Treponema denticola as a prognostic biomarker for periodontitis in dogs.

Periodontal disease is one of the most common disorders in the oral cavity of dogs and humans. Periodontitis, the irreversible periodontal disease, arises progressively from gingivitis, the reversible inflammatory condition caused by dental plaque. Although the etiology of periodontitis has been widely studied in humans, it is still insufficient for the etiological studies on periodontitis in dogs. Many studies have reported that human periodontitis-related bacteria are putative pathogens responsible for periodontitis in dogs. However, most of these studies have focused on the appearance of a specific microbiome, and most of the cohort studies have insufficient sample sizes to generalize their results. In the present study, subgingival samples collected from 336 teeth were categorized into three groups at first, based on clinical outcomes (healthy, gingivitis, periodontitis). Subsequently, the periodontitis samples were further divided into three subgroups (early, moderate, and advanced periodontitis) according to the degree of periodontal attachment loss. Healthy and gingivitis were grouped as a reversible group, and the three subgroups were grouped as an irreversible group. To investigate trends of periodontopathic bacteria in the samples of dogs, a quantitative real-time polymerase chain reaction (PCR) was performed for quantification of 11 human periodontopathic bacteria as follows: Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Tannerella forsythia, Treponema denticola (Td), Fusobacterium nucleatum, Prevotella nigrescens, Prevotella intermedia, Parvimonas micra, Eubacterium nodatum, Campylobacter rectus, and Eikenella corrodens. The PCR results showed that Aa and Pg, the representative periodontopathic bacteria, were not significantly correlated or associated with the periodontitis cases in dogs. However, interestingly, Td was strongly associated with the irreversible periodontal disease in dogs, in that it was the most prevalent bacterium detected from the dog samples. These findings indicate that the presence and numbers of Td could be used as a prognostic biomarker in predicting the irreversible periodontal disease and the disease severity in dogs.

Introduction

Periodontal disease is one of the most common disorders in the oral cavity of dogs and humans [1-5]. Periodontal disease is a group of illness occurring in the supportive tissues of the teeth. There are two main types of periodontal disease, gingivitis and periodontitis, which are classified by disease severity and progression. Gingivitis, the initial stage of periodontal disease, is a reversible inflammatory condition that presents with swelling, redness, and bleeding from the gingiva. In contrast, periodontitis is a destructive and irreversible form of periodontal disease, resulting in tissue destruction in the periodontal ligament, cementum, alveolar bone, and gingiva [6]. Periodontitis caused by microbial biofilm often leads to host-mediated destruction of periodontal tissues, resulting in not only loss of teeth but also bloodstream bacterial infections [7]. It is therefore important to predict the prognosis of periodontal disease by identifying biomarkers that aid in the development of appropriate therapeutic interventions and subsequently evaluating the periodontal tissues after the treatment.

Although the etiology of human periodontitis has been widely studied for several decades, the etiology of periodontal disease in dogs has not been completely explained yet. However, Yamasaki et al [6] evaluated putative pathogens related to periodontal disease in dogs The subgingival microbiota implicated in periodontal disease in dogs is predominantly constituted by gram-negative anaerobes, and it shows significant similarities to those of humans [6,8,9]. Another study has indicated that periodontal diseases in dogs are more closely related to those in humans than to other animals [10].

Although recent studies have found that the oral microbiome in dogs is significantly different from the human oral microbiome [11,12], many previous studies have suspected that human periodontitis-related bacteria such as Porphyromonas gingivalis (Pg), Porphyromonas gulae, Prevotella intermedia (Pi), Fusobacterium nucleatum (Fn), Dialister pneumosintes, Actinobacillus actinomycetemcomitans, Campylobacter rectus (Cr), Eikenella corrodens (Ec), Tannerella forsythia (Tf), and Treponema denticola (Td) are putative periodontitis-related pathogens in dogs [13,14]. Most of these previous studies evaluated only the appearance of putative bacteria rather than trends in bacterial numbers and correlations of periodontitis stages in the dog. Furthermore, their limitations imposed by small cohort sizes have not been resolved [15,16]. It is necessary to analyze trends in bacterial numbers and associations between bacterial species and various periodontal conditions in dogs to overcome the limitations of previous studies.

Throughout the present study, we simply put all the clinical samples into two classification groups largely. Those were the reversible group (collectively, the healthy and gingivitis sample group) and the irreversible periodontitis group. These two (reversible and irreversible) groups were basically used for the comparison with each other to assess the tested 11 bacteria that were thought to be associated with periodontal disease. A quantitative real-time polymerase chain reaction (PCR) was performed for the quantification of these 11 periodontopathic bacterial species as follows: Aggregatibacter actinomycetemcomitans (Aa), Pg, Tf, Td, Fn, Prevotella nigrescens (Pn), Pi, Parvimonas micra (Pm), Eubacterium nodatum (En), Cr, and Ec. Based on results of PCR analysis, the correlation and association between the number of bacterial species and various periodontal conditions were analyzed. For the first time in veterinary field, the current study also investigated the association between bacterial combination to understand the interrelationships of reversible and irreversible periodontal conditions with different severities.

Materials and methods

Animals

Client-owned dogs examined for periodontal disease by MAY Veterinary Dental Hospital were used in the study. The present study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committees (IACUC) of Gyeongsang National University (Approval no. GNU210813D0072). All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering. The owners of the dogs were informed about the aim of the study and gave permission for sampling of their dogs. During the period January 2019 to February 2020, a total of 336 subgingival clinical samples were collected from 176 dogs. These dogs were aged over 1 year. Dogs were evaluated via a serum biochemical panel and CBC were performed on the day prior to scheduled periodontal treatment. They had not received any antibiotics over the past 3 months. Their body weights were less than 20 kg, a common finding in the veterinary field in South Korea.

