| Literature DB >> 35047010 |
Wan Wei1, Xianjun Xuan2, Jiahui Zhu3, Tianwen Chen2, Yudan Fang2, Jiao Ding3, Danfei Ji3, Guoyi Zhou3, Bo Tang2, Xudong He4.
Abstract
Objective: We performed this study to investigate whether the EDNRA gene rs1878406 C > T polymorphism is associated with risk of large artery atherosclerosis (LAA) stroke in the Chinese Han population.Entities:
Keywords: genotype; large artery atherosclerosis; polymorphism; rs1878406; stroke
Year: 2022 PMID: 35047010 PMCID: PMC8763384 DOI: 10.3389/fgene.2021.783074
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Baseline clinical and demographic characteristics of the LAA stroke patients and controls.
| Characteristic | Case | Control |
|
|---|---|---|---|
| N | 1,112 (48.26%) | 1,192 (51.74%) | |
| Sex | |||
| Female | 290 (26%) | 440 (37%) | <0.001 |
| Male | 822 (74%) | 752 (63%) | |
| Age | 61.40 ± 10.31 | 57.42 ± 10.16 | <0.001 |
| ≤60 | 496 (45%) | 810 (68%) | <0.001 |
| >60 | 616 (55%) | 382 (32%) | |
| Hypertension | |||
| No | 292 (26%) | 851 (71%) | <0.001 |
| Yes | 820 (74%) | 341 (29%) | |
| Diabetes mellitus | |||
| No | 740 (67%) | 1,041 (87%) | <0.001 |
| Yes | 372 (33%) | 151 (13%) | |
| Hyperlipidemia | |||
| No | 677 (60.9%) | 892 (74.8%) | <0.001 |
| Yes | 435 (39.1%) | 300 (25.2%) | |
| Smoker | |||
| No | 632 (57%) | 823 (69%) | <0.001 |
| Yes | 480 (43%) | 369 (31%) | |
FIGURE 1Association between rs1878406 polymorphism and age at onset of LAA stroke. Box plot of age at LAA stroke onset for three different genotypes of patients with rs1878406.
Association of the rs1878406 C > T polymorphism with risk of LAA stroke.
| Genetic models | Genotype | Case | Control | Crude OR (95%CI) | Crude | AIC | Adjusted OR (95%CI) |
|
|---|---|---|---|---|---|---|---|---|
| Codominant | C/C | 717 (60.1%) | 632 (56.8%) | 1 | 0.006 | 3,186.9 | 1 | 0.016 |
| T/C | 421 (35.3%) | 395 (35.5%) | 1.06 (0.89–1.27) | 1.07 (0.87–1.32) | ||||
| T/T | 54 (4.5%) | 85 (7.6%) | 1.79 (1.25–2.55) | 1.85 (1.21–2.83) | ||||
| Dominant | C/C | 717 (60.1%) | 632 (56.8%) | 1 | 0.106 | 3192.6 | 1 | 0.137 |
| T/C-T/T | 475 (39.9%) | 480 (43.2%) | 1.15 (0.97–1.35) | 1.16 (0.95–1.41) | ||||
| Recessive | C/C-T/C | 1,138 (95.5%) | 1,027 (92.4%) | 1 | 0.002 | 3,185.4 | 1 | 0.005 |
| T/T | 54 (4.5%) | 85 (7.6%) | 1.74 (1.23–2.48) | 1.80 (1.19–2.73) | ||||
| Log-additive | — | — | — | 1.19 (1.04–1.36) | 0.011 | 3,188.8 | 1.20 (1.03–1.41) | 0.022 |
Adjusted for age, blood pressure, diabetes, hypertension, hyperlipidemia, and smoking.
Age-stratified analysis of the association between the rs1878406 C > T polymorphism and risk of LAA stroke.
| Genotypes | ≤60 | >60 | ||||||
|---|---|---|---|---|---|---|---|---|
| Control | Case | OR (95% CI) |
| Control | Case | OR (95% CI) |
| |
| C/C-T/C | 775 | 458 | 1 | 0.013 | 363 | 569 | 1 | 0.248 |
| T/T | 35 | 38 | 2.00 (1.16–3.45) | 19 | 47 | 1.44 (0.78–2.66) | ||
Adjusted for blood pressure, diabetes, hypertension, hyperlipidemia, and smoking.
Sex-stratified analysis of the association between the rs1878406 C > T polymorphism and risk of LAA stroke.
| Genotypes | Female | Male | ||||||
|---|---|---|---|---|---|---|---|---|
| Control | Case | OR (95% CI) |
| Control | Case | OR (95% CI) |
| |
| C/C-T/C | 418 | 270 | 1 | 0.308 | 720 | 757 | 1 | 0.011 |
| T/T | 22 | 20 | 1.43 (0.68–3.02) | 32 | 65 | 1.89 (1.14–3.11) | ||
Adjusted for age, blood pressure, diabetes, hypertension, hyperlipidemia, and smoking.
FIGURE 2(A) Adjusted OR of LAA stroke according to rs1878406 and age; the interaction between rs1878406 and age was non-significant (p interaction = 0.442). (B) Adjusted OR of LAA stroke according to rs1878406 and sex; the interaction between rs1878406 and sex was non-significant (p interaction = 0.553).
Regulatory motifs altered for rs1878406 based on HaploReg v4.1.
| PWM ID | PWM match score | C Allele: TTATCTTCAGTCTCACCTCCGAATCCTGTCAGCTGTTATCTCGTATTTAGAGCTTACCA | |
|---|---|---|---|
| C Allele | T Allele | T Allele: TTATCTTCAGTCTCACCTCCGAATCCTGTTAGCTGTTATCTCGTATTTAGAGCTTACCA | |
| GATA_known1 | 12 | 12.4 | HBDHVDYTCTTATCTHYHHWHV |
| GATA_known4 | 12.9 | 12.6 | NNHHBSTTATCWHBNDW |
| Myf_4 | 13.4 | 5.9 | NDRVCAVCTGYYNNBB |
PWM, Position Weight Matrix (Library from Kheradpour and Kellis, 2013).