| Literature DB >> 35058971 |
Shuaibing Yang1, Qianqian Zhao2, Lihua Tang3, Zejia Chen3, Zhaoting Wu3, Kaixin Li4, Ruoru Lin4, Yang Chen4, Danlin Ou4, Li Zhou3, Jianzhen Xu2, Qingsong Qin1,5,6.
Abstract
Human papillomavirus (HPV) is a causal agent for most cervical cancers. The physical status of the HPV genome in these cancers could be episomal, integrated, or both. HPV integration could serve as a biomarker for clinical diagnosis, treatment, and prognosis. Although whole-genome sequencing by next-generation sequencing (NGS) technologies, such as the Illumina sequencing platform, have been used for detecting integrated HPV genome in cervical cancer, it faces challenges of analyzing long repeats and translocated sequences. In contrast, Oxford nanopore sequencing technology can generate ultra-long reads, which could be a very useful tool for determining HPV genome sequence and its physical status in cervical cancer. As a proof of concept, in this study, we completed whole genome sequencing from a cervical cancer tissue and a CaSki cell line with Oxford Nanopore Technologies. From the cervical cancer tissue, a 7,894 bp-long HPV35 genomic sequence was assembled from 678 reads at 97-fold coverage of HPV genome, sharing 99.96% identity with the HPV sequence obtained by Sanger sequencing. A 7904 bp-long HPV16 genomic sequence was assembled from data generated from the CaSki cell line at 3857-fold coverage, sharing 99.99% identity with the reference genome (NCBI: U89348). Intriguingly, long reads generated by nanopore sequencing directly revealed chimeric cellular-viral sequences and concatemeric genomic sequences, leading to the discovery of 448 unique integration breakpoints in the CaSki cell line and 60 breakpoints in the cervical cancer sample. Taken together, nanopore sequencing is a unique tool to identify HPV sequences and would shed light on the physical status of HPV genome in its associated cancers.Entities:
Keywords: HPV; cervical cancer; episomal genome; integration; nanopore sequencing
Year: 2022 PMID: 35058971 PMCID: PMC8764290 DOI: 10.3389/fgene.2021.798608
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
FIGURE 1Workflow chart of bioinformatic analysis and de novo assembly of the HPV genome from nanopore sequencing reads.
Primers used in this study.
| Target | Primer designation | Sequence |
|---|---|---|
| HPV35: 212–766 | Primer1(F) | 5′-CAAGAATTACAGCGGAGTGAGGT-3′ |
| Primer1(R) | 5′-ACAGACGTAGTGTCGCCTCACAT-3′ | |
| HPV35: 609–1,165 | Primer2(F) | 5′-ACCCGAGGCAACTGACCTATACTGT-3′ |
| Primer2(R) | 5′-AGCTCACGCTGCTAAGTGGACTA-3′ | |
| HPV35: 1,139–1756 | Primer3(F) | 5′-CTAGTAGTCCACTTAGCAGCGTGAG-3′ |
| Primer3(R) | 5′-TTGGTGGTTGTATTAGCATACTTGC-3′ | |
| HPV35: 1,426–2,140 | Primer4(F) | 5′-AGTAATGCAAACGCAGCTATGTTG-3′ |
| Primer4(R) | 5′-AGTCACCGTCATCGTCCACCTTT-3′ | |
| HPV35: 2,124–2,708 | Primer5(F) | 5′-GGACGATGACGGTGACTGGAGG-3′ |
| Primer5(R) | 5′-TTGTCCTCTTCCTCGTGCAAAT-3′ | |
| HPV35: 2,558–3,086 | Primer6(F) | 5′-ACTTACATAGCAGGGTAGTGGTCTT-3′ |
| Primer6(R) | 5′-CACCATCAAATTGTACTTCCACTGT-3′ | |
| HPV35: 2,888–3,405 | Primer7(F) | 5′-GTGGTTCCAACGCAGGCCATTTC-3′ |
| Primer7(R) | 5′-CCCACGGAGCAGGCTTTGGTATG-3′ | |
| HPV35: 3,377–3,910 | Primer8(F) | 5′-GAGACCCATACCAAAGCCTGCTC-3′ |
| Primer8(R) | 5′-GCAATAGCGAACGTACAAGCAGA-3′ | |
| HPV35: 3,885–4,306 | Primer9(F) | 5′-GTGTCTGCTTGTACGTTCGCTAT-3′ |
| Primer9(R) | 5′-AACATCTGGTGGACAAGTTCCTG-3′ | |
| HPV35: 4,239–4,870 | Primer10(F) | 5′-TTAAACGTGCATCTGCAACACAACT-3′ |
| Primer10(R) | 5′-AGGGCGAGACCCTGGAATAGGC-3′ | |
| HPV35: 4,585–5,186 | Primer11(F) | 5′-TGTTACACCAAGGGTCCCACCTA-3′ |
| Primer11(R) | 5′-CCTGATAATAATGTACCCGTGCC-3′ | |
| HPV35: 5,075–5,640 | Primer12(F) | 5′-CCTGCACTAACATCTAGGAAAGG-3′ |
| Primer12(R) | 5′-GCAGGTAGACAGTGGCTTCGTTA-3′ | |
| HPV35: 5,426–5,945 | Primer13(F) | 5′-CCTATAACAGCAGGGCCAGACAT-3′ |
| Primer13(R) | 5′-TACACCCAATGGCTGACCACGAC-3′ | |
| HPV35: 5,874–6,505 | Primer14(F) | 5′-GATCCTGCCTCCCAGCGTTTGGT-3′ |
| Primer14(R) | 5′-GCATCGGAGGTTACCATAGAGCCAC-3′ | |
| HPV35: 6,477–7,057 | Primer15(F) | 5′-CCTAGTGGCTCTATGGTAACCTCCG-3′ |
| Primer15(R) | 5′-GGAGCTGCACGCTTGCCTAATCT-3′ | |
| HPV35: 6,964–7,627 | Primer16(F) | 5′-CAGACTTAGATCAATTTCCGTTGG-3′ |
| Primer16(R) | 5′-GTGTGGGTGGACCACAAGTATGAA-3′ | |