Sample collection

Clinical sample collections were performed under general anesthesia. The anesthesia protocol was briefly as follow: the premedication for the general anesthesia was glycopyrrolate (0.01 mg/kg, Mobinul; Myungmoon, Gyeonggi, Korea), subcutaneously, butorphanol (0.1 mg/Kg, Bu; Myungmoon, Gyeonggi, Korea) and midazolam (0.2 mg/Kg, Midacom; Myungmoon, Geyonggi, Korea), intravenously. Propofol (4 mg/Kg, Probio; Myungmoon, Geyonggi, Korea) was administered intravenously for the induction and the anesthesia was maintained with isofluranef at 1.5~2% and O2 at 2 L/min followed by the placement of cuffed endotracheal tube. Lactated Ringer solution was administered through IV at a rate of 10 ml/Kg/hr through the procedure. Conductive-fabric patient warming system was placed under the dogs and they were monitored using combination monitoring equipment.

Sample collection sites were divided into rostral and caudal teeth of the oral cavity. Target teeth were mandibular and maxillary canine teeth known to be functionally important rostral teeth. The major masticatory teeth, maxillary fourth premolars teeth and mandibular first molars teeth, were also targeted as caudal teeth. Two samples were collected from each dog (one from the rostral target teeth and one from the caudal target teeth). One sample was collected if target teeth were missing in the oral cavity for some reasons.

All samples were obtained using a sterilized paper point International Organization for Standardization #30, which was gently inserted into the subgingival pocket at 6 points around each tooth for 30 seconds and transferred immediately into a sterilized transport tube (Fig 1A). Six paper points obtained subgingival plaque from six points around a tooth, and all six paper points were placed in a sterilized sample container, then a unique barcode number was assigned to the sample container and analyzed as one sample. Teeth were examined and evaluated by intraoral dental radiography and periodontal probing.

Fig 1

Sample collection sites and grouping criteria.

(A) Sample collection sites are pointed at six positions around a tooth. (B) The subgingival plaque samples were classified into five periodontal disease (PD) groups based on the clinical conditions, such as healthy (PD0), gingivitis (PD1), early periodontitis (PD2), moderate periodontitis (PD3), and advanced periodontitis (PD4). The reversible group comprised PD0 and PD1, and the irreversible group comprised the other three PD groups (PD2, PD3, and PD4), which were classified by severity of periodontitis.

Sample grouping by five stages of periodontal disease (PD)

Intraoral dental radiographs were obtained under general anesthesia and evaluated by the same veterinarian (DH-K) with a standard approach under the same conditions. According to the classification criteria of the American Veterinary Dental College [17], samples were divided into five PD groups based on clinical conditions, such as healthy (PD0), gingivitis (PD1), early periodontitis (PD2), moderate periodontitis (PD3), and advanced periodontitis (PD4). These five-stage PD grouping was based on the degree of attachment loss and gum condition. PD0 and PD1 included subjects without attachment loss. PD2, PD3, and PD4 included subjects with < 25%, 25%~50%, and > 50% attachment loss, respectively. A reversible group comprised PD0 and PD1, and an irreversible was group comprised PD2, PD3, and PD4 (Fig 1B).

DNA extraction

DNA extraction was performed using an ExgeneTM Cell SV kit (GeneAll Biotechnologies, Seoul, South Korea) according to the manufacturer’s instructions. The paper point was treated with 180 μL lysozyme at 30 mg/mL and incubated at 37°C for 30 minutes. Proteinase K solution (20 μL of 20 mg/mL) and 200 μL of buffer BL were added to each sample followed by incubation at 56°C for 30 minutes and 95°C for 15 minutes. Subsequently, 200 μL of absolute ethanol was added, and the mixture was transferred into a column and centrifuged at 14,000 rpm for 1 minute. After washing the column with 600 μL of buffer BW, 700 μL of buffer TW was added. Next, 100 μL of buffer AE was used to elute DNA. DNA was quantified with a NanoDrop Spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). DNA samples were stored at –20°C before use.

Quantitative real-time polymerase chain reaction assay

Targeted oral bacteria and primer/probe set sequence used for quantitative real-time PCR in this study are listed in Table 1. PCR amplification was performed in a reaction volume of 20 μL (Bioneer, Inc., Daejeon, South Korea). PCR cycling was performed using a CFX96™ Real-Time System (Bio-Rad Laboratories Inc., Hercules, CA, USA). Cycling conditions consisted of an initial denaturation step at 95°C for 5 minutes, followed by 40 cycles of denaturation at 95°C for 30 seconds, primer annealing at 60°C for 40 seconds, and primer extension at 72°C for 30 seconds. After completion of the cycling steps, a final extension step at 72°C for 5 minutes was performed. The normalized value of expression for each species was calculated as the ratio of the relative copy number of the reference species.

Table 1

Targeted oral bacteria and primer/probe set sequence used for quantification real-time PCR.

