Literature DB >> 35061661

Single-cell sequencing reveals lineage-specific dynamic genetic regulation of gene expression during human cardiomyocyte differentiation.

Reem Elorbany1, Joshua M Popp2, Katherine Rhodes3, Benjamin J Strober2, Kenneth Barr3, Guanghao Qi2, Yoav Gilad3,4, Alexis Battle2,5,6.   

Abstract

Dynamic and temporally specific gene regulatory changes may underlie unexplained genetic associations with complex disease. During a dynamic process such as cellular differentiation, the overall cell type composition of a tissue (or an in vitro culture) and the gene regulatory profile of each cell can both experience significant changes over time. To identify these dynamic effects in high resolution, we collected single-cell RNA-sequencing data over a differentiation time course from induced pluripotent stem cells to cardiomyocytes, sampled at 7 unique time points in 19 human cell lines. We employed a flexible approach to map dynamic eQTLs whose effects vary significantly over the course of bifurcating differentiation trajectories, including many whose effects are specific to one of these two lineages. Our study design allowed us to distinguish true dynamic eQTLs affecting a specific cell lineage from expression changes driven by potentially non-genetic differences between cell lines such as cell composition. Additionally, we used the cell type profiles learned from single-cell data to deconvolve and re-analyze data from matched bulk RNA-seq samples. Using this approach, we were able to identify a large number of novel dynamic eQTLs in single cell data while also attributing dynamic effects in bulk to a particular lineage. Overall, we found that using single cell data to uncover dynamic eQTLs can provide new insight into the gene regulatory changes that occur among heterogeneous cell types during cardiomyocyte differentiation.

Entities:  

Mesh:

Year:  2022        PMID: 35061661      PMCID: PMC8809621          DOI: 10.1371/journal.pgen.1009666

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   6.020


Introduction

A primary aim of human genetics and genomics is to understand the genetic architecture of complex traits. Current studies demonstrate that the majority of trait-associated genomic loci are in non-coding regions of the genome, and are thought to be involved in gene regulation [1]. Therefore, studies exploring gene regulation are essential to our understanding of complex phenotypes [2,3]. Studies mapping expression quantitative trait loci (eQTLs), identifying genetic variants associated with gene expression levels, reveal the impact of genetic variation on gene regulation and can inform molecular mechanisms underlying trait-associated loci. eQTLs have now been identified for a wide variety of tissues, and their study has contributed to the understanding of gene regulation and disease [4-10]. Gene regulation, including genetic regulation of gene expression, can vary between contexts including different cell types, temporal stages, and environmental stressors. Particular attention has been paid to differences in gene regulation between tissues and cell types. Large studies including the Genotype-Tissue Expression Project (GTEx) have been now been successful in identifying thousands of eQTLs in diverse human tissues [4,11]. However, despite these efforts, we are still unable to identify a regulatory mechanism for the genetic contribution of a majority of disease-associated loci [12-16]. One reason for this knowledge gap may be that most large-scale eQTL studies are based on expression data from adult, bulk tissue samples that do not represent the specific cell types and contexts in which disease-relevant dysregulation occurs [17]. Recent advances in single-cell sequencing have allowed us to assay gene expression in individual cells, allowing us to access disease relevant cell types and cell states, even if they compose a small fraction of a tissue and would not be well captured by bulk data, and even if they are not known a priori. Indeed, single cell datasets have revealed a more complex landscape of gene expression in individual cell types than previously known in tissues such as brain and kidney [18,19]. Likewise, mapping eQTLs from single-cell RNA-sequencing data promises to enable the identification of previously undiscovered disease-relevant regulatory mechanisms. Recently, collection and analysis of population-scale scRNA-seq datasets have demonstrated that genetic effects do vary between cell types belonging to the same tissue [20-22]. Beyond cell-type specificity, only a small number of studies have attempted to characterize dynamic gene regulatory changes that occur during development or among contexts that change over time [23-30]. These have highlighted temporally specific eQTL effects that were not evident from static data. Studying the temporal dynamics of gene expression has the potential to uncover genomic loci involved in gene regulation during developmental processes and identify associations that were previously overlooked. Accordingly, we previously studied genetic effects on the regulation of gene expression during the differentiation of induced pluripotent stem cells (iPSCs) to cardiomyocytes [23]. We collected time-series bulk RNA-seq data for nineteen individuals to identify hundreds of eQTLs displaying dynamic, and sometimes transient effects on expression across the course of cardiomyocyte differentiation. These dynamic eQTLs included genetic variants which were associated with cardiovascular disease-related traits, including obesity. However, the complexities of cardiomyocyte differentiation and other dynamic processes are not fully captured by bulk RNA-seq data even in a time course study design. During development and differentiation, expression profiles change over time in individual cells along a spectrum of maturity [31]. Cells within a single sample do not necessarily differentiate at the same rate, along the same trajectory, or even toward the same terminal cell type. Different cell lines may also vary in the proportion of cells in different states at each time point. Indeed, in our previous work, we identified two clusters of cell lines undergoing cardiomyocyte differentiation that exhibited broad differences in the expression trajectory of groups of genes over time [23]. Bulk expression profiles represent an average across cells from various points across a developmental landscape, obscuring the underlying variation in cell state, and even making it difficult to definitively attribute differences to cis-regulatory genetic effects. Recent work has demonstrated that the improved resolution of single-cell RNA-seq data can identify homogeneous subpopulations of cells at similar stages of differentiation, offering a clearer view of genetic regulation in an individual time step [32,33]. However, such analysis has only been applied to a few cell types, not including cardiomyocytes, and has been limited to the study of dynamics within a single lineage. In this study, we applied single-cell RNA-seq to the nineteen cell lines assayed in our previous bulk RNA-seq analysis, collecting single-cell data at seven informative time points during cardiomyocyte differentiation, enabling us to observe cell-type specificity, cell composition differences, and temporal changes together in a unified experiment. The resolution of this single cell data enables us to characterize the cardiomyocyte differentiation landscape in much greater detail than was possible in bulk. We identify a bifurcation in cell fate, which explains the previously observed clustering of cell lines and enables us to study genetic regulatory dynamics along two distinct trajectories with a single experiment. Characterization of these trajectories allows us to reanalyze existing bulk samples and mitigate confounding impact of cellular composition and identify dynamic effects specific to each lineage [22,34].

Results

We differentiated induced pluripotent stem cells (iPSCs) from 19 human cell lines into cardiomyocytes; these same cell lines were previously used for a cardiomyocyte time course study published in Strober et al 2019 [23]. For the current study, we used new iPSC cultures of the same lines, and differentiated them again to cardiomyocytes. We used Drop-seq to collect single-cell RNA-seq data at 7 days throughout the 16-day differentiation time course. We chose to collect data from days 0 (iPSC), 1, 3, 5, 7, 11, and 15 (cardiomyocyte), as we have previously observed that these days represent the most informative stages during this particular differentiation trajectory [23,35]. We collected single-cell data using a balanced study design in which each collection included three individuals at three unique differentiation time points. While cells from the same cell line and differentiation day have similar expression profiles, likely due to biological factors, this study design minimizes technical effects associated with collection batch ( and Materials and Methods). After filtering data from low quality cells (Materials and Methods), the resulting 131 samples contained an average of 1,762 cells per sample and an average of 1,375 genes detected as expressed per cell. Following normalization, a principal component analysis revealed that, as expected, differentiation day is the primary axis of variation in the single cell gene expression data ().

Differentiation progress and cell line differences drive variation in gene expression

In order to characterize the complex landscape of cardiomyocyte differentiation, we used UMAP to produce a low-dimensional embedding of the single cell data while preserving global structure. We found that while cells from the early days of the differentiation time course exhibited fairly uniform transcription profiles, this was less true for later days (days 7, 11, and 15; and ). Marker genes known to be expressed at various stages in cardiac differentiation, from iPSC to mesoderm to cardiomyocyte, showed high expression at expected early, intermediate, and late stages of the differentiation time course, respectively ( and ). Next, we used unsupervised clustering to partition cells into clusters, and matched cell clusters to known cell types based on expression of known marker genes (, Materials and Methods, [36]). While these discrete cell type assignments are imperfect as they fail to capture the continuity of the differentiation process, they are useful in characterizing the broad relationships between groups of cells. As suggested by previous reports [23,35], we identified a bifurcation in the differentiation landscape, giving rise to two distinct terminal cell types. One of these terminal cell types has high expression of genes known to be involved in cardiomyocyte function, such as TNNT2 and MYL7 (, [37,38]). Cells in the other terminal cell type do not express cardiomyocyte markers, and instead have high expression of genes such as COL3A1 and VIM, which are expressed in the extracellular matrix of cardiac fibroblasts [39,40]. The differentiation outcome of each sample, namely the proportion of cells in each cluster, varied by individual cell line; certain lines differentiated primarily into either the TNNT2-expressing or the COL3A1-expressing terminal cell type clusters (Figs and ). For the remainder of this paper, we will refer to the TNNT2-expressing cell cluster as cardiomyocytes (CM) and to the COL3A1-expressing cluster as cardiac-fibroblasts (CF) or fibroblast. We also identified a cluster that underexpressed marker genes of cardiac cell types throughout the differentiation process, and instead expressed several endoderm-specific markers such as APOA1 and AFP. We were unable to fully characterize this cluster based on expression patterns alone, and omitted these cells from downstream investigation of the dynamics of gene regulation on gene expression during mesoderm and cardiac cellular differentiation ().

Gene expression patterns in single cell data.

(A) UMAP of full single cell dataset; cells are colored by differentiation day. (B) Estimated density of expression for several marker genes across cells. (C) UMAP of full single cell dataset; cells are colored by cell type, assigned based on Leiden clustering and marker gene expression. IPSC = induced pluripotent stem cell, MES = mesoderm, CMES = cardiac mesoderm, PROG = cardiac progenitor, CM = cardiomyocyte, CF = cardiac fibroblast, UNK = unknown cell type. (D) Proportion of cells belonging to each cell type per differentiation day, across all cell lines. (E) Distribution of L1TD1 (pluripotency marker), TNNT2 (cardiomyocyte marker) and COL3A1 (cardiac fibroblast marker) over cells from 6 representative examples of the 19 cell lines studied, for each of the 7 differentiation days.

Single-cell expression data resolves bifurcating trajectories during cellular differentiation

In previous work, we investigated the relationship between genotype and chronological time, represented by the differentiation day in which each bulk sample was collected. However, chronological time may not properly capture the axis of variation along which genetic regulation is changing, and can be heavily confounded by heterogeneity in differentiation within and between samples. If cells within a sample progress through differentiation at different rates, their aggregated expression profile will not be truly reflective of an individual stage of differentiation, confounding tests for association between genotype and differentiation progress. Systematic differences between cell lines can exaggerate this: differentiation speed appears to vary between cell lines (Fig 1E), such that differentiation progress at day 3, for example, is not uniform across samples. Such differences can lead to false associations between genotype and differentiation progress in cases where genotype is partially correlated with a cell line’s differentiation speed.
Fig 1

Gene expression patterns in single cell data.