| HPV35: 7,603–233 | Primer17(F) | 5′-TTTCATACTTGTGGTCCACCCA-3′ |
| Primer17(R) | 5′-CTCACTCCGCTGTAATTCTTGTT-3′ | |
| Divergent primers | Primer18(F) | 5′- ACAGCCTGTGATGTTACATAGCG -3′ |
| Primer18(R) | 5′- CAGACTTAGATCAATTTCCGTTGG -3′ | |
| HPV35: E2 | primer(F) | 5′-TATGGGAAGTGCATGTGGGTGGTC-3′ |
| primer(R) | 5′-GCACTGAGTCGCACTCGCTTGG-3′ | |
| HPV35: E6 | primer(F) | 5′-CTGAACGACCTTACAAACTGC-3′ |
| primer(R) | 5′-TCACTCCGCTGTAATTCTTGT-3′ | |
| HPV16: E2 | primer(F) | 5′-CATCAGTAACTGTGGTAGAGGGTC-3′ |
| primer(R) | 5′-GGATACTTCGTTGCTGCTAAAC-3′ | |
| HPV16: E6 | primer(F) | 5′-GAGCGACCCAGAAAGTTACCAC-3′ |
| primer(R) | 5′-ACGTCGCAGTAACTGTTGCTTG-3′ | |
| β-actin | primer(F) | 5′-TCCTCCTGAGCGCAAGTACTC-3′ |
| primer(R) | 5′-CGGACTCGTCATACTCCTGCTT-3′ | |
| PRR30 (BP) | primer(F) | 5′-GCTTTCCCTCAACTACTGCCCTGTG-3′ |
| primer(R) | 5′-ATGCGCCAACGCCTTACATACCG-3′ |
FIGURE 2HPV35 genome was assembled from data generated by nanopore sequencing and further amplified by PCR. (A) The distribution of reads generated by nanopore sequencing from a cervical cancer tissue sample. (B) The distribution of the read quality of nanopore sequencing data. (C) De novo assembly of the HPV35 genome from 678 reads generated by nanopore sequencing, which is shown in the Integrative Genomics Viewer (IGV). (D) Seventeen HPV35 genomic segments were amplified from DNA extracted from a cervical cancer tissue sample.
FIGURE 3Nanopore sequencing found tandem HPV genomes in cervical cancer tissues and CaSki cells, respectively. (A) An 11.54 kb-long HPV 35 tandem genomic sequence was obtained by nanopore sequencing. The 11.54 kb-long sequence was aligned to HPV35 16B (NCBI: KX514416.1), which consists of three genomic segments, E1-E7-E6 (1567–10 nt), a whole genome frame (7894–10 nt), and URR-L1 (1561–10 nt. (B) A 21.18 kb-long HPV tandem sequence flanked with human genomic sequence at one end was obtained by nanopore sequencing from CaSki cells. The sequence was aligned to HPV16 (NCBI: U89348), in which a truncated genome (470–7905 nt) was connected to another truncated one (470–6905 nt) in a head-to-tail manner. (C) Another 15.07 kb-long HPV tandem sequence was obtained by nanopore sequencing from CaSki cells and was flanked at one end by the human gene; concatemers are formed by joining of incomplete HPV genomes with two spliced sites at 2032 nt and 4,586 nt.
FIGURE 4Circular episomal HPV DNA was detected by exonuclease V digestion and PCR. (A) DNA extracted from cervical cancer tissue was digested with exonuclease V and the HPV genome was amplified by long-range PCR using a pair of divergent primers. (B) E2 and E6 were amplified with E2 and E6 primers from DNA treated with or without exonuclease V. β-actin served as a control.
Physical state determination of the HPV genome by exonuclease V (ExoV)-qPCR–based assay.
| Items | HPV35 in cervical cancer | HPV16 in CaSki | ||||
|---|---|---|---|---|---|---|
| Genes | E2 | E6 | β-actin | E2 | E6 | β-actin |
| Resistance to ExoV digestion | 0.25 | 0.34 | 0.003 | 0.0005 | 0.0006 | 0.001 |
| Physical state of HPV | Integrated and episomal | Integrated | ||||
Note: a resistance rate of the detected genes equal to 1 indicates the HPV, genome is exclusively episomal; a rate close to 0 indicates exclusively integrated; between 0–1, mixed.
FIGURE 5HPV integration sites identified by nanopore sequencing in CaSki cells and a cervical cancer tissue. (A) Distribution of HPV integration sites in different function regions of human genes identified from CaSki cells (HPV16) and a cervical cancer tissue (HPV35) by nanopore sequencing. (B) The HPV integration site was amplified by PCR from the CaSki cells, followed by agarose gel electrophoresis. C-33A cells (HPV-negative cervical cancer cells) was used as a negative control. (C) Sanger sequencing of the HPV integration site. PCR products were subjected to Sanger sequencing. Peaks of nucleotides at integration sites were shown. The cellular sequence from PRR30 was boxed with green color, and viral sequence was boxed with red color. (D) The sequence of the integration site located in PRR30 gene. The exon region of PRR30 gene was labeled with green color, and the URR region of HPV genome was labeled with red color. Three random nucleotides at the breakpoint (BP) were labeled with blue color.