Species and primer/probe	Primer/probe set sequence (5′ to 3′)	Length (base)	Amplicon size (bp)	Reference
AaAaLtF14AaLtR11AaLtP13	CGGTGGAGAAGGAAATGATATTTATG ATTGCCGTTACGCTCAAATG FAM-CCACACTATTACGGAACATAGCGGTG-BHQ-1	262028	139	Thisstudy
PgPghaF14PghaR13PghaP11B	GCAGGGTCAGAAAGTAACGCTC CGATCCGTTTTACTTCACGG HEX-CCGAGCGCAAAGAAGGCAGAA-BHQ-1	222021	80	Thisstudy
TfTfKpF13TfKpR12TfKpP11	CCGGCGGTTTCCTGTAGTAGA ACTTCGTCCGTTGCAGGGTT TEXAS RED-CTCCCTTCACCCTCTCGCCG-BHQ-2	212020	68	Thisstudy
TdTdopF13TdopR13TdopP01	CATCTCTTGATGCAGCCGAAG GTCAGGGCTTACAACATAGTCGTC Cy5-TGGCGGAAGGAAAACAAGCC-BHQ-2	212420	98	Thisstudy
Fn.FnChF15FnChR13FnChP12	GACATCTTAGGAATGAGACAGAGATG CAGCCATGCACCACCTGTCT TEXAS RED-CAGTGTCCCTTCGGGGAAACCT-BHQ-2	262022	73	Thisstudy
PnPngyF12PngyR13PngyP11	GCAAGAACGTGATGACGGGA ATTTCGCAGTCTTTGGGATCT TT Cy5-TTGCCAGGAAAACTTGCCGA-BHQ-2	202320	79	Thisstudy
PiPipiF12PipiR13Pi194P13H	CCACCAACGACAACCTTCCA TCTACTGCTTCGAGCGCAC HEX-CAAGACAATCTCCGACGGAACGTT-BHQ-1	201924	103	Thisstudy
PmPmF-30PmR-30Pm16S30	AAACGACGATTAATACCACATGAGAC ACTGCTGCCTCCCGTAGGA TEXAS RED-TCAAAGATTTATCGGTGTAAGAAGGGCTCGC-BHQ-2	261931	201	Nonnenmacher et al. [18]
EnEnglF01EnglR01EnglP01	ATCCACAACAAAAGCGGCCT AGGAATGTCCGGAGCAGGAA HEX-CAAACCAATCTGCAGCATGGG-BHQ-1	202021	157	Thisstudy
CrCrgrF14CrgrR12CrgrP01	GCGAAGTAGTGAGCGAAGAG GCCTGCGCCATTTACGATA FAM-CAAGCGTGATCATCGACAAGGATAACA-BHQ-1	201927	119	Thisstudy
EcEcISRF-21EcISRR-21EcISRP21	AGGCGACGAAGGACGTGTAA ATCACCGGATCAAAGCTCTATTG Cy5-CGTGTAAGCCTGCGAAAAGCATCG-BHQ-2	202324	69	Price et al. [19]Modified

F: Forward primer, R: Reverse primer, P: Probe.

The qPCR performed with the primer-probe sets used in this study are as shown in the Table 1, and the data for assessment of specificity and sensitivity of the primer-probe sets detecting 11 bacteria from the subgingival plaques of dogs can be found in Supporting Information section.

Statistical methods

All statistical analyses were performed using the MedCalc Statistical Software version 18.5 (MedCalc Software, Ostend, Belgium). The independence of characteristics of samples was analyzed by independent t-tests. The correlation between the number of bacteria and the severity of the periodontal condition was evaluated by Pearson’s correlation coefficient. Associations of each bacterium or combination of bacteria between reversible and irreversible groups were analyzed using logistic regression. The significance level was set at p < 0.05.

Results

Characteristic profiles of dogs that donated the subgingival plaque samples

Characteristic profiles of dogs that donated the subgingival plaque samples are summarized in Table 2. The mean ages were 9.36 and 9.69 years for the reversible and irreversible groups, respectively. Males accounted for 54.7% and 58.3% in the reversible and irreversible groups, respectively. The mean body weights were 6.44 kg and 5.79 kg for the reversible and irreversible groups, respectively. An independent t-test was performed to show a statistical independence between these characteristics of the dogs and the reversible and irreversible groupings based on the dog’s periodontal disease conditions. The statistical results showed that these dog’s characteristics were not significantly associated with their periodontal disease conditions. Of the total 336 samples, 190 samples (PD0, 70; PD1 120 samples) were classified into the reversible group, and 146 samples (PD2, 77; PD3, 34; PD4, 35 samples) were classified as the irreversible group.

Table 2

Characteristic profiles of dogs that provided the subgingival plaque samples.

Characteristic	Reversible group	Irreversible group	p *
Age (years)	9.36 ± 1.20	9.69 ± 1.40	0.113
Male (%)	54.7	58.3	0.585
Weight (kg)	6.44 ± 3.11	5.79 ± 3.04	0.061

Data of age and weight are given as mean ± standard deviation. Data of male are provided as percentage (%).

*Independent t-test.

Prevalence of the putative periodontopathic bacteria in dogs

Overall bacterial prevalence

The overall prevalence of the tested 11 bacteria detected in the reversible and irreversible groups is shown in Fig 2. Fn, Pm, and Ec showed a high prevalence over 50%, whereas Aa, Pg, and Pn showed a low prevalence less than 10%.

Fig 2

Overall prevalence of bacteria in the reversible and irreversible groups.

Bars represent the number of samples that each bacterial species was detected and the percentage of the number of samples detected to the number of total samples (%). Fn, Pm, and Ec showed high prevalence at over 50%, whereas Aa, Pg, and Pn showed low prevalence at less than 10%.

Prevalence of the putative periodontopathic bacteria in the reversible and irreversible groups

The prevalence of each bacterium was compared between the reversible and irreversible groups (Fig 3A). The prevalence of all bacterial species in the irreversible group was higher than that in the reversible group. Among the tested 11 bacterial species, Aa, Tf, Td, Pn, Pi, Pm, En, and Cr were detected two times more in the irreversible group compared with the reversible group. Prevotella intermedia showed the biggest difference in prevalence among the reversible and irreversible groups at 5.95 times. Treponema denticola showed the second biggest difference at 5.69 times.

Fig 3

Prevalence of bacteria in comparison between groups.

(A) Comparison of fold changes between the reversible and irreversible groups. (B) Comparison of fold changes between the reversible group and each periodontal disease (PD) group of the irreversible group. PD2: PD2 group, PD3: PD3 group, PD4: PD4 group, con: Reversible group.

