that the decreased expression of CYP19A and GLUT4 led to a decrease in glucose uptake and the secretion of estrogen and progesterone. After inhibiting the expression of miR-196b-5p, the increase of intracellular ROS content indicated the increase of OS. It has been proven that RDX and LRRC17 are the target genes miR-196b-5p (). This is a preliminary but pioneering study to elucidate the functions of miR-196b-5p, RDX, and LRRC17 in KGN cells and their relationships. In the meantime, there are some limitations in our study. First, we performed in vitro experiments in KGN cell lines, so we were unable to predict the in vivo effect of miR-196b-5p on ovarian function. Second, a large number of PCOS patients are needed to further verify the expression of miR-196b-5p, RDX, and LRRC17. Therefore, we plan to continue this experiment in our subsequent work.
Figure 6

Representative schema of the effects of miR-195b-5p on VDD. MiR, microRNA; VDD, vitamin D deficiency; VD, vitamin D; ROS, reactive oxygen species; RDX, radixin; LRRC17, leucine rich repeat containing; GLUT4, glucose transporter 4; CYP19A, aromatase; E2, estradiol.

Representative schema of the effects of miR-195b-5p on VDD. MiR, microRNA; VDD, vitamin D deficiency; VD, vitamin D; ROS, reactive oxygen species; RDX, radixin; LRRC17, leucine rich repeat containing; GLUT4, glucose transporter 4; CYP19A, aromatase; E2, estradiol. The article’s supplementary files as
  38 in total

1.  Adipocyte expression of glucose transporter 1 and 4 in PCOS: Relationship to insulin-mediated and non-insulin-mediated whole-body glucose uptake.

Authors:  Uche Ezeh; Ida Y-D Chen; Yen-Hao Chen; Ricardo Azziz
Journal:  Clin Endocrinol (Oxf)       Date:  2019-02-14       Impact factor: 3.478

2.  Low Plasma Level of Leucine-Rich Repeat-Containing 17 (LRRc17) Is an Independent and Additive Risk Factor for Osteoporotic Fractures in Postmenopausal Women.

Authors:  Namki Hong; Beom-Jun Kim; Chong Hwa Kim; Ki Hyun Baek; Yong-Ki Min; Deog-Yoon Kim; Seung Hun Lee; Jung-Min Koh; Moo-Il Kang; Yumie Rhee
Journal:  J Bone Miner Res       Date:  2016-10-07       Impact factor: 6.741

3.  Identification of microRNAs controlling human ovarian cell proliferation and apoptosis.

Authors:  Alexander V Sirotkin; Marcela Lauková; Dmitriy Ovcharenko; Pauline Brenaut; Milos Mlyncek
Journal:  J Cell Physiol       Date:  2010-04       Impact factor: 6.384

4.  RP5-1120P11.3 promotes hepatocellular carcinoma development via the miR-196b-5p-WIPF2 axis.

Authors:  Hongjun Zhai; Xinwu Zhang; Shuo Chen; Meng Fan; Shuangyu Ma; Xiaoli Sun
Journal:  Biochem Cell Biol       Date:  2019-07-12       Impact factor: 3.626

5.  Knockdown of radixin by RNA interference suppresses the growth of human pancreatic cancer cells in vitro and in vivo.

Authors:  Shu-Dong Chen; Mao-Min Song; Zhi-Qiang Zhong; Na Li; Pi-Lin Wang; Shi Cheng; Ri-Xing Bai; Hui-Sheng Yuan
Journal:  Asian Pac J Cancer Prev       Date:  2012

6.  Influence of vitamin D levels on in vitro fertilization outcomes in donor-recipient cycles.

Authors:  Briana J Rudick; Sue Ann Ingles; Karine Chung; Frank Z Stanczyk; Richard J Paulson; Kristin A Bendikson
Journal:  Fertil Steril       Date:  2013-11-05       Impact factor: 7.329

7.  Radixin deficiency causes conjugated hyperbilirubinemia with loss of Mrp2 from bile canalicular membranes.

Authors:  Shojiro Kikuchi; Masaki Hata; Kanehisa Fukumoto; Yukari Yamane; Takeshi Matsui; Atsushi Tamura; Shigenobu Yonemura; Hisakazu Yamagishi; Dietrich Keppler; Shoichiro Tsukita; Sachiko Tsukita
Journal:  Nat Genet       Date:  2002-06-17       Impact factor: 38.330

8.  Vitamin D deficiency causes defective resistance to Aspergillus fumigatus in mice via aggravated and sustained inflammation.

Authors:  Pei Li; Xiaoyong Xu; Ehong Cao; Bo Yu; Wanchun Li; Ming Fan; Mei Huang; Lining Shi; Rong Zeng; Xin Su; Yi Shi
Journal:  PLoS One       Date:  2014-06-13       Impact factor: 3.240

9.  Oxidative stress-induced apoptosis in granulosa cells involves JNK, p53 and Puma.

Authors:  Hongyan Yang; Yan Xie; Dongyu Yang; Decheng Ren
Journal:  Oncotarget       Date:  2017-04-11
View more
  2 in total

1.  Ezrin Contributes to the Plasma Membrane Expression of PD-L1 in A2780 Cells.

Authors:  Mayuka Tameishi; Honami Ishikawa; Chihiro Tanaka; Takuro Kobori; Yoko Urashima; Takuya Ito; Tokio Obata
Journal:  J Clin Med       Date:  2022-04-27       Impact factor: 4.964

2.  A bibliometric analysis of global research on vitamin D and reproductive health between 2012 and 2021: Learning from the past, planning for the future.

Authors:  Yimeng Lu; Xudong Zhang; Shanshan Wu; Siwen Zhang; Jichun Tan
Journal:  Front Nutr       Date:  2022-09-08
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.