(A) UMAP of full single cell dataset; cells are colored by differentiation day. (B) Estimated density of expression for several marker genes across cells. (C) UMAP of full single cell dataset; cells are colored by cell type, assigned based on Leiden clustering and marker gene expression. IPSC = induced pluripotent stem cell, MES = mesoderm, CMES = cardiac mesoderm, PROG = cardiac progenitor, CM = cardiomyocyte, CF = cardiac fibroblast, UNK = unknown cell type. (D) Proportion of cells belonging to each cell type per differentiation day, across all cell lines. (E) Distribution of L1TD1 (pluripotency marker), TNNT2 (cardiomyocyte marker) and COL3A1 (cardiac fibroblast marker) over cells from 6 representative examples of the 19 cell lines studied, for each of the 7 differentiation days.

Cellular heterogeneity drives further challenges when aggregating across cells that are differentiating along diverging paths. Aggregated bulk profiles will lose information about the individual cell types present, and if cell type composition varies between individuals (Fig 1E), this will further confound associations between genotype and expression changes during differentiation. By collecting expression at the single-cell level, we are able to address both of these challenges. To properly focus on the two primary cardiac lineages present, we used the scanpy package to produce a low-dimensional Force Atlas embedding of the cells that had been successfully assigned to a known cell type (, Materials and Methods, [41,42]). We inferred pseudotime for each cell with diffusion pseudotime [43,44], so that progress through differentiation is learned from cells’ individual expression profiles rather than their time of collection (). We performed trajectory analysis using PAGA [44] to examine the relationships between the cell types present in this dataset, which helped to resolve two distinct lineages present in the data, giving rise to cardiomyocyte and cardiac fibroblast cell types ().

Pseudotime inference and pseudobulk aggregation.

(A) Force atlas embedding of all cells from the two cardiac differentiation lineages combined, colored by cell type. IPSC = induced pluripotent stem cell, MES = mesoderm, CMES = cardiac mesoderm, PROG = cardiac progenitor, CM = cardiomyocyte, CF = cardiac fibroblast, UNK = unknown cell type. (B) Force atlas embedding from (A), colored by log2(pseudotime+1), which was inferred for each cell shown using diffusion pseudotime. (C) Distribution of normalized expression of TNNT2, a cardiomyocyte marker gene, across cells from the cardiomyocyte lineage for each differentiation day. (D) Normalized TNNT2 expression across cells from each of 16 pseudotime quantile bins along the cardiomyocyte trajectory. (E) Normalized expression of COL3A1, a cardiac fibroblast marker, across cells from the cardiac fibroblast lineage for each differentiation day. (F) COL3A1 expression across cells for 16 pseudotime quantile bins along the cardiac fibroblast trajectory. One disadvantage to single-cell data compared to bulk is that single-cell measurements are more sparse and noisy: by aggregating over cells, bulk RNA-sequencing reduces noise, which makes expression measurements more tractable for eQTL calling. This introduces a tradeoff between the flexibility of analysis at the single cell level, where we can explore a broader range of dynamic effects among finely resolved pseudotimes or cell populations, and the robustness of analysis on aggregated data [45]. To balance this tradeoff, we partitioned cells from each lineage into pseudotime bins, pooling information across cells to mitigate the noisiness of single cell expression measurement while maintaining homogeneous populations of cells through lineage subsetting and pseudotime binning. Cells were assigned based on the trajectory analysis to the cardiomyocyte lineage, the cardiac fibroblast lineage, or both in the case of precursor cell types. This aggregation scheme enables us to produce a greater number of samples, as we are no longer constrained to the 7 days when experimental collection was performed, while maintaining the expected trends of lineage-specific marker gene expression over pseudotime ().

Mapping of dynamic eQTLs

We applied a Gaussian linear model to the aggregated single-cell pseudo-bulk data based on pseudotime bins from each lineage to identify dynamic eQTLs, namely variant-gene pairs in which the interaction effect of genotype and differentiation time is significantly associated with changes in gene expression. We identified linear dynamic eQTLs for 357 genes in the cardiomyocyte lineage (q < 0.05) and 903 genes in the cardiac fibroblast lineage (Materials and Methods; ). The difference in the number of dynamic eQTLs detected between the two lineages may arise due to greater heterogeneity among predominantly cardiomyocyte samples, or from a difference in the number of cells captured (45,980 cardiac fibroblasts versus 21,862 cardiomyocytes) leading to more precise pseudobulk expression profiles in predominantly cardiac fibroblast samples. We found that both lineage specificity and the replacement of real chronological time with pseudotime improved power for dynamic eQTL detection: using chronological differentiation day as the time variable identified only 142 and 29 dynamic eQTLs for the cardiomyocyte and cardiac fibroblast lineages, respectively. Using differentiation day as the time variable and omitting lineage specificity altogether identified only 5 dynamic eQTLs in the pseudobulk data. For comparison, an analysis of static (non-dynamic) eQTLs using the mashr framework [46], which similarly aggregated pseudobulk by cell line and differentiation day, revealed 183 static eQTLs (Materials and Methods).

Comparison of linear dynamic eQTL calling methods.

We report the number of linear dynamic eGenes (genes with a significant dynamic eQTL at gene-level q-value < = 0.05), for each of the aggregation schemes assessed. Total number of genes tested and total number of tests run are also reported. Ultimately, our lineage subsetting and pseudotime approach revealed slightly more dynamic eQTLs than were previously identified in an experiment with bulk collections at over twice as many time points [23]. To ensure a meaningful comparison, we re-processed the previously collected bulk data in a similar pipeline as pseudo-bulk, accounting for changes in hypothesis testing and filtering of variant-gene pairs (Materials and Methods). This revealed a total of 1028 genes with a dynamic eQTL (compared to a total of 1056 genes detected between both lineages with pseudobulk binned to a similar number of samples; ). When the bulk data was subset to the same 7 collection time points used for the single cell experiment, only 210 dynamic eGenes were detected. The increased detection rate offered by the pseudobulk analysis may stem from increased homogeneity of cellular populations that undergo pseudobulk aggregation, as well as improved measurement of differentiation progress achieved by using cellular pseudotime rather than sample collection time. We investigated several potential sources of confounding in this analysis. First, we assessed calibration of dynamic eQTL calling by permuting the pseudotime variable in the interaction term before calling dynamic eQTLs, which did not reveal evidence of substantial inflation (Materials and Methods, ). Second, we investigated the possibility that broad differences between cell lines, such as variation in differentiation speed or trajectory preference, are driving false positive discoveries. We did not find evidence of confounding among dynamic eQTLs, as would be suggested by elevated pairwise correlation of genotype at these loci (Materials and Methods, ). This is likely because regression of cell line principal components (Materials and Methods, [23]) effectively controls for such broad differences (). Third, we checked for type I error inflation due to ’double dipping’, where the hypotheses tested are influenced by analysis of the data itself [47-49], since pseudotime is inferred from single-cell expression data. We demonstrate in simulation that the fixed-effect linear model used in this study was conservative in the presence of multiple measurements per individual and did not lead to type I error inflation, though there may be some loss in sensitivity (Materials and Methods, ). Finally, we investigated the impact of uncertainty in pseudotime estimation by examining the impact of permuting cellular pseudotime before pseudobulk aggregation, which did not suggest inflation (Materials and Methods, ). As an example of the trait relevance of these dynamic eQTLs, one dynamic eQTL variant, rs1234988, has previously been implicated by GWAS to be associated with hypertension (p = 2.5e-35), and was detected as a dynamic eQTL for ARHGAP42, a Rho GTPase which has previously been identified as a critical regulator of vascular tone and hypertension in mice (Figs and , [50,51]). Notably, ARHGAP42 is known to be a smooth-muscle selective Rho GAP, and this dynamic eQTL was exclusively identified in the cardiac fibroblast lineage (Bonferroni-adj. p = 2.4e-5, cardiac fibroblast lineage, adj. p = 0.79, cardiomyocyte lineage). This variant is not detected as a dynamic eQTL without lineage subsetting or pseudotime binning (adj. p = 1). This example illustrates the advantages of incorporating exploratory data analysis in the study of in vitro experimental datasets: while the differentiation procedure used for these experiments was designed to produce exclusively cardiomyocytes, an alternative terminal cell type discovered after exploratory data analysis is able to provide meaningful insight into an additional differentiation process.

Linear and nonlinear dynamic eQTLs.

(A) rs1234988 is a linear dynamic eQTL for ARHGAP42; the effect of genotype (color) on ARHGAP42 expression (y-axis) varies across pseudotime (x-axis). (B) A previously reported genome-wide association study (bottom) showed that hypertension is associated with genotype at the rs1234988 locus, where a dynamic eQTL for ARHGAP42 was identified. (C) rs1814432 is a nonlinear dynamic eQTL for the gene CFC1B. The pseudotime values can be interpreted as intermediate time points with greater resolution than chronological time. We therefore used these values to also identify nonlinear dynamic eQTLs, whose effects vary in a nonlinear way over the course of differentiation, such as presence only at intermediate stages of the differentiation (Figs and S12). We identified 74 nonlinear dynamic eQTL variants for the cardiomyocyte lineage (q<0.05), and 147 for the cardiac fibroblast lineage (Materials and Methods; ). Our time course study design is particularly useful for detecting transient nonlinear genetic effects which may not be found by studying only the initial or terminal cell types of a dynamic process such as differentiation. We examined the extent to which the dynamic eQTLs detected overlapped with eQTLs previously identified in GTEx [4]. After subsetting to gene-variant pairs that were tested in both our data and GTEx, we found that the greatest replication of pseudotime-binned, cardiomyocyte lineage linear dynamic eQTLs occurred in atrial appendage tissue (π1 = 0.50, method described in [52]), while the greatest replication of pseudotime-binned, cardiac fibroblast linear dynamic eQTLs (as well as bulk) occurred in cultured fibroblasts (π1 = 0.47, 0.56 respectively). However, by searching directly for dynamic effects across cell types rather than within a single tissue in isolation, we additionally identify eQTLs which were not found to be a significant eQTL in any tissue in GTEx. After subsetting to variant-gene pairs that were tested in both our data and GTEx, we found that 100 of the 359 (28%) linear dynamic eQTLs in the cardiomyocyte lineage were identified as eQTLs in GTEx. Similarly, only 22 of 75 (29.3%) nonlinear dynamic eQTLs on the cardiomyocyte lineage where previously identified as eQTLs in GTEx. Further classification of these cardiomyocyte lineage nonlinear dynamic eQTLs as "early-acting", "late-acting", "transient" (or "middle"), and "switch" (as in ref. [23]) found that most of these variants (68 of 74) are late-acting, supporting the similar replication rates between linear and nonlinear dynamic eQTLs. Of the five early-acting and transient dynamic eQTLs, none were identified as cis-eQTLs in GTEx.