Prevalence of bacteria in the reversible and periodontal disease (PD) groups

This study also compared the prevalence of each bacterium between the reversible group and each PD group (Fig 3B). Although the severity of periodontal disease was getting worse from PD2 to PD4, the prevalence of Aa and Pg showed a gradually decreasing trend. In contrast, the prevalence of Fn, Pn, Pi, and Pm continually increased along the increase of PD severity. Bacteria that showed increases over two times in their prevalence for all PD groups were Tf, Td, Pn, Pi, En, and Cr. were Tf, Td, Pn, Pi, En, and Cr showed more than double the difference in the prevalence of all PD groups. The fold change of T. denticola, the biggest change, was 7.68 times between the reversible and PD3 groups. P. intermedia showed the biggest difference between the reversible and PD4 groups at 9.31 times. The bacterium that showed the biggest increase in its prevalence between the reversible group and PD3 group (moderate periodontitis) was T. denticola. P. intermedia showed the biggest difference between the reversible group and PD4 group (advanced periodontitis).

Mean number of bacteria

Overall mean number of bacteria

This study analyzed the mean number of all bacterial species in all groups (Fig 4). The mean number of F. nucleatum was 2.76E+07, which was the largest, whereas the mean number of A. actinomycetemcomitans was 6.21E+02, which was the smallest.

Fig 4

Overall mean numbers of bacteria in all groups.

Bars show standard deviation. log = logarithm.

Mean numbers of bacteria in the reversible and irreversible groups

Mean numbers of bacteria in the reversible and irreversible groups were compared. Results are shown in Fig 5A. Mean numbers of all bacterial species were increased in the irreversible group. Numbers of Aa, Pg, Td, Pm, En, and Cr in the irreversible group were higher over five times compared with those in the reversible group. However, Aa might not be associated with irreversible periodontal condition in dogs because of its extremely low overall bacterial number. The bacterium that showed the biggest difference in its number between the two groups was T. denticola (25.14 times). This result indicated a significant correlation between the number of bacteria and periodontitis, an irreversible condition.

Fig 5

Mean numbers of bacteria in comparison between groups.

(A) Comparison of fold changes between the reversible and irreversible groups. PD2: PD2 group, PD3: PD3 group, PD4: PD4 group, con: Reversible group.

Mean numbers of bacteria in the reversible and PD groups

Mean numbers of bacteria in the reversible group and each PD group were compared. Results are shown in Fig 5B. In the comparison between the reversible and PD2 groups, Aa and Td showed significant increases (24.31 times and 22.95 times, respectively). The difference of Td, 32.06 times, was unrivaled and overwhelming in comparison with the PD3 group. In the comparison of the reversible group and the PD4 group, Td and En showed the most overwhelming differences at 23.23 times and 21.62 times, respectively. Aa, Pg, and Tf showed significant differences in their numbers between the reversible and PD2 groups. However, the present study found that the number of bacteria continuously decreased as the severity progressed from PD3 to PD4. Specifically, Aa was not detected in the PD4 group. Conversely, Pm, En, and Cr increased continuously as severity progressed. Compared with the reversible group, the significant difference of Td in its number was observed in all PD groups. These results suggest that the number of bacteria except for a few could be correlated with the severity of periodontal condition, especially in the case of T. denticola.

Correlation between the severity in the irreversible group and the number of bacterial species

Correlation analysis between the severity in the irreversible group and bacterial species was performed. All species, except Aa and Pg, showed reliable positive correlations with the irreversible group. In particular, Td, Pm, and Cr showed moderate correlations with Pearson’s r > 0.4 (Table 3).

Table 3

Correlation between the severity of periodontal condition and the number of each bacterial species.

Species	Pearson’s r	p-value
Aa	0.029	0.592
Pg	0.017	0.751
Tf	0.329	<0.001
Td	0.430	<0.001
Fn	0.357	<0.001
Pn	0.144	0.008
Pi	0.310	0.010
Pm	0.428	<0.001
En	0.354	<0.001
Cr	0.413	<0.001
Ec	0.260	0.006

Pearson’s r: Pearson correlation coefficient.

Aa: Aggregatibacter actinomycetemcomitans, Pg: Porphyromonas gingivalis, Tf: Tannerella forsythia, Td: Treponema denticola, Fn: Fusobacterium nucleatum, Pn: Prevotella nigrescens, Pi: Prevotella intermedia, Pm: Parvimonas micra, En: Eubacterium nodatum, Cr: Campylobacter rectus, Ec: Eikenella corrodens.

Association between the number of each bacterial species and periodontal condition

Statistical methods were used to analyze associations between periodontal conditions and the number of bacteria using various comparisons (Table 4). Table 4 represents data that were p > 0.05. As shown in Table 4, the number of individual bacterial species was relatively increased, except for Aa and Pg, in the comparison between the reversible and irreversible groups. Similarly, Aa and Pg showed no significant reliability in associations between the reversible and each PD group. These facts indicated that the number of Aa and Pg had no association with periodontal conditions. Based on this, A. actinomycetemcomitans and P. gingivalis were excluded from further analysis.

Table 4

Relatively very low reliability of Aa and Pg in the Associations between the number of each bacterial species and the reversible and irreversible group and each PD group.

	Species	Odd ratio (95% CI)	p-value
Reversible group vs. irreversible group	Aa	1.184 (0.942–1.488)	0.148
	Pg	1.027 (0.969–1.088)	0.182
Reversible group vs. PD2 group	Aa	1.227 (0.968–1.555)	0.091
	Pg	1.045 (0.978–1.116)	0.196
Reversible group vs. PD3 group	Aa	1.193 (0.890–1.600)	0.238
	Pg	0.994 (0.891–1.108)	0.907
Reversible group vs. PD4 group	Aa		N.A
	Pg	1.012 (0.919–1.113)	0.815
Reversible group vs. PD3+4 group	Aa	1.106 (0.826–1.482)	0.499
	Pg	1.003 (0.929–1.083)	0.935

Logistic regression.

