| Literature DB >> 35071227 |
Baoyi Zhu1, Zhanfang Kang2, Sihua Zhu1, Yuying Zhang1, Xiangmao Lai1, Lilin Zhou1, Hai Huang3, Xiaofeng Gao4, Chonghe Jiang1, Jianwen Zeng1.
Abstract
Bladder outlet obstruction (BOO) is a common urologic disease associated with poorly understood molecular mechanisms. This study aimed to investigate the possible involvements of circRNAs (circular RNAs) and circRNA-encoded proteins in BOO development. The rat BOO model was established by the partial bladder outlet obstruction surgery. Differential expression of circRNA and protein profiles were characterized by deep RNA sequencing and iTRAQ quantitative proteomics respectively. Novel proteins encoded by circRNAs were predicted through ORF (open reading frame) selection using the GETORF software and verified by the mass spectrometry in proteomics, combined with the validation of their expressional alterations by quantitative RT-PCR. Totally 3,051 circRNAs were differentially expressed in bladder tissues of rat BOO model with widespread genomic distributions, including 1,414 up-regulated, and 1,637 down-regulated circRNAs. Our following quantitative proteomics revealed significant changes of 85 proteins in rat BOO model, which were enriched in multiple biological processes and signaling pathways such as the PPAR and Wnt pathways. Among them, 21 differentially expressed proteins were predicted to be encoded by circRNAs and showed consistent circRNA and protein levels in rat BOO model. The expression levels of five protein-encoding circRNAs were further validated by quantitative RT-PCR and mass spectrometry. The circRNA and protein profiles were substantially altered in rat BOO model, with great expressional changes of circRNA-encoded novel proteins.Entities:
Keywords: bladder outlet obstruction; circRNA; circRNA-encoded protein; iTRAQ proteomics; protein-encoding circRNA
Year: 2022 PMID: 35071227 PMCID: PMC8777291 DOI: 10.3389/fcell.2021.772534
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
The information of primers used for quantitative PCR method.
| Gene ID | Primer sequence (5′-3′) | Product length (bp) |
|---|---|---|
| R-chr14:44496991|44498906-F | AGGAACTGGATTATGAACGGATTCA | 203 |
| R-chr14:44496991|44498906-R | AGCTATCTTCTTATCAGTCACTGTAT | |
| R-chr1:259396273|259437470-F | CTTCCTCTCCCACAAGCAGG | 215 |
| R-chr1:259396273|259437470-R | CATCCCGCCAAGGCATTTTC | |
| R-chr9:81258380|81275269-F | ATAGCCCACTCCTTCCCCAT | 209 |
| R-chr9:81258380|81275269-R | CATGGAGCACCTGGAGAACG | |
| R-chr13:51600243|51609980-F | GGAAGGTTACAAAGCACACCAC | 226 |
| R-chr13:51600243|51609980-R | TCAACAAGCTCTCGATGCCT | |
| R-chr1:141877382|141880461-F | CGCAGAGTCGATGGTGACC | 201 |
| R-chr1:141877382|141880461-R | GGCTCATTGACGACATGGTG | |
| R-chrX:52581092|52765991-F | TTGCTGTTGGAGGTACCTGC | 212 |
| R-chrX:52581092|52765991-R | TCCCCAGTTGCATTCAGTGT | |
| R-chr19:39176540|39195019-F | GCCGTGTCATAGCTACCCTC | 188 |
| R-chr19:39176540|39195019-R | GACCTTCCTGTCCTTGGTGG |
FIGURE 1Characterization of differentially expressed circRNAs in rat BOO model. (A) Frequency distribution of circRNAs expression in rat BOO model based on backspliced reads. X axis: the range of total backspliced reads of circRNAs. Y axis: the frequency of circRNAs. (B) Frequency distribution of circRNAs in rat BOO model based on circRNA length. X axis: the range of circRNAs length; Y-axis: the frequency of circRNAs. (C) The numbers of circRNAs in rat bladder tissues with different genomic origins. (D) Numbers of circRNAs encoded by different rat chromosomes. The up- and down-regulated circRNAs in the rat BOO model were shown in red and green bars respectively. (E) Hierarchical clustering of differential circRNA expression in the rat BOO model. Increased and decreased expression of circRNAs were indicated by red and green lines respectively. (F) A volcano plot showing the differential expression of circRNAs in the rat BOO model. CircRNAs with elevated and reduced expression in the rat BOO model were shown by red and green spots respectively.
FIGURE 2Proteomic identification of differentially expressed proteins in rat BOO model. (A) Hierarchical clustering of proteins differentially expressed in the bladder tissues of rat BOO model. Elevation and decreases of protein expression compared with the Sham group were present as red and green lines respectively. (B) The volcano plot displaying differentially expressed proteins in the bladder tissues of the rat BOO model. Red and green spots indicate up-regulated and down-regulated proteins respectively. (C) Functional categorization of proteins differentially expressed in the bladder tissues of the BOO rats. The enrichments of differentially expressed proteins in GO cellular components, molecular functions and biological processes were performed separately. (D) Functional categorization of differentially expressed proteins in rat BOO model based on KEGG signaling pathways. The enrichment significances were indicated by spot colors and protein numbers were indicated by the spot diameters.
FIGURE 3Validation of protein-encoding circRNA expression in rat BOO model. (A) The list of predicted protein-encoding circRNAs selected for validation and their expressional alterations in rat BOO model shown by RNA sequencing. The expressional ratio between the Sham and BOO groups, as well as the statistical significances (p values), during the RNA sequencing were shown in the table. (B) Relative expressional levels of representative protein-encoding circRNAs in the rat BOO model. The expression of circRNAs in rat BOO model (n = 7) were measured by quantitative RT-PCR method, compared with the Sham group (n = 8). *p < 0.05; **p < 0.01. Error bar indicated standard error. Mann-Whitney U test was used for comparison between groups.
FIGURE 4Mass spectrometric identification of circRNA-encoded proteins in rat BOO model. The amino acid sequences of novel proteins encoded by circRNAs chr14:44496991|44498906 (A), chr1:259396273|259437470 (B), chr1:141877382| 141880461 (C), chr9:81258380|81275269 (D), and chr19:39176540|39195019 (E) were listed in the left. Unique amino acid sequences encoded by circRNAs were shown in green, and peptides identified by mass spectrometry were highlighted by yellow background. The mass spectrometric identification of unique amino acid sequences in these five circRNA-encoded proteins were shown in the right.