Deconvolution of bulk RNA sequencing data assigns lineage specificity to dynamic eQTLs

The information about the landscape of cardiomyocyte information obtained through single-cell RNA sequencing can also be applied to improve dynamic eQTL calling in bulk data. For each cell type that we identified in the single cell data, we computed a signature expression profile across the top 300 differentially expressed genes that were also measured in bulk (Materials and Methods). We then used CIBERSORTx to deconvolve our bulk data, assigning to each bulk sample a vector of cell type proportions (Figs and , Materials and Methods, [53]). Deconvolution reveals that cell type heterogeneity is prominent between samples, particularly in days 7–15. This heterogeneity emphasizes the need to account for cell type proportion in measuring genetic regulatory dynamics, as these broad differences between cell lines can drive false positive associations between time and any genotype that is correlated with broad cell type proportion differences between cell lines.

Cell type deconvolution and interaction eQTL calling.

(A) Cell type deconvolution was applied to decompose RNA expression of a mixed sample, aggregated over multiple cell types, into its constituent cell type proportions (Materials and Methods). Each row represents a cell line, collected in two separate experiments. In the left column, bulk RNA-sequencing data was collected for 15 timepoints (time on x-axis). In the right column, pseudobulk was aggregated across cells collected for 7 time points (time on x-axis). For pseudobulk data, deconvolution is not needed, as each cell is assigned to a cell type. Thus, "ground truth" cell type fractions are accessible as reflected here. (B) Number of genes with a cell type interaction eQTL in bulk for each of six cell types. (C-D) CMYA5 has an interaction eQTL for the cardiomyocyte lineage (C) that is not identified in the cardiac fibroblast lineage (D). We then used these cell type proportions to identify cell type specific regulatory effects, based on cell type interaction eQTLs (ieQTLs) for each known cell type that was observed in the single cell data (). Interaction eQTLs for a cell type at an endpoint of the differentiation (iPSC, cardiomyocyte [CM], and cardiac fibroblast [CF]) are analogous to linear dynamic eQTLs, since cellular composition often partially reflects differentiation time. However, this relationship varies between lineages: we find that cardiomyocyte proportion is more correlated with differentiation day than cardiac fibroblast proportion (Pearson’s ⍴ = 0.59 for cardiomyocyte proportion, compared to ⍴ = 0.36 for cardiac fibroblast proportion). Accordingly, we found that CM and CF ieQTLs called with this approach were replicated in the previously used dynamic eQTL calling framework on the same bulk dataset to varying degrees (π1 = 0.84 and 0.43, respectively). This may reflect a fundamental difference between the two differentiation trajectories, if cells within samples which produce primarily cardiac fibroblasts reach maturity more quickly. This hypothesis is supported by the observation that the maximum pseudotime value of the cardiomyocyte lineage is greater than that for the cardiac fibroblast lineage (Fig 2B).
Fig 2

Pseudotime inference and pseudobulk aggregation.

(A) Force atlas embedding of all cells from the two cardiac differentiation lineages combined, colored by cell type. IPSC = induced pluripotent stem cell, MES = mesoderm, CMES = cardiac mesoderm, PROG = cardiac progenitor, CM = cardiomyocyte, CF = cardiac fibroblast, UNK = unknown cell type. (B) Force atlas embedding from (A), colored by log2(pseudotime+1), which was inferred for each cell shown using diffusion pseudotime. (C) Distribution of normalized expression of TNNT2, a cardiomyocyte marker gene, across cells from the cardiomyocyte lineage for each differentiation day. (D) Normalized TNNT2 expression across cells from each of 16 pseudotime quantile bins along the cardiomyocyte trajectory. (E) Normalized expression of COL3A1, a cardiac fibroblast marker, across cells from the cardiac fibroblast lineage for each differentiation day. (F) COL3A1 expression across cells for 16 pseudotime quantile bins along the cardiac fibroblast trajectory.

This approach enables insights that could not be attained using bulk data alone. The use of an expression signature matrix derived from single cell data with multiple terminal cell types allows us to characterize hundreds of lineage-specific effects which were previously obscured in bulk data: we find that many of the CM- and CF-ieQTLs are lineage-specific (78% and 77% respectively), including some which are potentially relevant to heart-related disease. show an example of a cardiomyocyte interaction eQTL for cardiomyopathy-associated protein 5 (CMYA5), a gene which is highly expressed in heart and skeletal muscle and has previously been associated with cardiac hypertrophy [54]. This variant was not previously identified by GTEx as an eQTL for CMYA5. More broadly, these interaction eQTLs showed enrichment for genes related to myogenesis that had not been observed among bulk dynamic eQTLs (p = 7e-4, both CM and CF ieQTL, compared to p = 0.17, bulk dynamic eQTL). This paradigm for analysis is potentially powerful, for example, given bulk data with larger sample sizes or denser time point sampling possible due to lower cost and effort of bulk sequencing, combined with smaller-scale single cell data that offers cell type, lineage, and pseudotime resolution. Given the denser time-point sampling in our bulk data, there are many interaction QTLs that were not detected in the single-cell data alone, or bulk data alone, but enabled by the integration of bulk and single-cell data together.

Discussion

Using iPSCs and their derived terminal cell types, we can identify genetic effects related to dynamic changes in gene expression over time. We used single-cell gene expression data to investigate the effects of gene regulatory and cell type composition changes throughout a cardiomyocyte differentiation time course. Single-cell data enables us to identify cells going down distinct differentiation trajectories, and to deconvolve heterogeneous cell types in matched bulk samples. One question that arises from these single-cell data is the interpretation of distinct differentiation trajectories and potentially different cell types at the end of the time course. We found that, in later stages of differentiation (days 7, 11, and 15), most cells have either high gene expression of cardiac troponin T (TNNT2) and associated genes such as myosin light chain/MYL7, or high gene expression of a collagen-coding gene (COL3A1) and associated genes such as vimentin/VIM, as discovered through a semi-supervised pipeline which includes dimensionality reduction, unsupervised clustering, and visualization of expression patterns for known marker genes (Fig 1B). Cells broadly express either of these gene sets in a mutually exclusive manner, suggesting that these gene sets represent two distinct cell types. The focus of this project was not to fully characterize these cell types, but instead to disentangle the broad effects of cell line differences in differentiation rate/lineage preference from the dynamics of cis-regulation of gene expression. Still, the identity of these terminal cell types and the circumstances in which each trajectory might be favored is an interesting question. These data suggest that there are differences in gene expression trajectory and ultimate cell fate that may arise in response to the same differentiation protocol. The identity of these terminal cell types, and the factors that might cause a cell line to favor one differentiation trajectory and ultimate cell type at the expense of another, are questions that have been explored in previous studies. In a study by D’Antonio-Chronowska et al. [55], embryonic stem cell lines undergoing cardiac differentiation resulted in a heterogeneous cell type population. These cells were identified as either true cardiomyocytes—which exhibit mechanical beating and have high expression of TNNT2—or “epicardium-derived cells” which do not exhibit mechanical beating and have high expression of gene markers such as VIM and TAGLN. The study demonstrated that these two cell types were present in varying proportions in each individual cell line, and suggests that this cell fate decision can be influenced by genetic factors, such as variability in X chromosome gene dosage [55]. The cardiomyocyte and epicardium framework explored by D’Antonio-Chronowska et al. [55] may be useful in understanding the distinct differentiation trajectories present in our cardiac differentiations. The terminal non-cardiomyocyte cells expressing COL3A1 in these samples may represent an endothelial or cardiac fibroblast cell type, which derive from the epicardium cell lineage. Cardiac fibroblasts express gene markers such as collagen and vimentin, which were found to be expressed in the terminal cells of this differentiation trajectory [39,40,56]. The gene expression profile of COL3A1-expressing cells, which includes high expression of genes related to extracellular matrix and physical cellular structure, implies that these terminal cells may be involved in providing some kind of structural support, perhaps as a reinforcement to true beating cardiomyocytes. To determine whether differentiation trajectory and ultimate cell fate decision is influenced by genetic factors, it may be useful to perform cardiomyocyte differentiation with multiple replicates of each cell line, and compare the differentiation trajectories between these replicates. The relatively high correlation between these single-cell RNA-seq samples compared to matched bulk RNA-seq samples of the same cell line [23] suggests that there may be genetic factors involved in this trajectory decision—although more rigorous testing should be performed to investigate this claim. We may also investigate whether subtle systematic differences exist between cell lines even in the iPSC stage (Day 0), and whether these differences correlate with the ultimate trajectory of these cell lines during differentiation. Recent studies have suggested that there may be genes whose expression level at the iPSC stage correlates with downstream differentiation efficiency in a predictable manner [32,33]. Their results suggest that the decision for ultimate cell type trajectories remains consistent within a cell line, and that iPSCs from those cell lines exhibit distinct gene expression profiles that can be used to accurately predict differentiation trajectories even before differentiation begins. This is an intriguing possibility, and more work should be performed to investigate whether the cell lines used here also exhibit distinct gene expression profiles early on that may correlate with the outcomes of any subsequent differentiation. While simulations suggested that inferring pseudotime before testing for dynamic genetic effects did not result in type I error inflation in this case (S10 Fig), the potential pitfalls of this type of ’double dipping’ will remain an important consideration for future analyses and applications. Existing methods which address this type of circularity [49] rely on resampling procedures that pose a bottleneck when combined with rapidly advancing and often computationally expensive unsupervised or semi-supervised machine learning tools, including many popular pseudotime inference tools. All together, the results from this study demonstrate the benefit of using single-cell RNA-sequencing with a balanced time course study design to investigate dynamic gene regulatory differences between individuals during cellular differentiation. Single-cell data offers a high-resolution view of the landscape of differentiation, which we leveraged to infer pseudotime along multiple differentiation trajectories. By isolating axes of variation of cis-regulatory dynamics (pseudotime within a particular lineage, rather than chronological differentiation day), we were able to identify a greater number of dynamic eQTLs with less than half as many collection time points as previous efforts in bulk RNA-seq data. The dynamic eQTLs detected included variants which overlapped known GWAS hits, demonstrating the utility of this approach in identifying causal loci that underlie risk for development of disease. We also used this data to lend new utility to bulk RNA-seq datasets, by assigning lineage specificity to dynamic eQTLs through the use of cell type interaction eQTL calling. While further follow-up studies should be performed to validate the function of these genomic loci and their potential relevance to downstream phenotypes, the dynamic genetic effects identified in this study and the methodology used to identify them provide a resource for investigating mechanisms underlying important biological processes such as cellular differentiation and perturbation response.