Association between the combinatory coexistence and numbers of bacterial species with the PD groups

With exception of Aa and Pg, as shown in Table 5, the combinatory coexistence and numbers of bacterial species among the remaining nine putative periodontopathic bacteria in the five-stage PD groups showed significant associations with the irreversible group and with the respective PD groups. For the comparison between the reversible and irreversible groups, bacterial numbers of Tf, Td, Pi, En, and Ec showed significant associations (p = 0.001, p < 0.001, p = 0.006, p = 0.009, and p = 0.004, respectively). In the case of comparison between the reversible group and the PD2 group, numbers of Tf, Td, En, and Ec (p < 0.001, p = 0.001, p = 0.002, and p = 0.002, respectively) showed significant associations with the PD2 group. For the comparison between the reversible and PD3 groups, numbers of Td, Fn, Pi, Pm, and Ec also showed significant associations with the PD3 group (p < 0.001, p = 0.019, p = 0.001, p = 0.020, and p = 0.043, respectively). Numbers of Td, Pi, and Pm also showed significant associations with the PD4 group in the comparison between the reversible and PD4 groups (p = 0.005, p < 0.001, and p = 0.014, respectively). Numbers of Td, Fn, Pi, and Pm showed significant associations with PD3 + PD4 group in the comparison between the reversible and PD3 + PD4 groups (p < 0.001, p = 0.005, p < 0.001, and p = 0.004, respectively).

Table 5

Association between the combinatory coexistence and numbers of bacterial species with the periodontal disease groups.

	Species	Odd ratio (95% CI)	p-value
Reversible group vs. irreversible group	Tf	1.109 (1.042–1.182)	0.001
	Td	1.159 (1.086–1.237)	<0.001
	Pi	1.105 (1.029–1.187)	0.006
	En	1.081 (1.019–1.146)	0.009
	Ec	1.161 (1.048–1.285)	0.004
Reversible group vs. PD2 group	Tf	1.138 (1.060–1.221)	<0.001
	Td	1.134 (1.050–1.224)	0.001
	En	1.114 (1.042–1.190)	0.002
	Ec	1.222 (1.078–1.386)	0.002
reversible group vs PD 3 group	Td	1.288 (1.156–1.435)	<0.001
	Fn	1.113 (1.018–1.352)	0.019
	Pi	1.207 (1.077–1.352)	0.001
	Pm	1.141 (1.021–1.276)	0.020
	Ec	1.283 (1.008–1.633)	0.043
Reversible group vs. PD4 group	Td	1.152 (1.043–1.273)	0.005
	Pi	1.195 (1.082–1.319)	<0.001
	Pm	1.145 (1.028–1.276)	0.014
Reversible group vs. PD3+4 group	Td	1.212 (1.117–1.315)	<0.001
	Fn	1.099 (1.029–1.175)	0.005
	Pi	1.193 (1.090–1.307)	<0.001
	Pm	1.127 (1.039–1.223)	0.004
PD2 group vs. PD3 group	Td	1.128 (1.039–1.226)	0.004
PD3 group vs. PD4 group
PD2 group vs. PD4 group	Pi	1.097 (1.010–1.192)	0.028

Logistic regression.

P. intermedia showed a high significance in the comparison between the reversible and PD3 groups, between the reversible and PD4 groups, and between the reversible and PD3 + PD4 groups. However, T. forsythia showed a significance in the comparison between the reversible and PD2 groups only. Based on the above results, T. denticola seemed to be a superior species to others in all different comparisons analyzed statistically in this study.

This study also statistically analyzed the association between each PD group. Only T. denticola was significantly associated with the PD3 group in the comparison between the PD2 and PD3 groups. P. intermedia was only significantly associated with the PD4 group in the comparison between the PD2 and PD4 groups. However, no bacteria showed significance in the comparison between the PD3 and PD4 groups.

Discussion

Periodontitis is the most prevalent oral disease in humans. It also appears in approximately 44–63.6% of dogs [2]. The severity and prevalence of periodontitis in dogs increase with age [3]. This inflammatory oral disease is observed in approximately 80% of dogs aged 4 years [4], 82% of dogs aged 6–8 years, and 96% of dogs aged 12–14 years [5].

Periodontitis is an irreversible inflammatory periodontal condition that is always accompanied by anatomical destruction in the periodontium. It is classified into three grades as early, moderate, and advanced periodontitis according to the severity of attachment loss [17]. Since the irreversibly destroyed periodontium cannot be reestablished, understanding the etiology of periodontitis is significantly important to predict and prevent the expected irreversible condition. Therefore, this study analyzed the trends of 11 bacterial species in dogs with reversible or irreversible periodontal conditions.

Dewhirst et al. [20] have obtained 353 canine oral bacterial taxa from 51 dogs and analyzed them. They found that only 16.4% of oral bacterial taxa were shared between dogs and humans and that 83.6% of identified taxa in dogs were novel. The 11 bacterial species focused in this study were included in 16.4% of oral bacterial taxa sharing with humans in the study. Other studies have also confirmed that canine microbiome is significantly different from human microbiome, revealing that bacteria not found in human subgingival plaque or did not have a high rate of prevalence were detected in dog subgingival plaque with significantly high percentages [11,21]. Wallis et al. [12] have longitudinally researched changes that occur in subgingival bacterial communities during the transition from health through gingivitis to the early stage of periodontitis in dogs. Their study suggested that a reduction in the proportion of health-associated species was a more evident indicator than the appearance of disease-associated species. Although the microbiome and environmental factors of dogs are relatively different from those of humans, most human periodontitis-related bacterial species are suspected as putative periodontitis-related pathogens in dogs [13,14].

