Detection of porcine enteric viruses (Kobuvirus, Mamastrovirus and Sapelovirus) in domestic pigs in Corsica, France.

Many enteric viruses are found in pig farms around the world and can cause death of animals or important production losses for breeders. Among the wide spectrum of enteric viral species, porcine Sapelovirus (PSV), porcine Kobuvirus (PKoV) and porcine Astrovirus (PAstV) are frequently found in pig feces. In this study we investigated sixteen pig farms in Corsica, France, to evaluate the circulation of three enteric viruses (PKoV, PAstV-1 and PSV). In addition to the three viruses studied by RT-qPCR (908 pig feces samples), 26 stool samples were tested using the Next Generation Sequencing method (NGS). Our results showed viral RNA detection rates (i) of 62.0% [58.7-65.1] (n = 563/908) for PSV, (ii) of 44.8% [41.5-48.1] (n = 407/908) for PKoV and (iii) of 8.6% [6.8-10.6] (n = 78/908) for PAstV-1. Significant differences were observed for all three viruses according to age (P-value = 2.4e-13 for PAstV-1; 2.4e-12 for PKoV and 0.005 for PSV). The type of breeding was significantly associated with RNA detection only for PAstV-1 (P-value = 9.6e-6). Among the 26 samples tested with NGS method, consensus sequences corresponding to 10 different species of virus were detected. This study provides first insight on the presence of three common porcine enteric viruses in France. We also showed that they are frequently encountered in pigs born and bred in Corsica, which demonstrates endemic local circulation.

Introduction

Pig farms make an important contribution to the economy of world agriculture and are an important source of food. Porcine diarrhea can cause mortality in animals, especially in piglets, and cause economic losses to the pig farmers; many of the pathogens responsible can also infect humans. A very broad spectrum of viruses that can cause porcine diarrhea has been found in pig feces, including porcine Sapelovirus (PSV), porcine Kobuvirus (PKoV), porcine Sapovirus, porcine Astrovirus (PAstV), porcine Bocavirus and porcine Rotavirus [1-7]. The most prevalent viruses detected in pig feces are PKoV, Mamastroviruses or Astrovirus 4 (PAstV), porcine Circovirus (PCV) and PSV [8, 9].

Kobuviruses belong to the Picornaviridae family. The genome is a single-stranded 8.2–8.3-kb RNA molecule that contains a large open reading frame coding for a polyprotein [10, 11]. Different species of kobuviruses have been found around the world in diverse animal species (pigs, cattle, sheep, goats, bats, rodents, felines, canines, etc.) and humans. It is suspected to be a pathogen that causes digestive disorders, particularly diarrhea in humans and animals, with transmission occurring via the fecal–oral route [12].

Porcine Sapelovirus (Family Picornaviridae, genus Sapelovirus) is a non-enveloped virus of 7.5–8.3 kb positive-polarity single-stranded RNA genome [13]. Sapelovirus genus is closely related to the genus Enterovirus and consists of three species: Avian Sapelovirus, Sapelovirus A (Porcine Sapelovirus [PSV]) and Sapelovirus B (simian Sapelovirus), with a single serotype [14]. PSV is transmitted via the fecal–oral route, and infection of pigs can be asymptomatic or associated with diarrhea, respiratory distress, encephalitis, skin lesions and reproductive tract disorders [15-17]. PSV is circulating in China, India, Korea, the United States, Brazil and Europe (Germany, the United Kingdom and Spain) [16-23]. Recently, PSV was detected and characterized for the first time in France, in Corsica. Importantly, the PSV-infected piglet from which the sequenced strain was isolated (PSV OPY-1-Corsica-2017; Genbank accession no. MH513612) was born and bred on the island of Corsica, suggesting local transmission [24].