Materials and methods

Ethics statement

The cell lines used in this study were obtained from the NHGRI Sample Repository for Human Genetic Research at the Coriell Institute for Medical Research. All samples were collected by the Coriell Institute for Medical Research with written informed consent and with IRB approval. The genetic data used here has previously been made available through the International HapMap Project [57].

Samples

We used induced pluripotent stem cell (iPSC) lines from 19 individuals from the Yoruba HapMap population. These iPSC lines were reprogrammed from lymphoblastoid cell lines and characterized previously [58]. All 19 individuals were female and unrelated. We chose to use only female individuals to avoid introducing additional variance that is not of interest in this study.

iPSC maintenance

Feeder-free iPSC cultures were maintained on Matrigel Growth Factor Reduced Matrix (CB40230, Thermo Fisher Scientific, Waltham, MA) with Essential 8 Medium (A1517001, Thermo Fisher Scientific) and Penicillin/Streptomycin (30002Cl, Corning, Corning, NY). Cells were grown in an incubator at 37°C, 5% CO2, and atmospheric O2. Cells were passaged to a new dish every 3–5 days using a dissociation reagent (0.5 mM EDTA, 300 mM NaCl in PBS) and seeded with ROCK inhibitor Y-27632 (ab120129, Abcam, Cambridge, UK).

Cardiomyocyte differentiation

We differentiated iPSCs using a protocol previously optimized for use with the Yoruba HapMap panel [58]. This protocol implements slight modifications to the cardiomyocyte differentiation protocols from [59] and [36]. Feeder-free iPSCs were seeded onto wells of a 6-well plate and grown for 3–5 days prior to differentiation. When most lines were 70%-100% confluent, E8 media was replaced with “heart media” along with 1:100 Matrigel hESC-qualified Matrix (08-774-552, Corning) and 12uM of GSK-3 inhibitor CHIR99021 trihydrochloride (4953, Tocris, Bristol, UK). “Heart media” is composed of RPMI (15-040-CM, Thermo Fisher Scientific) with B27 Supplement minus insulin (A1895601, Thermo Fisher Scientific), 2mM GlutaMAX (35050–061, Thermo Fisher Scientific), and 100mg/mL Penicillin/Streptomycin (30002Cl, Corning). CHIR99021 is a small molecule that activates WNT signaling and initiates the differentiation on day 0 (after the ‘day 0’ cell collection) [59]. “Heart media” was replaced 24 hours later at day 1 of differentiation. 48 hours later, at day 3 of differentiation, cells were fed with new “heart media” containing 2uM of the WNT inhibitor Wnt-C59 (5148, Tocris) [59]. We cultured cells in Wnt-C59 heart media for 48 hours. At day 5, Wnt-C59 was removed, and base “heart media” was added. “Heart media” was refreshed on days 7, 10, 12, and 14 of differentiation. Cells began spontaneous mechanical beating between days 7 and 13 of differentiation. In some cases, after performing cardiac differentiation, one might choose to perform a post hoc purification process to remove any non-cardiac cell types present at the terminal time point [60]. However, for the purposes of a time course experiment where multiple intermediate time points are assayed, a purification protocol undertaken only at the end of the differentiation would not prove useful; therefore, no cell type purification was performed.

Sample collection and processing

We performed cardiomyocyte differentiations in three total batches of six to seven cell lines at a time. For each batch, cardiomyocyte differentiations were performed with three staggered starting days, such that samples could be collected from each cell line in three differentiation stages at any given time. For all 19 cell lines, samples were collected on differentiation days 0 (iPSC, before treatment with CHIR99021), 1, 3, 5, 7, 11, and 15. Drop-seq collection was performed a total of three collection days for each batch of six to seven cell lines. In the first collection day, samples from all cell lines in the batch were collected for differentiation days 1, 3, and 7. In the second collection day, samples from all cell lines in the batch were collected for differentiation days 5, 7, and 11. In the third collection day, samples from all cell lines in the batch were collected for differentiation days 0 (iPSC), 11, and 15. Through this process, single-cell gene expression data was collected for all cell lines in seven unique time points, with two time points (differentiation days 7 and 11) having two replicates. This staggered differentiation and collection study design was performed to minimize the technical effect of sample collection as a potential confounding variable associated with cell line or differentiation day. To harvest the samples at the start of each collection day, cells in at least two wells of a 6-well culture dish were released from the dish using Accutase (BD Biosciences, San Jose, CA, #561527). Samples were washed three times and resuspended in 1X PBS, 0.01% BSA. Cells were then passed through a 40 um filter to encourage the formation of a single cell suspension. The concentration of each single cell suspension was quantified manually using an NI hemocytometer (INCYTO, Cheonan, Korea, DHC-N01-2). Using a 125 um Drop-seq microfluidic device, single cells were captured in droplets along with a DNA barcoded bead (ChemGenes, Wilmington, MA, Macosko-2011-10(V+)), following the standard Drop-seq protocol [61]. The DNA barcoded beads include a cell-specific barcode so the cell identity of each RNA molecule can be recovered. After Drop-seq collection, the RNA molecules were reverse transcribed, and cDNA amplification was performed according to the Drop-seq protocol. cDNA concentration and library size were measured using the Qubit 3 fluorometer (Thermo Fisher) and BioAnalyzer High Sensitivity Chip (Agilent, Santa Clara, CA, #5067–4626). Library preparation was performed using the Illumina Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). Libraries in each batch were multiplexed together so that every sequencing lane contained three samples, one from each of the three collection days. Each of those samples was itself a multiplexed collection of three individual cell lines at three distinct differentiation time points, which were mixed upon Drop-seq collection. Samples went through paired-end sequencing using the Illumina NextSeq 500. 20 bp were sequenced for Read 1, and 60 bp for Read 2 using Custom Read 1 primer, GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC, according to manufacturer’s instructions [61]. The same multiplexed library pool was sequenced twice with the goal of achieving at least 20 million reads per sample. We recorded 20 technical and biological covariates and measured their contribution to variation in our data ().

RNA-seq quantification

For each sequencing run, we obtained paired-end reads, with one pair representing the cell-specific barcode and unique molecular identifier (UMI), and the second pair representing a 60 bp mRNA fragment. We used dropseqRunner (available at github.com/aselewa/dropseqRunner) which takes a fastq file with paired-end reads as input and produces an expression matrix corresponding to the UMI of each gene in each cell. All RNA-seq samples were aligned to the human genome (GRCh38) using STAR-solo [62]. We used featureCounts [63] to assign each aligned read to a genomic feature, and umi_tools [64] to create a count matrix representing the frequency of each feature in our dataset. We then used the single-cell demultiplexing software ’demuxlet’ to assign to each cell a probability that the cell is a doublet [65]. The following filter was applied to remove 21,725 rare genes (out of 60,668) from downstream analysis: Gene must be detected in at least 10 cells The following filters were then applied to remove 330,750 low-quality cells (out of 564,362) for downstream analysis: Maximum doublet probability of 0.3 from demuxlet Unambiguous assignment of the cell to an individual by demuxlet (maintain cells not assigned to ’doublet_ambiguous’) Maximum of 25% mitochondrial reads Minimum of 300 unique genes detected (of the genes that passed the previous filtering step) Following these filtering steps, an additional 2,826 cells were removed whose feature or read counts were more than 4 standard deviations away from the median. This left a total of 230,786 cells and 38,943 genes for downstream analysis ().

Cell cycle correction and normalization of single-cell expression data with Seurat

We used the Seurat workflow for cell cycle regression in differentiating. Each cell was assigned a score for G2/M phase and S phase according to marker gene expression, and the difference between these scores was regressed out during normalization. The data was then normalized using the SCTransform function in [66,67], producing corrected counts, log-normalized corrected counts, Pearson residuals, and a set of highly variable features. The Pearson residuals of 1,000 highly variable features were scaled so that each gene had unit variance across all cells for downstream analysis.

Dimensionality reduction and clustering with scanpy

Dimensionality reduction, clustering and pseudotime were performed using the scanpy package [41], following Seurat object to h5ad conversion via the sceasy package [68]. The scaled Pearson residuals from 1000 highly variable features were used to compute 50 principal components (PCs), which were then embedded into a 2D UMAP plot (Fig 1A and 1C). These 50 PCs were also used to produce a neighborhood graph, and Leiden clustering was performed at resolution 0.35 to produce the clusters shown in Fig 1C. (Several clusters are merged into the unknown cell type, as described below).

Lineage specification and pseudotime inference

Based on marker gene expression patterns (Fig 1B), 6 of the 10 Leiden clusters were annotated with known cell types. To facilitate trajectory reconstruction, 3 outlier clusters with less than 5,000 cells were removed. Cluster 7 contained a group of cells which did not express marker genes for cardiomyocytes or progenitor cell types, and instead expressed a group of genes that are specifically expressed in hepatocytes, a cell type stemming from the endoderm layer rather than the mesoderm layer. This small population of cells drove a significant amount of variation in the data (S4 Fig), making it difficult to properly resolve the mesoderm-specific lineages that were the focus of this project. For this reason, the cells assigned to one of the mesoderm-specific lineages (clusters 1–6) were used for downstream analysis (a UMAP embedding of the subset data is shown in ). The log-normalized gene expression was re-centered and re-scaled, and PCA was re-run on specifically these cells to properly focus on the variation among the lineages of interest. The top 3 re-computed PCs were used to calculate a new neighborhood graph, which was used to compute a new embedding to visualize specifically the two cardiac-related differentiating lineages (Fig 2A). The bifurcation into separate cardiac fibroblast and cardiomyocyte lineages can clearly be observed in the PAGA plot (S5 Fig), which was created with the previously described cell type annotations, the re-computed neighborhood graph, and an edge weight threshold of 0.15. This PAGA embedding was used to define the two lineages used for downstream lineage isolation tasks, where all iPSC, mesoderm, cardiac mesoderm, and cardiac progenitor cells are assigned jointly to both lineages, while cardiomyocyte and cardiac fibroblast (terminal cell types) are unique to their corresponding lineage. Finally, four diffusion components were computed from the new neighborhood graph, and diffusion pseudotime was used to assign pseudotime values to cells from both cardiac lineages.