Kumar et al. [22] have reported that higher number of species lost or gained is closely related to changed clinical status of the periodontal condition. They also suggested that the appearance of previously undetected bacterial species was not related to periodontitis. Rather, it was the result of microbial succession through fluctuation of newly abundant and/or meager bacterial species in subgingival space [23]. According to Griffen’s study, it is significantly compelling to understand changed patterns of the number of putative periodontal pathogenic bacterial species and their associations through the periodontitis process in dogs. However, only a few studies have assessed periodontal pathogenic bacterial species and their associations in dogs. The majority of previous studies have analyzed only the difference in the prevalence of putative pathogens between limited severity of the disease such as health, gingivitis, and early periodontitis. Based on findings of the study by Griffen et al. [23], the prevalence of the 11 bacterial species in dogs, trends in their number changes, and their correlations and associations with irreversible periodontal condition with different severity were evaluated in this study for the first time in the veterinary field.

Nishiyama et al. [14] have assessed the presence of putative periodontal pathogens based on human periodontitis-related bacterial species in 40 dogs. It showed that Pg, Cr, Aa, Pi, Tf, Fn, and Ec were detected in 64%, 36%, 24%, 20%, 20%, 16%, and 12% of 25 dogs with periodontitis, respectively. T. denticola and D. pneumosintes were not detected in that study. Another study has analyzed 73 subgingival samples taken from dogs to assess the associations of red complex bacteria species in dogs [24]. It indicated that dogs with gingivitis or periodontitis were more likely to be infected with T. forsythia and P. gingivalis. Recently, Özavci et al. [25] have investigated the periodontal disease-related pathogens of dental plaque from 50 cats and 51 dogs with periodontal disease by PCR analysis. Their findings indicated that the periodontal disease-related pathogens, which showed high prevalence in the periodontal disease of cats and dogs, were P. gingivalis (cats 96%, dogs 88%), P. nigrescens (cats 90%, dogs 57%), and P. gulae (cats 70%, dogs 39%).

However, in this study, A. actinomycetemcomitans and P. gingivalis did not show any reliable correlations or associations with periodontitis. Numbers of all individual bacterial species, except Aa and Pg, in the irreversible group and each PD group were higher than those in the reversible group. Specifically, Aa showed extremely low overall prevalence and bacterial count. This study found that Aa and Pg did not have any reliable association or contribution to periodontal disease in dogs. Except Aa and Pg, the other nine bacteria appeared to contribute to the periodontal process, although their mutual associations remained unclear.

Polkowska et al. [26] have analyzed gingival pocket microflora in 21 dogs experiencing moderate periodontitis (PD3) and advanced periodontitis (PD4). According to their study, the most commonly isolated pathogens in PD3 were Streptococcus sanguis (15.59%), Peptostreptococcus spp. (15.59%), Escherichia coli (12.84%), Proteus mirabilis (5.50%), Veillonella spp. (4.58%), and Staphylococcus aureus (4.58%). In PD4, Peptostreptococcus spp. (23.69%), Streptococcus salivarius (13.01%), Veillonella spp. (7.53%), Actinomyces spp. (6.16%), Actinomyces viscosus (4.10%), and Staphylococcus aureus (4.79%) were most often isolated [24]. The prevalence of Peptostreptococcus spp., which were reclassified as Parvimonas spp. in 2006, was significantly high in both PD3 and PD4 [26,27]. Similarly, the prevalence of Pm in PD3 and PD4 were over two times compared to that in the reversible group in our study. We also found that Pm was statistically associated with both PD3 and PD4 compared to the reversible group (p < 0.05).

The etiological findings from the periodontitis cases after analysis with the subgingival plaque samples in dogs were different from those that are widely studied in humans. Previous studies have described ecological succession and colonization of putative periodontopathic bacterial complexes in the subgingival plaque in a color-coded manner to demonstrate their abundance and the degree of association with periodontitis, including non-spore-forming anaerobes that usually form bacterial complexes in the subgingival plaque [28,29]. Subsequently, the keystone hypothesis has suggested that certain low-abundance pathogens could orchestrate inflammatory disease by remodeling a normally nonpathogenic microbiota into a dysbiotic one and altering host immune protective mechanisms [30,31]. According to these studies, Pg plays the strongest key role in the initiation and progression of human periodontitis, different from our findings. Aa is also strongly associated with human periodontitis by overwhelming the natural resistance of local host innate defense response and producing inflammatory cytokines that can result in connective tissue and bone loss [32].

One study has suggested that periodontal disease is not caused by a few isolated bacteria but by a community-wide effect of bacteria [12]. To confirm this, bacterial associations were analyzed using a combination of nine bacteria excluding Ag and Pg in this study. In the statistical evaluation of putative symbiotic associations of the combination of these nine bacteria between the reversible and irreversible groups, Tf, Td, Pi, En, and Ec showed significant associations with the irreversible group. Specifically, T. denticola showed a significantly strong reliability.

This study also evaluated the association of the combination of nine bacteria excluding Aa and Pg in the comparison between the reversible and PD groups. Tf, Td, En, and Ec were highly associated with the PD2 group, suggesting that the periosteum showed initial anatomical destruction. In the comparison between the reversible group and the PD3 group involving moderate periodontal destruction, Td, Fn, Pi, Pm, and Ec showed relatively high associations with the PD3 group. In the comparison between the reversible group and the PD4 group, the terminal stage of periodontitis, Td, Pi, and Pm were reliably associated with the PD4 group. Td, Fn, Pi, and Pm also showed strong associations with the PD3 + PD4 group in the comparison between the reversible group and the PD3 + PD4 group, suggesting a clinically more than moderate stage of periodontitis. Tf and En were related to the initial stage of irreversible periodontal condition. Pi and Pm were related to more than moderate stage of irreversible periodontal condition. However, T. denticola had a superior significance in contributing to periodontitis at different severity levels in dogs.

To understand whether any bacteria had strong associations with the progress of the irreversible periodontal condition, this study also analyzed the association between a combination of nine bacteria and progression between the PD groups. T. denticola showed strong association with progression between PD2 and PD3. P. intermedia also showed a reliable association with progression between PD2 and PD4. However, no bacteria showed significant association with progression between PD3 and PD4. Therefore, T. denticola could be a predictable biomarker for the deterioration from early periodontitis to moderate periodontitis. In the aggravation from early periodontitis to advanced periodontitis, P. intermedia can be suggested as a predictable biomarker.