Astroviruses are nonenveloped single-stranded RNA viruses with positive polarity, with an icosahedral capsid [25], that belong to the family Astroviridae, which includes two genera: Mamastrovirus (mammals) and Avastrovirus (avian) (ICTV, Astroviridae, 2019). Astroviruses can infect a large spectrum of animal species (pigs, deer, marine mammals, rodents, birds, pets, etc.) as well as humans [26]. Astrovirus infections are generally associated with more or less severe gastrointestinal signs in mammals (Mendez and Arias, 2007), but have also been detected in healthy individuals [27]. In humans, they cause intestinal disorders, particularly in children and immunocompromised individuals [28, 29].

The present study was conducted in Corsica, a French Mediterranean island, where livestock farming is a principal economic activity. In this region, more than 54,000 pigs, predominantly of the “Nustrale” breed, are bred using a traditional extensive farming system [30, 31]. Traditional extensive (or semi-extensive) outdoor system of pig farming is the main method of breeding. It favors contact with wild animals, which could result in sharing of pathogens such as hepatitis E virus (HEV) and Aujesky’s disease agent [32, 33]. For HEV, we recently reported RNA detection in 9.2% of tested pig stool samples, with 75% of pig farms showing at least one positive sample [34]. Exploring the circulation of other enteric viruses in such pig farms could help to gain knowledge in the epidemiological cycle of HEV through the possible role of co-infection and super-infection. The main aim of this study was to detect and characterize three common porcine enteric viruses (PKoV, PAstV-1 and PSV) by molecular detection analysis of faeces collected within Corsican pigfarms.

Materials and methods

Study area, pig farms and sampling plan

Study area, samples/data collection, pig farms sampled, sampling plan and ethics statement are as described previously [34].

Briefly, (i) we collected fresh stool samples individually on the ground where pigs were pasturing and also intra-rectally using a glove with the help of a qualified technician (the individual level was control for each sample; feces were collected directly after defecation); (ii) three types of breeding system operated in Corsica were included: seven outdoor extensive farms (E-farms), six outdoor semi-extensive farms (SE-farms) and three indoor closed farms (C-farms); (iii). for each stool sample, the township, anonymous breeder code, breeding type, age and breed of pig and nature of the sample (“rectal” or “on the ground” feces) were recorded; (iv). Four age categories were defined among the young pigs: 1–3 months, 3–4 months, 4–6 months and adults (older than 6 months). Samples from plots where post-weaning pigs were held together with older pigs (age mixed) were classified as the “Herd” group. Information on the individual health status of the pigs was not collected by a case report form. However, there is no apparent disease in the farms during the collect according to breeders. All the samples were collected between April and September 2017.

RNA extraction and reverse transcription–quantitative polymerase chain reaction (RT–qPCR)

One gram of fecal sample was resuspended in 9 mL of phosphate-buffered saline and then centrifuged at 5,000 × g for 10 min. The resulting supernatant was collected and stored at −80°C until processed. Viral RNA was extracted from 200 μL of supernatant using QIAamp Cador Pathogen on a QIAcube HT (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Samples were spiked with an internal control (T4 and MS2 phages) before extraction, to monitor the extraction and subsequent steps, as described previously. Each pool was spiked before extraction with a predefined amount of MS2 bacteriophage in order to monitor the subsequent steps (nucleic acid purification, reverse transcription and PCR amplification) and to detect the presence of inhibitors and enzymatic reactions as described previously [35]. All extractions and RT-qPCRs were checked with the presence of a curve for phage and positive and negative controls respectively. Nucleic acids were eluted in 100 μL of RE buffer and stored at –80°C.

Samples initially collected for the detection of HEV RNA were analyzed by RT–qPCR for PKoV, PSV and PAstV-1. Of the 919 samples initially collected, 908 were available for this study. Details of the three molecular assay [8, 36] are presented in Table 1 using an Applied Quant Studio 3 (Applied Biosystems, CA, USA). For PKoV RNA and PAstV-1 RNA detection, a RT–qPCR test was considered positive if negative controls were negative, positive controls were positive and an exponential curve was observed before a 35-Ct threshold.