Influence of batch on cell type composition

If a group of cells from the same batch are more likely to display similar cell type composition than cells from different batches, this could indicate that batch effects are confounding cell type annotation. However, since the experimental design places cells from the same cell line and differentiation stage in the same batch, it is important to disentangle similarity in cells due to the same cell line/ differentiation stage (a likely biological effect) from similarity in cells due to batch (a primarily technical effect; see S1 Fig). To do this, we grouped cells by cell line and differentiation day (called a ‘sample’ here), and summarized each group by their cell type proportions. As indicated in , each batch contains three different samples representing a different cell line/differentiation day combination. We focused on the impact of batch on terminal cell type composition by analyzing samples from collection day 3 that had been differentiating for 11 or 15 days. At these time points, terminal cell types (cardiomyocyte, CM, and cardiac fibroblast, CF) make up a majority of the cells present. Based on the experimental design, we have 19 pairs of samples such that one sample is at differentiation day 11, the other is at day 15, and the two samples belong to the same batch. If batch effects are causing cells from the same batch to receive similar terminal cell type labels, we would expect these sample pairs to display greater similarity of cell type proportion compared to a background of sample pairs from distinct batches matched for differentiation day. We computed pairwise differences in cell type proportion for both cardiomyocyte and cardiac fibroblast cell types, and compared these to a background (day 11 and day 15 samples from distinct batches) using a t-test. This analysis indicated that samples from the same batch are not more likely to display similar cell type composition than cells from different batches when controlling for cell line and differentiation day (CM p = 0.286, CF p = 0.446).

Pseudobulk expression aggregation and normalization

Although the noisiness of single cell expression profiles necessitates aggregation across cells before dynamic eQTL calling, an improved understanding of the differentiation landscape allows us to pursue an aggregation strategy that mitigates the confounding impact of cellular composition differences and offers greater power than dynamic eQTL calling on bulk samples. Three pseudobulk aggregation schemes were used in this study: Chronological differentiation day binning—This strategy is most directly comparable to bulk RNA-sequencing. Aggregation is performed by taking the sum of SCTransform-corrected counts from all cells from the same differentiation day and individual. Lineage subsetting—Differentiation day binning was performed within each lineage separately. As evidenced by the PAGA graph, all cells up to the progenitor cell type (PROG) are assigned to both lineages, only cells from the terminal cell type (cardiomyocyte or cardiac fibroblast) are unique to one lineage or another. Lineage subsetting & pseudotime binning—After lineage subsetting, cells are partitioned into 16 quantile bins according to pseudotime. We chose 16 bins in order to directly compare to our previous 16 time-point bulk experiment (see ). Aggregation then consists of the sum of SCTransform-corrected counts from cells within the same cell line and pseudotime bin. After pseudobulk aggregation, low-depth samples with library size less than 10,000 were filtered out. In this dataset, this cutoff was equivalent to removing samples with less than or equal to 50 cells. This removed 15 samples from the pseudotime-binned cardiac fibroblast lineage, all corresponding to pseudotime bins 14 or 15 (7 individuals were filtered out of both bins altogether, and one additional individual had only bin 15 filtered out). In the pseudotime-binned cardiomyocyte lineage, this filtered out 5 samples. Remaining samples underwent TMM normalization with singleton pairing through the edgeR package so that expression could be compared across samples for dynamic eQTL calling [69,70]. We then transform the TMM-normalized counts into compute counts per million (CPM) for each sample, and apply log normalization (with the edgeR package, which uses an approach to pseudocount addition that is adapted for library size). These logCPM expression values are used for QTL calling.

Bulk expression normalization

In order to properly compare bulk RNA-seq data to our pseudobulk data, we reprocessed the bulk data from a previous experiment in a way that is intended to most closely match the logcpm pseudobulk expression. For this reason, we used transcripts per million (TPM) instead of previously used reads per kilobase of transcript, per million mapped reads (RPKM). For each sample, we first divided each gene’s counts by the length in kilobase to compute reads per kilobase (RPK), and then fed these adjusted expression values into the same normalization pipeline as was used for pseudobulk counts (which are not biased by gene length)—TMM normalization with singleton pairing and logCPM adjustment, with the edgeR package. Since the input was reads per kilobase rather than counts, this gives logTPM expression values for use in QTL calling.

Sample PCA

To identify primary sources of variation between samples, we ran principal component analysis (PCA) on the gene expression matrix for pseudobulk data. The first principal component is correlated with differentiation time (). For the top 10 PCs, we calculated the percent variance explained of each principal component by each technical factor recorded during sample collection (S14 Fig).

Cell line collapsed PCA

To perform dynamic eQTL calling, we search for changes in gene expression over time that are correlated with a specific genotype. This can be confounded by broad differences between cell lines across the differentiation time course, such as differences in differentiation speed, lineage preference, or technical factors. For example, assume cell lines with genotype G at locus i generally have increasing proportions of cardiomyocytes over time, while cell lines with genotype C at locus i have increased proportions of cardiac fibroblasts over time. In this case, any gene whose expression is upregulated in cardiomyocytes will appear to have a dynamic eQTL at locus i, regardless of any cis-regulatory dynamics related to that gene, which constitute the intended focus of this study. With single-cell data, we are able to more directly account for some of these factors, namely differentiation speed (with pseudotime binning) and lineage preference (with lineage subsetting). However, it remains useful to control for any broad cell line differences in this more unsupervised fashion, as any broad effects could drive false positive QTL detection. We used a “cell line collapsed PCA” approach to identify such patterns across the entire time course [23]. To identify cell line collapsed PCs, we rearranged the gene expression matrix from the standard pseudobulk expression quantification such that each row represented expression from one cell line and each column represented a gene at a single time point. After standardizing each column to have zero mean and unit variance, we applied PCA to this matrix to learn a low dimensional representation. Each cell line has a shared loading across all time points, and PCs reflect broad differences in the way cell lines proceed through differentiation. For example, in bulk, it appears that the first cell line PC picks up on differences in differentiation speed between cell lines, while the second cell line PC picks up on differences in terminal cell type preference as defined as the highest total cell type proportion among days 10 to 15 (S9 Fig).

Genotype data

We used previously collected and imputed genotype data for the 19 Yoruba individuals from the HapMap and 1000 Genomes Project [71]. For eQTL analyses, we filtered to variants with no missingness and a minor allele frequency of at least 0.1 across the 19 individuals present.

Dynamic cis-eQTL test selection

We selected which genes to check for dynamic eQTLs based on the following filters: Gene must have at least 0.1 CPM in at least 10 bulk/pseudobulk samples Gene must have at least 6 counts (reads) in at least 10 samples Both of these filters were applied separately for each aggregation scheme. We tested all variants within 50kb of the transcription start site of each gene. Transcription start sites were obtained from Gencode’s release 37 [72], basic gene annotation, and matched to mapped genes by Ensembl gene ID. The total number of tests is presented alongside the number of dynamic eQTLs detected in Tables 1 and S2.
Table 1

Comparison of linear dynamic eQTL calling methods.

We report the number of linear dynamic eGenes (genes with a significant dynamic eQTL at gene-level q-value < = 0.05), for each of the aggregation schemes assessed. Total number of genes tested and total number of tests run are also reported.

Dataset Aggregation Time Points Lineage Linear Dynamic eGenes Detected Total # Genes Tested Total # Tests
PseudobulkPseudotime16CM3578,9691,601,727
PseudobulkPseudotime16CF9039,1401,633,408
PseudobulkDifferentiation Day7CM1429,5411,693,532
PseudobulkDifferentiation Day7CF1009,5481,711,693
PseudobulkDifferentiation Day7Combined59,6561,731,798
BulkDifferentiation Day7Combined21010,7721,963,378
BulkDifferentiation Day16Combined102810,9811,991,072

Linear dynamic eQTLs using single-cell pseudobulk data

Linear dynamic eQTLs are cis-eQTLs whose effects are linearly modulated by differentiation time. We detected linear dynamic eQTLs with a Gaussian linear model that quantified the interaction between genotype and differentiation time on gene expression, while controlling for the linear effects of both genotype and differentiation time. We also controlled for linear effects of the first five cell line collapsed PCs (see below). Following the method used in [23], we built a separate linear model for each tested variant-gene pair. Specifically, let t denote the time point (or, for pseudotime binning, the median pseudotime value across cells constituting the pseudobulk sample) of the current sample, c denote the cell line of the current sample, T denote the total number of time points, and C denote the total number of samples. E∈R denotes the standardized expression matrix for the current gene, G∈R denotes the dosage based genotype vector for the current variant, and PC∈R denotes the Kth cell line collapsed PC vector. We modeled the expression levels as follows: We used lmFit from the limma package to fit this model, and used a t-test to measure the significance of the genotype and time coefficient (β13). Bonferroni correction was applied to account for multiple SNPs being tested per gene, and Storey’s q-value was used to control false discovery rates at the gene level, after selecting the most significant dynamic eQTL per gene [73]. Model diagnostics with partial regression and partial residual plots for the example linear dynamic eQTL in Fig 3A are shown in S12 Fig [74].
Fig 3

Linear and nonlinear dynamic eQTLs.

(A) rs1234988 is a linear dynamic eQTL for ARHGAP42; the effect of genotype (color) on ARHGAP42 expression (y-axis) varies across pseudotime (x-axis). (B) A previously reported genome-wide association study (bottom) showed that hypertension is associated with genotype at the rs1234988 locus, where a dynamic eQTL for ARHGAP42 was identified. (C) rs1814432 is a nonlinear dynamic eQTL for the gene CFC1B.

Nonlinear dynamic eQTLs using single-cell pseudobulk data

To detect dynamic eQTLs whose effect size changes non-linearly with time, we used a second order polynomial basis function over time, which alters the above linear dynamic eQTL model as follows: Once again, time is either time of collection, or median pseudotime of the sample. As before, we used lmFit from the limma package to fit this model, and this time used a similar t-test to measure the significance of the genotype and quadratic time coefficient (β20). Multiple testing correction was applied as with linear dynamic eQTL calling. Model diagnostics with partial regression and partial residual plots for the example nonlinear dynamic eQTL in Fig 3C are shown in S12 Fig [74].