A previous study has investigated Treponema spp. in a gingival plaque from both healthy and periodontitis affecting 11 dogs to describe their occurrence and diversity. According to this phylogenetic analysis, Td and Treponema maltophilum (Tm) were mainly detected in the two groups in the diversity of treponema population. In addition, it indicated that Td and Tm are common in dogs regardless of periodontal status [33]. However, this finding is significantly different from that of the present study, which investigated 176 dogs. Although the overall prevalence of Td was 25.60%, Td showed the second biggest difference at 5.69 times in comparison of the prevalence between the reversible and irreversible group in this study. The mean number of Td in the irreversible group was also significantly higher than that in the reversible group, 25.14 times. Furthermore, this study reveals that T. denticola is most significantly correlated and associated with the irreversible group (periodontitis) in the above various statistical comparisons.

Several studies have revealed that Porphyromonas gulae is predominant in periodontal disease in dogs instead of P. gingivalis. Previous studies have noted that P. gulae is rarely found in humans but is commonly detected in animals with active periodontitis [7,34]. P. gulae is distinct from other related genera of P. gingivalis, which is known as a keystone pathogen in human periodontitis. Recently, it has been reported that P. gulae might be associated with periodontitis in dogs [35,36]. However, it is not clearly understood how P. gulae contributes to periodontal disease progression or how it cooperates with other bacterial species. Other studies have also shown that bacteria not found in human subgingival plaque or do not have a high rate of prevalence are significantly highly detected in subgingival plaque of dogs [11,12]. According to these studies, Porphyromonas cangingivalis, Porphyromonas gingivicanis, P. gulae, Porphyromonas canoris, and Fusobacterium sp. are highly prevalent in subgingival plaque of dogs, unlike in that of human beings. Although they might not contribute to the initiation or the progression of periodontitis in dogs because of their high prevalence through health to early periodontitis, we need to further evaluate the correlations and associations of these highly prevalent bacteria in dogs with periodontal disease, along with nine bacterial species analyzed in the present study.

Out of the putative 11 periodontopathic bacteria tested in this study, A. actinomycetemcomitans and P. gingivalis were not significantly associated in periodontal disease of dogs. However, the remaining nine others were significantly associated with periodontal diseases in dogs. Interestingly, among the nine PD-associated bacteria, T. denticola was the remarkable bacterium found in the irreversible group, which showed a correlation with the disease severity of periodontitis. Therefore, these findings suggest that T. denticola could be used as a prognostic biomarker in predicting the irreversible periodontal disease and the disease severity in dogs.

Test results of qPCR sensitivity with the primer/probe set.

(DOCX)

Click here for additional data file.

Standard curves generated from the Ct values for amplification of the target DNA of the red complex bacteria.

(DOCX)

Click here for additional data file.

Primer and probe set used for qPCR detection of 11 bacterial species from the subgingival plaques in the teeth of dogs.

(DOCX)

Click here for additional data file.

List of bacteria tested for the specificity of the qPCR with the primer/probe set.

(DOCX)

Click here for additional data file.

Test results of qPCR specificity with the primer/probe set.

(DOCX)

Click here for additional data file.

25 Nov 2021

5 Jan 2022

Catherine A. Brissette, Ph.D.

Academic Editor, PLOS ONE

Dear Dr. Catherine A. Brissette

We thank the editor and referees of the “PLOS ONE” for taking their time to review our report. We have made some corrections and clarifications in the manuscript after going over the review’s comments. The changed are summarized below:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.

Answer: It was approved by the Institutional Animal Care and Use Committees (IACUC) of Gyeongsang National University, an ethics committee related to animal experiments, and it was described in the animals section of materials and methods.

3. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Review Comments to the Author

Reviewer #1:

This manuscript screened prognosis marker bacteria for dog periodontitis from dental plaque using quantification real-time PCR. The investigation of the dog periodontitis is a little and more investigation is required. This manuscript focused on the human periodontal pathogen in dog periodontitis. The viewpoint is interesting. Author had better to revise several points to improve manuscript.

1. Specificity of the primer/probe set of quantification real-time PCR was not clear.

The composition of the dental plaque bacteria in dog has not completely investigated. It is possible that the primers/probes cross reacted to closely related species to human periodontal pathogen. For example, the sequence of P. gingivalis and P. gluae shows very high similarity. In the present condition, the specificity of the detection of the species by the authors was not clear. Authors should describe the specificity of the primers used in this study.

Answer & Correction: We appreciate this point of specific comment asking us to provide the qPCR specificity/sensitivity data with the primer/probe set designed for this study. Accordingly, we provided additional data regarding the specificity/sensitivity test results in the Supporting Information section.

In the Supporting Table S1 and S2, Porphyromoas gulae, the putative periodontopathic bacteria in dogs, was newly included to show the differential detection ability of the qPCR with the primer/probe set designed for specific detection of P. gingivalis (the human periodontopathic bacteria) in the subgingival plaque samples of dogs (Please see the highlighted portion of the tables).

In the revised manuscript, page 9, we added sentence “The qPCR performed with the primer-probe sets used in this study are as shown in the Table 1, and the data for assessment of specificity and sensitivity of the primer-probe sets detecting 11 bacteria from the subgingival plaques of dogs can be found in Supporting Information section.”

2. Author showed the number of each organism in this paper. In the present condition, the percentage of the total microorganisms is unclear. It is helpful to understand the

� 

Answer : In the present study, the total number of samples is 336, and the detection rate for each bacteria is expressed by dividing the number of samples detected for each bacteria. For example, in Figure 2, 5/336=1.49% of samples in which Aa: Aggregatibacter actinomycetemcomitans was detected among 336 samples were indicated.