Table 1

RT–qPCR detection assays used in the study.

Viruses	Name of primers and probes	Sequences	References
PSV	FW: SYBR-PSV1 primer	GGCAGTAGCGTGGCGAGC	[36]
	REV: SYBR-PSV2 primer	CTACTCTCCTGTAACCAGT
PKoV	FW: T-248-F-PKoV	TCTCTGACCTCTGAAGTGCACT	[8]
	REV: T-249-R-PKoV	TGAAGAAGCCATGTGTCTTGTC
	Probe: T-250-PKoV-FAM	GGTTGCGTGGCTGGGAATCCAC
PAstV-1	FW: T217-F-PAstV-1	CCAAAACCAGCAATCCGTCAA
	REV: T218-R-PAstV-1	GCCCCTAAAGCAACGATCGG
	Probe: T-219-PAstV-1-VIC	TTCTTGTCAAGGATAATACGGGG

For PSV RNA detection, the qPCR machine was programmed to perform a melt-curve analysis at the end of the run to ensure assay specificity; RT–qPCR results were considered positive if a melt curve was detected at between 83°C and 85°C and an amplification curve was observed before a 35-Ct threshold. The QuantiTect SYBR® Green PCR Kit was used for this biomolecular detection (Qiagen, Hilden, Germany).

Statistical analyses

The detection rate of RNA viruses (PKoV, PAstV-1 and PSV) in pig fecal samples was calculated at the individual level and the pig farm level. Positivity rate was also estimated in each subgroup, and a two-sided 95% confidence interval [95% CI] was calculated. Categorical variables were expressed as the number of cases (percentages). Frequencies were compared using the χ2 test or Fisher’s exact test (P < 0.05). A bivariate analysis was carried out to identify the variables that were related to infection with each virus. The multivariate logistic regression analysis included variables that were related to outcome variables in the bivariate analysis with a P-value < 0.2 or a possible association. Odds ratios (ORs), including their 95% CIs, were calculated for the logistic regression models. As in Capai, F. [34], samples with no associated age (Herd group) were excluded from the multivariate analysis, and previous results for the detection rate of HEV RNA among pig feces were included in the analysis to estimate a possible association between coinfections with different viruses [37]. All statistical analyses were performed using the R program (http://www.r-project.org).

Virus genome sequencing

Virus genome sequencing was performed for 26 stool samples as described previously [38]. Only, 26 analyses could be realized for financial reason and these 26 samples were randomly selected among the overall samples. A random RT–qPCR was performed using tagged random primers. A ProtoScript® II Reverse Transcriptase kit (New England Biolabs) was used for reverse transcription with random tagged primers, and Platinum® Taq High Fidelity polymerase enzyme (Thermo Fisher Scientific) with specific primers for amplification. After Qubit quantification using Qubit® dsDNA HS Assay Kit and Qubit 2.0 fluorometer (ThermoFisher Scientific), amplicons were fragmented (sonication) into fragments of 200 bp length. Libraries were built by adding barcodes for sample identification, and primers for amplification using the AB Library Builder System (ThermoFisher Scientific). To pool equimolar amounts of the barcoded samples, a quantification by quantitative PCR using an Ion Library TaqMan™ Quantitation Kit (Thermo Fisher Scientific) was performed. An automated Ion Chef instrument (ThermoFisher) was used for emulsion PCR of the pools and loading them on a 520 chip. Sequencing was performed using S5 Ion torrent technology (Thermo Fisher Scientific) following the manufacturer’s instructions. Reads were trimmed (reads with quality score < 0.99 and length < 100 bp were removed, and the 30 first and 30 last nucleotides were removed from the reads), and de novo contigs were produced. These contigs were submitted to Blastn to determine the best reference sequences(s). A consensus sequence was obtained after mapping of the reads on the previously determined reference using CLC genomics workbench software 20.0.4 (Qiagen). The de novo contig was compared with the consensus sequence to ensure that the reference sequence did not affect the consensus sequence. Only sequences corresponding to enteric viruses found in pigs were selected for analysis.