Control experiments

We assessed calibration of our dynamic eQTL calling methods with permutations. If we permute the time variable in the interaction term, we do not expect this term to properly capture interactions between genotype and time. For each variant-gene pair, we performed an independent permutation of the time variable in the interaction term, across all (cell line, day) samples. The results of this analysis are shown in S7 Fig. As another check for confounding factors, we explored the possibility that broad differences between cell lines, such as variation in differentiation speed or trajectory preference, are driving false positive discoveries. If a pair of cell lines share properties such as trajectory preference that confound eQTL analysis, variants where those cell lines share genotype would be more likely to appear as dynamic eQTLs. If this is the case, we would expect pairwise correlation between cell lines according to genotype, across the top 200 dynamic eQTLs, to be higher than expected by chance (compared to a background set of random loci matched for minor allele frequency and distance to transcription start site), as these false dynamic eQTLs are not in fact picking up on distinct cis regulatory patterns but broad cell line patterns. This type of elevated correlation was not observed, suggesting that cell line PCA adequately controls for broad cell line differences (S8 Fig). We also permuted pseudotime across all cells to investigate sensitivity to uncertainty surrounding pseudotime binning and variation in pseudobulk library sizes. For each of 100 cell-level permutations, we aggregated pseudobulk by the permuted pseudotime quantile bins, and performed dynamic eQTL calling. We used the absolute value of the resulting t-statistics to generate an empirical null distribution for each gene. The empirical p-values generally agreed with the original results up to the significance threshold imposed by the number of permutations performed (p = 0.01, -log10(p) = 2). These results do not suggest inflation of the nominal p-values from the original analysis, and were in fact less conservative than the p-values obtained using Student’s t-distribution (S11 Fig).

Simulations to examine type I errors due to ’double dipping’

We conducted simulations to evaluate potential type I error inflation caused by selective inference. We simulated gene expression data from the following linear mixed model: Here Y is the expression of gene k in cell j of individual i, where k = 1,…,1000, j = 1,…,100 and i = 1,…,n. The sample size n is 10 or 20. We assumed one cis-eQTL per gene. To simulate the genotype G, we first generated the minor allele frequency (MAF) from Uniform(0.1,0.5) and then generated G~binomial(2, MAF). The other variables included genetic effect size β, cell maturity M and its effect size α, individual-specific random effect a and error term ϵ. They were generated from the following distributions: Note that (a,…,a) are i.i.d. across individuals and (ϵ,…,ϵ) are i.i.d. across individuals and cells, but they are both correlated across genes. To construct a realistic correlation structure, we chose Σ to be the correlation matrix of the expression of 1000 randomly selected genes from our pseudo bulk data. We fixed so that cell maturity and individual specific random effect explained 30% variance of expression and varied . We then generated the genetic effect size β~N(0,0.12) or N(0,0.42), corresponding to on average 0.4% or 6.3% variance of gene expression explained by genetic effects. The variance of the error term was chosen so that the expression of each gene has unit variance. We defined the pseudo time in this simulation study to be the first gene expression principal component (PC). We divided the cells into three equal pseudo time bins and averaged expression of the cells for each individual in each pseudo time bin into pseudo bulk expression (). We also calculated the average pseudo time for cells within each pseudo bulk sample, denoted by t. We tested two models for dynamic eQTL calling (fitted for each gene k separately): 1) linear mixed model with individual-specific random effects ; 2) linear model without random effects. Type I error was calculated across 1000 genes (S10 Fig). The simulation suggests that a fixed-effect linear model for dynamic eQTL calling, as used in this study, was conservative in the presence of multiple measurements per individual and did not lead to type I error inflation. The more powerful linear mixed model did lead to moderate inflation.

Correlation between bulk and pseudobulk data

We calculated the Pearson correlation of the normalized gene expression matrix from matched bulk RNA-seq data [23] with the normalized gene expression matrix from pseudobulk RNA-seq data. We observed a high correlation of gene expression values between bulk and pseudobulk samples of any given differentiation day (), and a consistent pattern of correlation for all cell lines ().

Bulk dataset deconvolution using single cell data

Cell type deconvolution was performed using CIBERSORTx [53]. The method was first assessed for accuracy using pseudobulk data, where a ground truth is available. Cells from each annotated cell type were split into training (60% of cells) and testing (40%) groups. The annotated Seurat object was subset to training data, and the FindAllMarkers command was used to identify a subset of 404 genes for use in deconvolution. We removed genes that were not measured in bulk, leaving 317 genes for use in deconvolution. A gene expression signature matrix was created from exclusively the training data by taking the sum of SCTransform-corrected counts within each cell type. Normalization of the signature matrix was performed using edgeR: normalization factors were first computed with ‘TMMwsp’ method, then TMM-normalized counts were converted to counts per million. To assess the accuracy of this approach, we then used the same normalization pipeline to aggregate pseudobulk by sample for the testing data, where samples corresponded to a (cell line, differentiation day) combination (S13 Fig). To perform deconvolution of the bulk RNA sequencing data, we used the signature matrix described above and subset the bulk data to the 317 genes contained in the signature matrix.

Cell type interaction eQTLs

To account for variable cell type composition in bulk RNA-seq data, rather than looking for cis-eQTLs whose effects are modulated by time (linear dynamic eQTLs), we looked for those whose effects are modulated by cell type proportion [22]. This mitigates the confounding impact of lineage preference on dynamic eQTL calling, as well as differences in differentiation speed (to the extent that this is captured by cell type proportion). To do so, we replaced the time variable in the dynamic eQTL model with cell type proportion as follows: Where K is the CIBERSORTx inferred cell type proportions in the sample. Separate models were built for each variant-gene pair, in each cell type except the ‘unknown’ cell type. We additionally explored a model in which we regressed out all cell type proportions (except the unknown cell type, as cell type proportions are constrained to sum to 1). Note that while all fixed cell type proportion terms are included as covariates, there is only one interaction term for a single cell type proportion. Therefore, once again, separate models were fit for each variant-gene pair, in each cell type except ’unknown’. We found that regressing out additional cell types, not just the one included in the interaction term, led to detection of a greater number of genes with a cell type interaction eQTL (). To check whether these additional covariates were in fact introducing false positive associations between individuals, we measured the pairwise genetic correlation between cell lines among the top hits detected after regressing out additional cell type proportions. We then compared this to the genetic correlation among a set of hits detected before regressing out additional cell type proportions, matched for minor allele frequency. We did not see an increase in genetic correlation among significant tests introduced by incorporation of additional covariates (). However, we did observe a lower replication rate of this expanded set of interaction eQTLs among linear dynamic eQTLs (π1 = 0.69 and 0.32, respectively, compared to 0.84 and 0.43 under the first model). We also explored including sample-level principal components as covariates in the linear model: Where U represents the first sample principal component, as opposed to PC, the first cell line principal component. Here, we again found that additional covariates led to an increased number of cell type interaction eQTLs detected (S23 Fig): for several cell types (pluripotent cells, mesoderm and progenitor) this figure continued to increase with up to 30 principal components regressed out. With the terminal cell types where more interaction eGenes were detected, the maximum number of hits detected occurred after regressing out 10 principal components. The replication rate among dynamic eQTLs decreased as the number of hits detected increased (π1 = 0.63 and 0.30 for cardiomyocyte and cardiac fibroblast, respectively, after 5 PCs were regressed out; 0.59 and 0.38 after 10; 0.64 and 0.42 after 20; 0.68 and 0.44 after 30). The results from fitting the first model are reflected in the main text.

Static eQTL calling

The interaction testing frameworks described above are designed to test for significant associations between genotype and some environmental variable (pseudotime, real differentiation time, or cell type proportion). To specifically test for genetic variants associated with gene expression levels across all observed environmental contexts, it is not sufficient to perform a similar hypothesis testing procedure on β1, the coefficient associated with genotype. This coefficient measures the effect of genotype on expression specifically when the environmental variable is equal to zero, not across all environmental contexts [75]. As a result, estimates of this effect can be highly sensitive to the decision of how to center the environmental variable. A more reliable way to identify eQTLs that are active across contexts is to perform eQTL calling in each context independently, and then pool information to infer patterns of sharing of regulatory effects across contexts, as done by the mashr package [46]. We performed regular eQTL calling in each cell type, and separately in each day, using the following model: Where PCi represents the ith sample principal component, computed from the single-context (day or cell type) gene expression data. We used both canonical and data-driven covariances, as described in [76], to fit the mash model to a random subset of 250,000 tests. To identify tests that are significant across all contexts, we first subset to the most significant test for each gene in any context. We then used the fitted mash model to count the number of conditions each of these effects is significant in, at a local false sign rate threshold of 0.05. This identified 183 static eQTLs using pseudobulk data aggregated by differentiation day, versus 147 static eQTLs using pseudobulk data aggregated by cell type.

Overlap with published GTEx eQTLs

We used the GTEx v8 release to evaluate replication and overlap of our dynamic eQTLs with variants previously detected in adult tissues. To assess replication in each tissue, we used the qvalue package in R [52] to compute π1 replication rates among all variant-gene pairs that were declared dynamic eQTLs that were also tested in GTEx. To determine the percentage of variant-gene pairs that were declared both dynamic eQTLs and significant cis eQTLs in GTEx, we incorporated cis eQTLs from all tissues.

Experimental Design.

(XLSX) Click here for additional data file.

Comparison of nonlinear dynamic eQTL calling methods.

We report the number of nonlinear dynamic eGenes (genes with a significant nonlinear dynamic eQTL at gene-level q-value < = 0.05), for each of three aggregation schemes assessed. Total number of genes tested and total number of tests run are also reported. (XLSX) Click here for additional data file.

UMAP embedding colored by batch and sample.

(A) Cells are colored by batch (the experiment, collection day, and collection in which they were collected for sequencing). (B-E) Coloring by batch (B, D) and sample (C, E) shows that apparent batch effects are driven by similarity between cells of the same sample (cell line and differentiation day) within the batch, rather than the overall batch itself. (TIF) Click here for additional data file.

Principal component analysis of single cell data.

(Top Left) Principal components biplot for single cell data, colored by differentiation day. (Top Right) Principal components biplot for single cell data, colored by cell type. (Bottom) Violin plot of PC1 loadings on each cell, grouped by differentiation day. (TIF) Click here for additional data file.

Cell lines display differences in trajectory preference.

The force atlas embedding which was learned from all cells jointly is shown for each individual cell line, colored by cell type. (TIF) Click here for additional data file.

Cell cluster 6 appears to be an outlier cluster.

This group of cells which underexpresses cardiac markers from all stages of differentiation and overexpresses endoderm markers such as APOA1 and AFP is picked up by the third principal component (top), and largely drives the variation behind the second diffusion component (bottom). The variation driven by relatively small population of cells interferes with reconstruction of biologically feasible trajectories, and was removed from downstream analysis. (TIF) Click here for additional data file.

PAGA identifies a bifurcation in cellular differentiation.

PAGA identifies a bifurcation into cardiomyocyte and cardiac fibroblast cell types after the cardiac progenitor stage. (TIF) Click here for additional data file.

Comparison of dynamic eQTL calling in bulk and pseudobulk.