3. In the prevalence of the pathogen in the present study is significantly difference especially in P. gingivalis and A. actinomycetemcomitans. Authors mentioned about the condition of the disease such as PD3, PD4 for the comparison. The microflora changed according to the age and type of dog. Authors had better to include the condition of the dog for comparison of the prevalence.

Answer: As mentioned in Table 2, the age, sex and weight of dogs under the reversible and Irreversible groups (PD3, PD4) were compared, but it was stated that there was no statistical difference. (12 pages)

Minor comments

1. Page 4, line 9. … alveolar bone, and gingiva. The description of periodontitis need the reference.

Answer & Correction: References in this content correspond to Reference No. 7 in the current manuscript. Accordingly, references were added to the manuscript and references 6 and 7 were changed.

2. Page 4, line 16-17. However, many studies …disease in dogs [7]. Author only 1 report for the “many studies”.

According to reviewer 1's comment, the sentence has been modified as follows.

�  …..Yamasaki et al evaluated putative pathogens related to periodontal disease in dogs

Reviewer #2:

This manuscript is straightforward and presents data demonstrating a strong association of Treponema denticola to be associated with canine periodontitis. A strength of this manuscript compared to previous literature is the larger sample size and collection of clinical samples from multiple sites around the tooth. Association analysis seems appropriate but the authors need to make sure to not overstate the relevance of this data.

1. The manuscript is fairly well written, but there are still quite a few minor grammatical edits required. Also the authors should refer to " this current study" in places throughout the text of the discussion, as it is not always clear that they are referring to their own data presented in this manuscript.

Answer and Corrections: Since the word "this study" may be confused with the current manuscript, our study was revised as "the current study" or "the present study" in the manuscript.

2. Please clarify method for sample collection and DNA isolation. Were 6 individual paper points used as shown in Figure 1? Were these 6 paper points then pooled together to give 1 sample which was then treated with 180ul lysozyme as indicated the methods?

Answer and correction: Yes, comments from Reviewer 2, the following sentence has been added to the sample collection section. The total number of samples is 336, and the detection rate for each bacteria is expressed by dividing the number of samples detected for each bacteria.

Page 4: Six paper points obtained subgingival plaque from six points around a tooth, and all six paper points were placed in a sterilized sample container, then a unique barcode number was assigned to the sample container and analyzed as one sample

3. Most figures are depicting fold change while Figure 4 indicates absolute numbers of bacteria. indicate in the methods how these values were calculated ( compared to standard curve of each bacteria known numbers?)

If bacterial DNA was directly used ( or bacteria cultured) this information needs to be included.

Answer: As mentioned in Table 2, the age, sex and weight of dogs under the reversible and Irreversible groups (PD3, PD4) were compared, but it was stated that there was no statistical difference. (12 pages)

4. table 4 refers to "each bacterial species" in the title, but only association for Aa and Pg is shown

Answers and corrections: Comments from Reviewer 2 Therefore, the contents of Table 4 have been corrected to the following sentences.

Table 4. Associations between the number of each bacterial species and the reversible and irreversible group and each PD group �  Table 4. Relatively very low reliability of Aa and Pg in the Associations between the number of each bacterial species and the reversible and irreversible group and each PD group

Answers and corrections: In accordance with the amendments to Table 4, the relevant sentences in the document have been corrected to the following sentences.

Statistical methods were used to analyze associations between periodontal conditions and the number of bacteria using various comparisons (Table 4). �  Statistical methods were used to analyze associations between periodontal conditions and the number of bacteria using various comparisons (Table 4)

5. THE methods do refer to the number of total dogs studied yet There is no mention of the number of animals that were divided into each classification group ( ie. PD1, Pd2 etc). How many animals were in the PD and P1 group ( reversible) or the PD2. Pd3 and Pd4 group ( irreversible). Were these classifications of the clinical sample collected made on each tooth collected or the overall radiographic appearance of the animal?

� 

Answers and correction : The following was added to the results section.

Page 13: …... Of the total 336 samples, 190 samples (PD0, 70; PD1 120 samples) were classified into the reversible group, and 146 samples (PD2, 77; PD3, 34; PD4, 35 samples) were classified as the irreversible group.

Reviewer #3:

The manuscript presents an original and interesting point of view of the study of microbiota in canine periodontitis. My overall impression is that the section results is too long, and some parts should be deleted, considering that same data are presented also in the tables and figures.

Specific comments:

Table 1 could be moved to supplementary material.

Answer: If “Table 1” is not an issue for publication, we would like to leave it in the main manuscript.

Table 2, title ( and also headline in the results): “donated” is not appropriate, please substitute.

Answers and corrections: As the reviewer's advice, the following corrections were made: “Table 2. Characteristic profiles of dogs that provided the subgingival plaque sample”

Figures: it is not necessary to comment the results. So delete sentences: Figure 2, legenda: , starting from Fn, Pn, etc

Answers and corrections: The part mentioned by the reviewer has been deleted.

Fig. 3: please delete last sentence, starting from Treponema denticola

Answers and corrections: The part mentioned by the reviewer was deleted and merged into a part of the related manuscript.

Fig 4: delete 3 sentences, starting from The mean number

Answers and corrections: The part mentioned by the reviewer has been deleted.

Fig 5: delete starting from mean numbers

Answers and corrections: The part mentioned by the reviewer has been deleted.

Submitted filename: Response to Reviewer_R1_F.docx

Click here for additional data file.

7 Jan 2022

Treponema denticola as a prognostic biomarker for periodontitis in dogs

PONE-D-21-24139R1

Dear Dr. Lee,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Catherine A. Brissette, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

12 Jan 2022

PONE-D-21-24139R1

Treponema denticola as a prognostic biomarker for periodontitis in dogs

Dear Dr. Lee:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Catherine A. Brissette

Academic Editor

PLOS ONE