Results

As suggested by Arya, Antonisamy [39], we previously calculated the minimum sample size required to achieve the objectives related to the HEV (n = 176 stool specimens) [34]. Overall, we collected 919 pig feces samples from 16 pig farms selected according to location and breeding system.

For PSV RNA detection, using the SYBR green A range of temperatures around 84°C (83–85°C) was tolerated. Indeed, a one-nucleotide difference within the amplified sequence can impact the melt-curve dissociation temperature [40, 41].

Viral RNA detection rate for the three viruses in feces from domestic pigs and univariate analysis

Overall, 908 samples were available for the detection of the three virus of interest, 310 were from E-farms, 396 from SE-farm and 201 from C-farm.

Our results showed viral RNA detection rates (i) of 62.0% [58.7–65.1] (n = 563/908) for PSV, (ii) of 44.8% [41.5–48.1] (n = 407/908) for PKoV and (iii) of 8.6% [6.8–10.6] (n = 78/908) for PAstV-1 (Table 2).

Table 2

Viral RNA in stools of domestic pigs stratified by breeding system and age.

Factor	Condition	Number of samples		positive (n)	PKoV RNA detection (%)		P-value	positive (n)	PAstV-1 RNA detection (%)		P-value	positive (n)	PSV RNA detection (%)		P-value
		N	%		%	[95% CI]			%	[95% CI]			%	[95% CI]
Breeding systems	E-farm	310	34.1	136	43.9	[38.3–49.6]	0.91	17	5.5	[38.3–49.6]	9.6e–6	186	60.0	[54.3–65.5]	0.0094
	SE-farm	396	43.6	180	45.5	[40.5–50.5]		27	6.8	[4.5–9.8]		233	58.8	[53.8–63.7]
	C-farm	201	22.1	91	45.3	[38.2–52.4]		34	16.9	[12–22.8]		143	71.1	[64.3–77.3]
Age	1–3 months	111	12.2	77	69.4	[59.9–77.7]	2.4e–12	34	30.6	[22.2–40.1]	2.4e–13	86	77.5	[68.6–84.9]	0.005
	3–4 months	143	15.7	84	58.7	[50.2–66.9]		9	6.3	[2.9–11.6]		91	63.6	[55.2–71.5]
	4–6 months	162	17.8	71	43.8	[36.0–51.8]		4	2.5	[0.7–6.2]		120	74.1	[66.6–80.6]
	Adults (>6 months)*	190	20.9	54	28.4	[22.1–35.4]		17	8.9	[5.3–13.9]		116	61.1	[53.7–68.0]
	Herds (age mixed)	302	33.3	121	40.1	[34.5–45.8]		14	4.6	[2.6–7.7]		150	49.7	[43.9–55.4]
All pigs		908	100.0	407	44.8	[41.5–48.1]		78	8.6	[6.8–10.6]		563	62.0	[58.7–65.1]

*6–8 months old (n = 47); Sow/Boar (n = 30); at least 6 months old (n = 108).

E-farm: Extensive farm; SE-farm: semi-extensive farm; C-farm: closed farm; Herds: pigs without associated age.

For PSV and PKoV, there was no statistical association with the type of breeding system; in contrast, PAstV-1 was detected more frequently in C-farms compared with SE- and E-farms (P-value = 9.6e–6) (Table 2).

Significant differences were observed for all three viruses according to age (P-value = 2.4e–13 for PAstV-1; 2.4e–12 for PKoV and 0.005 for PSV) (Table 2). RNA virus detection by age group showed a significant decrease in the rate of positive cases after three months for PAstV-1 (30.6% vs. 6.0%; P-value = 3.87e–7) and between 1 and 3 months (69.4%) and in adults (28.9%) for PKoV (P-value = 6.37e–12). For PSV, the detection rates by age group were between 61.0% and 77.5% (Fig 1). However, the positivity rate among pigs under six months of age was significantly lower than that in pigs older than 6 months (71.4% vs. 61.1%; P-value = 0.014; OR = 1.59, CI 95% 1.09–2.32).