(A) Number of dynamic eGenes that were detected in common between pseudotime-binned cardiomyocyte lineage, pseudotime-binned cardiac fibroblast, and previously collected bulk data. The majority of cardiomyocyte lineage dynamic eGenes overlap with at least one of the other two analyses. (B, C) Replication analysis of pseudobulk dynamic eQTLs in bulk [73]. (B) Distribution of nominal p-values from bulk data for the subset of gene-variant pairs that were identified as a dynamic eQTL in the pseudotime-binned cardiomyocyte lineage (π1 = 0.40). (C) Distribution of nominal p-values from bulk data for the subset of gene-variant pairs that were identified as a dynamic eQTL in the pseudotime-binned cardiac fibroblast lineage (π1 = 0.13). (TIF) Click here for additional data file.

Permutation analyses.

Permutation analyses (see Control Experiments in Materials and Methods) do not suggest substantial inflation in bulk (a), pseudotime-binned cardiomyocyte-subset pseudobulk (b), or pseudotime-binned cardiac fibroblast-subset pseudobulk (c). The p-values from this study are shown in blue, while those obtained from a permutation test are shown in red. (TIF) Click here for additional data file.

Genetic correlation across dynamic eQTLs.

In order to check whether broad cell line differences are driving false positive dynamic eQTLs, we compared genetic correlation among the top 200 linear dynamic eQTLs for bulk (top, left), and both pseudobulk lineages, cardiomyocyte (middle, left) and cardiac fibroblast (bottom, left), to genetic correlation among a set of background variants within 50kb of a gene, and matched for minor allele frequency (right). (TIF) Click here for additional data file.

Cell line PCA picks up on differences in the way cell lines progress through differentiation.

(Left) Inferred cell type proportions in bulk for each of the 19 cell lines, sorted by cell line PC1 loading. Focusing particularly on the proportions of iPSC and mesoderm cells, (blue and teal, respectively), it appears that cell line PC1 is picking up on differentiation speed, with cell lines with a higher PC1 score (lower subplots) differentiating slower than cells with a lower PC1 score. (Right) The second cell line PC score appears to separate cell lines based on their terminal cell type preference, cardiomyocyte or cardiac fibroblast, as defined by the most common cell type among differentiation days 10 to 15. (TIF) Click here for additional data file.

Selective inference simulations.

Simulations were performed to examine the impact of selective inference on type I error rates (Simulations to examine type I errors due to ’double dipping’). Under the generative model used, inflated type I error rates (bars exceeding the dashed line) were not observed when testing is performed using a linear model (blue). (TIF) Click here for additional data file.

Cell permutation analyses.

We generated an empirical null distribution by performing dynamic eQTL calling after permuting cell pseudotime upstream of pseudobulk aggregation. We compared the resulting empirical p-values (y-axis) to the nominal p-values from the original analysis (x-axis) in both lineages. We did not find evidence of inflation in the nominal p-values from the original analysis (instead, the contrast between the distributions suggests the nominal p-values may be overly conservative). (TIF) Click here for additional data file.

Regression Analysis.

(Top left) Linear dynamic eQTL, partial regression plot. For the linear dynamic eQTL example shown in Fig 3A (), we obtained the residuals from regressing expression on all independent variables except the genotype * pseudotime interaction term (y-axis), and plotted these against the residuals from regressing the interaction term itself on all other independent variables (x-axis). The slope of the line shown measures the effect of the interaction between genotype and pseudotime after controlling for all other independent variables. (Top right) Linear dynamic eQTL, partial residuals plot. On the y-axis, Xβ+res, where X is genotype*time for a cell line/pseudotime bin pseudobulk sample, β is the estimated coefficient for the genotype*time interaction term, and res are the residuals from the fitted linear dynamic eQTL model. On the x-axis is X. (Bottom) Similar partial regression and partial residuals plots (respectively) for the nonlinear dynamic eQTL shown in Fig 3C (), where the interaction term of interest is between genotype and pseudotime squared. (TIF) Click here for additional data file.

CIBERSORTx assessment in pseudobulk.

Assessment of CIBERSORTx performance in pseudobulk, where ’ground truth’ is available. CIBERSORTx-estimated cell type proportions from differentiation day-binned pseudobulk data for three cell lines is shown at left (’inferred’), compared to true cell type proportions (’true’, right), as determined by the cell type annotation approach described in the supplement. (TIF) Click here for additional data file.

PCs percent variance explained by technical factors in single cell data.

(a) Variance explained of each gene expression principal component (1–10) for pseudobulk samples aggregated by cell line and differentiation day using recorded covariates, including: percent cells beating (visually assessed), differentiation day, collection day, culture confluence, cell morphology (visually assessed), and cellular debris. (b) Variance explained of principal components for pseudobulk samples aggregated by cell line pseudotime bin for cardiac fibroblast (CF, left) and cardiomyocyte (CM, right) lineages. Technical covariates shown are cell line, library size, median pseudotime, number of cells, and the normalization factor used for TMM normalization, from the edgeR package (see Materials and Methods). (TIF) Click here for additional data file.

Number of UMIs, genes, and percent mitochondrial reads per cell in single cell data, by day.

Distribution of the number of Unique Molecular Identifiers (UMIs) per cell, number of genes per cell, and the percent mitochondrial reads per cell in full single cell dataset, prior to (top row) and after (bottom row) filtering as described in Materials and Methods (RNA-seq quantification). X-axis separated by differentiation day. (TIF) Click here for additional data file.

Number of UMIs, genes, and percent mitochondrial reads per cell in single cell data, by individual.

Distribution of the number of Unique Molecular Identifiers (UMIs) per cell, number of genes per cell, and the percent mitochondrial reads per cell in full single cell dataset, prior to (top row) and after (bottom row) filtering as described in Materials and Methods (RNA-seq quantification). X-axis separated by cell line. (TIF) Click here for additional data file.

Number of cells per sample.

Number of cells per collected sample following filtering described in Materials and Methods (RNA-seq quantification). (TIF) Click here for additional data file.

UMAP embedding with outlier clusters removed.

As in Fig 1C, a UMAP embedding of the single cell dataset colored by cell type, except with outlier clusters removed. (TIF) Click here for additional data file.

Dynamic eQTL detection rates across multiple bin sizes.

Y-axis shows the number of significant linear dynamic eGenes (genes with a dynamic eQTL, q<0.05) for a variety of numbers of pseudotime quantile bins (x-axis) for both the cardiac fibroblast (pseudobulk-cf, left) and cardiomyocyte (pseudobulk-cm, right) lineages. (TIF) Click here for additional data file.

PCA on pseudobulk and bulk samples identifies differentiation progress as primary source of variation.

PCA on bulk (row 1), single cell data aggregated into pseudobulk by differentiation day/ individual (row 2), cardiomyocyte lineage-specific single cell data aggregated into pseudobulk by pseudotime / individual (row 3), and cardiac fibroblast lineage-specific single cell data aggregated into pseudobulk by pseudotime/individual (row 4). Samples colored on a gradient by (left column) differentiation day or pseudotime bin, or (right column) cell line. (TIF) Click here for additional data file.

Correlation of bulk and pseudobulk data by day.

Pearson correlation between single-cell pseudobulk data and bulk RNA-seq data [23] for each individual; panels separated by differentiation day. (TIF) Click here for additional data file.

Correlation of bulk and pseudobulk data by individual.

Pearson correlation between single-cell pseudobulk data and bulk RNA-seq data [23] for each differentiation day; panels separated by individual. (TIF) Click here for additional data file.

Impact of additional covariates on interaction eQTL calling.

We examined the impact of regressing out additional covariates from the interaction eQTL model, and found an increase in the number of genes with a dynamic eQTL, as well as a decrease in the replication rates in bulk dynamic eQTLs (Materials and Methods) for both regression of cell type proportions (top) and up to 30 principal components (bottom). (TIF) Click here for additional data file.

Genetic correlation across cell type interaction eQTLs.

We compared genetic correlation among 200 cardiac fibroblast cell type interaction eQTLs detected exclusively after regressing out additional cell type proportion covariates (a), compared to 200 interaction eQTLs, detected before controlling for cell type proportions (b). We similarly computed genetic correlation among 200 cell type interaction eQTLs discovered only after regression of 5 (c), 10 (d), 20 (e), and 30 (f) sample principal components. (TIF) Click here for additional data file. 3 Aug 2021 Dear Dr Battle, Thank you very much for submitting your Research Article entitled 'Single-cell sequencing reveals lineage-specific dynamic genetic regulation of gene expression during human cardiomyocyte differentiation' to PLOS Genetics. The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time. Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions. Yours sincerely, Mingyao Li Associate Editor PLOS Genetics Hua Tang Section Editor: Natural Variation PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: Elorbany and coauthors carried out scRNA-seq on 19 cell lines at 7 different time points and identified lineage-specific dynamic eQTLs during cardiomyocyte differentiation. The paper is easy to follow, but there are a few points that need to be addressed before this is suited to be published in PLOS Genetics. Major: 1. The authors identified two major lineages, in concordance with their previous findings. The differentiation process involves transient cell states, instead of discrete cell types. I am concerned about the clustering analysis/results shown in Figure 1. A trajectory analysis will be more appropriate – granted, the authors inferred the pseudotime in Figure 2, but the results in the first figure fall in the domain of hard clustering and may raise questions. In addition to trajectory reconstruction, the authors can also consider “soft” clustering instead. For example, the PAGA method that was referenced [44]. 2. There are two lineages (CM and CF) identified. How is pseudotime inferred and assigned for these two lineages given there is a split? Figure 2b does not clearly show the bifurcation pattern, and the pseudotime seems to be monotonically increasing along the reduced dimensions. Did the authors carry out two lineage-specific eQTL analyses using pseudotime x Genotype as a covariate? 3. While the authors show the number of significant gene-SNP pairs in Table 1, it would be more informative to show how they compare and contrast via, for example, a venn diagram. How many of the SNPs identified by the pseudobulk are also identified by the bulk analysis with more timepoints? How do they compare against the original bulk analysis? The authors mentioned, “This variant is not detected as a dynamic eQTL without lineage subsetting or pseudotime binning.” Is it detected by lineage subsetting (the original Science paper identified two clusters of cell lines)? In this case, the authors could more clearly emphasize the utility of the single-cell data. 4. The authors carried out close to 2 million tests, and I am concerned about the power issue. For the two cases in Figure 3a and Figure 3c, visualization of the regression analysis is needed to show the estimated beta_13 and beta_20 with their estimates and nominal p-values (e.g., using partial residuals). Minor: 1. It would be good to include a reduced dimension plot with colors corresponding to batch. I understand that the authors carefully designed the experiment, but there are 131 samples – is batch effect corrected for? 2. It would be more appropriate to reduce the dimensions and mark the two lineages after removing the unknown cells, as was done in Figure 2. 3. The figure legends and axis labels are too small to be read. 4. In Figure 3A, boxes for GG at timepoint 14 and 15 are missing. Reviewer #2: The authors perform single cell analysis of 19 donors across 7 time points in order to examine dynamic genetic regulation during differentiation of cardiomyocytes. They find both linear and non-linear dynamic eQTLs, a number of which would not have been found without the use of single cell resolution, which enabled pseudotime reconstruction and lineage subsetting. The disentangling of cell line specific differentiation speed is a key result, and the detailed analysis presented here provides a framework for future studies. The authors then compare their results to a previous bulk eQTL time series dataset and to GTEx. Finally, the authors use cell type proportions per cell line to deconvolve the bulk samples and detect cell type interaction eQTLs. The dataset and analysis presented here are both valuable for increasing the understanding of dynamic genetic regulation of these cell types, as well as for the discussion of technical issues and optimizations that should be taken into account when performing single-cell QTL studies from iPSC. Major comments: - "We collected single-cell data using a balanced study design in which each collection included three individuals at three unique differentiation time points." Please provide the study design as a Supp Table or additional data table. Do the collection groups from the study design correlate with the two clusters of cell lines with respect to the bifurcation in cell fate? - A number of results are not presented in Results in the order I would have expected. The simulation to assess double dipping from latent variables in the linear model formula (S18) doesn't follow directly the section on the linear model but shows up in the Discussion. Likewise the permutation analysis (S10) is only mentioned in Methods. These seem to be key control experiments that should be at the least briefly mentioned in main text. Minor comments: In line 209, it is described how and why single cells were aggregated within pseudotime bins separately along each lineage. This facilitates analysis, allows for use of well-developed tools for bulk profiles, and as described in the text makes analysis perhaps more robust. Can the authors discuss any potential downsides to this approach compared to a model at the single cell level using the continuous inferred pseudotime variable? From line 221, the dynamic eQTLs are presented, e.g. 357 eGenes in CM and 903 in CF. These are the significant results from interaction of genotype and differentiation time. How many stable eGenes were found? That is the significance of beta_1 in line 703. Or are stable, genetically regulated eGenes not possible to detect with their analysis framework? "Ultimately, our lineage subsetting and pseudotime approach revealed more dynamic eQTLs than were previously identified...The increased detection rate may stem from...", this is technically true but the 3% increase might be better described as "nearly the same" or "slightly more". At first I missed that this was the increase being described. In Fig 3a and 3c, it would be useful to know the number of samples per genotype x timepoint, if there is a condensed way to include this information on the plot. At the least, knowing the mean number of samples per genotype would be useful. Line 266: recommend to cite qvalue here to give background to the pi_1 statistic. Line 270 "by searching directly for dynamic effects across tissues rather than within a single tissue in isolation": Suggest rewording "across cell types" rather than "across tissues" as in principle the analysis presented does not require a multi-tissue system. Line 298: any hypothesis as to why the CF replication was much lower than the CM replication as estimated by pi_1? Line 301: how many of the ieQTLs were lineage specific? Line 385: "infeasible": for the sake of specificity, do the authors mean that latent variable inference is computationally intensive and thus would be a bottleneck with current algorithms? Line 389-391: the fixed-effect linear model may nevertheless lead to loss in sensitivity as it is quite a bit overly conservative (as mentioned in Methods). Line 661: "Each cell line has a shared loading across all time points, and PCs reflect trajectories across all genes" I followed the cell line collapsed PCA up until this point. Rows represent cell lines and columns represent gene x time points. So the loadings for each PC are of dimension genes x time points (~38k x 7)? I wasn't clear how this reflects trajectories. Line 732: "we checked whether dynamic eQTLs were enriched for genotypes shared between any particular pair of individuals (suggesting broad individual differences could be driving the dynamic eQTLs, Fig. S10)." Didn't understand what it meant for "eQTLs to be enriched for genotypes", can the authors be more specific? And Fig S10 is the permutation analysis only, was there another Fig to be referenced here (S15)? Line 767 - extra line break. Fig S10 "do not suggest inflation", would suggest "do not suggest substantial inflation" as there is some inflation of small p-values for (a) and (c) panels here. Reviewer #3: Attached review as an attachment. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Michael Love Reviewer #3: No Submitted filename: review.docx Click here for additional data file. 23 Nov 2021 Submitted filename: Response to Reviewers.pdf Click here for additional data file. 21 Dec 2021 Dear Dr Battle, We are pleased to inform you that your manuscript entitled "Single-cell sequencing reveals lineage-specific dynamic genetic regulation of gene expression during human cardiomyocyte differentiation" has been editorially accepted for publication in PLOS Genetics. Congratulations! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Yours sincerely, Mingyao Li Associate Editor PLOS Genetics Hua Tang Section Editor: Natural Variation PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: The authors have addressed my previous concerns. Reviewer #2: The authors have addressed all of my previous concerns, in particular assessing whether the design would contribute to cell fate differences (not significant when assessing pairs of batched samples relative to background pairs of samples). A number of additional analyses were performed to answer questions from my first review, and these questions have been directly answered in every case. Figure S9 demonstrates the intuition behind the cell line PCs representing differentiation speed and terminal cell type preference. Note that the design is listed as Table S1 but was uploaded as Table S2. Reviewer #3: I appreciate the authors' effort to address my questions and concerns. I felt the authors adequately addressed all points. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: None Reviewer #2: Yes Reviewer #3: None ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Michael Love Reviewer #3: No ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00889R1 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 14 Jan 2022 PGENETICS-D-21-00889R1 Single-cell sequencing reveals lineage-specific dynamic genetic regulation of gene expression during human cardiomyocyte differentiation Dear Dr Battle, We are pleased to inform you that your manuscript entitled "Single-cell sequencing reveals lineage-specific dynamic genetic regulation of gene expression during human cardiomyocyte differentiation" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, Zsofia Freund PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  71 in total

1.  Statistical significance for genomewide studies.

Authors:  John D Storey; Robert Tibshirani
Journal:  Proc Natl Acad Sci U S A       Date:  2003-07-25       Impact factor: 11.205

2.  Statistical learning and selective inference.

Authors:  Jonathan Taylor; Robert J Tibshirani
Journal:  Proc Natl Acad Sci U S A       Date:  2015-06-23       Impact factor: 11.205

3.  Single-Cell Multi-omic Integration Compares and Contrasts Features of Brain Cell Identity.

Authors:  Joshua D Welch; Velina Kozareva; Ashley Ferreira; Charles Vanderburg; Carly Martin; Evan Z Macosko
Journal:  Cell       Date:  2019-06-06       Impact factor: 41.582

4.  Cardiac fibroblasts regulate myocardial proliferation through beta1 integrin signaling.

Authors:  Masaki Ieda; Takatoshi Tsuchihashi; Kathryn N Ivey; Robert S Ross; Ting-Ting Hong; Robin M Shaw; Deepak Srivastava
Journal:  Dev Cell       Date:  2009-02       Impact factor: 12.270

5.  Understanding mechanisms underlying human gene expression variation with RNA sequencing.

Authors:  Joseph K Pickrell; John C Marioni; Athma A Pai; Jacob F Degner; Barbara E Engelhardt; Everlyne Nkadori; Jean-Baptiste Veyrieras; Matthew Stephens; Yoav Gilad; Jonathan K Pritchard
Journal:  Nature       Date:  2010-03-10       Impact factor: 49.962

6.  Population-scale single-cell RNA-seq profiling across dopaminergic neuron differentiation.

Authors:  Julie Jerber; Daniel D Seaton; Anna S E Cuomo; Natsuhiko Kumasaka; James Haldane; Juliette Steer; Minal Patel; Daniel Pearce; Malin Andersson; Marc Jan Bonder; Ed Mountjoy; Maya Ghoussaini; Madeline A Lancaster; John C Marioni; Florian T Merkle; Daniel J Gaffney; Oliver Stegle
Journal:  Nat Genet       Date:  2021-03-04       Impact factor: 38.330

7.  Determining cell type abundance and expression from bulk tissues with digital cytometry.

Authors:  Aaron M Newman; Chloé B Steen; Chih Long Liu; Andrew J Gentles; Aadel A Chaudhuri; Florian Scherer; Michael S Khodadoust; Mohammad S Esfahani; Bogdan A Luca; David Steiner; Maximilian Diehn; Ash A Alizadeh
Journal:  Nat Biotechnol       Date:  2019-05-06       Impact factor: 54.908

8.  Normalization and variance stabilization of single-cell RNA-seq data using regularized negative binomial regression.

Authors:  Christoph Hafemeister; Rahul Satija
Journal:  Genome Biol       Date:  2019-12-23       Impact factor: 13.583

9.  Exploiting the GTEx resources to decipher the mechanisms at GWAS loci.

Authors:  Alvaro N Barbeira; Rodrigo Bonazzola; Eric R Gamazon; Yanyu Liang; YoSon Park; Sarah Kim-Hellmuth; Gao Wang; Zhuoxun Jiang; Dan Zhou; Farhad Hormozdiari; Boxiang Liu; Abhiram Rao; Andrew R Hamel; Milton D Pividori; François Aguet; Lisa Bastarache; Daniel M Jordan; Marie Verbanck; Ron Do; Matthew Stephens; Kristin Ardlie; Mark McCarthy; Stephen B Montgomery; Ayellet V Segrè; Christopher D Brown; Tuuli Lappalainen; Xiaoquan Wen; Hae Kyung Im
Journal:  Genome Biol       Date:  2021-01-26       Impact factor: 17.906

10.  Mapping Variation in Cellular and Transcriptional Response to 1,25-Dihydroxyvitamin D3 in Peripheral Blood Mononuclear Cells.

Authors:  Silvia N Kariuki; Joseph C Maranville; Shaneen S Baxter; Choongwon Jeong; Shigeki Nakagome; Cara L Hrusch; David B Witonsky; Anne I Sperling; Anna Di Rienzo
Journal:  PLoS One       Date:  2016-07-25       Impact factor: 3.240

View more
  2 in total

1.  Cell type determination for cardiac differentiation occurs soon after seeding of human-induced pluripotent stem cells.

Authors:  Connie L Jiang; Yogesh Goyal; Naveen Jain; Qiaohong Wang; Rachel E Truitt; Allison J Coté; Benjamin Emert; Ian A Mellis; Karun Kiani; Wenli Yang; Rajan Jain; Arjun Raj
Journal:  Genome Biol       Date:  2022-04-05       Impact factor: 17.906

2.  Genetic control of the dynamic transcriptional response to immune stimuli and glucocorticoids at single cell resolution.

Authors:  Justyna A Resztak; Julong Wei; Samuele Zilioli; Edward Sendler; Adnan Alazizi; Henriette E Mair-Meijers; Peijun Wu; Richard B Slatcher; Xiang Zhou; Francesca Luca; Roger Pique-Regi
Journal:  bioRxiv       Date:  2022-03-15
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.