Fig 1

Detection rate of each RNA virus by age group.

Description of coinfections in samples of pig feces

Table 3 lists all infections and coinfections detected in pig feces samples. Of the 908 samples tested, 697 samples were positive for at least one virus (76.8%). A total of 344 samples contained at least two distinct viral RNA (37.9%), of which 259 specimens (28.5%) were coinfected by two viruses, 78 specimens (8.6%) were coinfected by three viruses and seven specimens (0.8%) were positive for all four viruses (Table 3).

Table 3

Coinfections in pig feces samples.

	N
No infection	211	Number for each coinfection
Single infection	353	PKoV	PSV	PAstV-1	HEV
		102	229	9	13
Double infection	259	PKoV/PSV	PKoV/PAstV-1	PKoV/HEV	PSV/HEV	PAstV-1/PSV	PAstV-1/HEV
		216	4	3	21	14	1
Triple infection	78	PKoV/PAstV-1/PSV	PKoV/HEV/PSV	PKoV/HEV/PAstV-1	HEV/PAstV-1/PSV
		39	35	2	2
All four viruses	7

Detection rate of viral RNA at the farm level

At least one pig was detected positive for PKoV RNA in each of the 16 pig farms sampled (100%), 62.5% for PAstV-1 infection (n = 10/16) and 93.8% for PSV infection (n = 15/16). The positivity rate at farm level ranged between 22.5% and 80.8%, 0.0% and 34.0%, and 0.0% and 87.5% for PKoV, PAstV-1 and PSV, respectively. The detail of the detection rates of the three viruses for each farm were presented on the S1 Table.

Multivariate analysis: Associated factors identified for each viral infection

A multivariate logistic regression analysis was performed, and the results showed associations depending on the three viruses (Table 4). A strong association was observed between PKoV and PSV detection (OR = 3.36 [2.44–4.67]; P-value = 9.1e–15). PKoV was also associated with PAstV-1 codetection (OR = 2.16 [1.29–3.70]; P-value = 0.015) and young pigs under 4 months of age (OR = 3.11 [2.31–4.20]; P-value = 4.3e–10). PAstV-1 detection was also associated with age, with pigs over 3 months of age significantly less frequently infected than younger pigs (OR = 0.18 [0.11–0.29]; P-value = 2.8e–9). PSV infection was not associated with age or type of breeding.

Table 4

Statistical analysis of factors associated with each virus (multivariate logistic regression model with random effect at the farm level).

Viruses	Factor	Condition	OR	[95% CI]	P-value adjusted
PKoV	Coinfection	PSV	3.36	[2.44–4.67]	9.1e–15
	Coinfection	PAstV-1	2.16	[1.29–3.70]	0.015
	Age group	0–4 months	3.11	[2.31–4.20]	4.3e–10
PAstV-1	Coinfection	PKoV	2.25	[1.32–3.90]	0.014
	Age group	>3 months	0.18	[0.11–0.29]	2.8e–9
PSV	Coinfection	HEV	2.01	[1.17–3.64]	0.041
	Coinfection	PKoV	2.92	[2.13–4.04]	3.7e–8

Only factors with P‐values < 0.05 are included.

Next-generation sequencing (NGS)

In addition to the three viruses studied by RT–qPCR, NGS analysis was performed in a second phase on 26 random selected samples. Overall, consensus sequences corresponding to 10 different species of virus were obtained. PAstVs were detected in ten samples (38.5%), porcine stool/serum-associated circular virus in six (23.1%), Bocavirus in five (19.2%), Sapelovirus and Posavirus in four (15.4%), Circovirus in three (11.5%), Pasivirus in two (7.7%) and Rotavirus and porcine Enterovirus G in one (3.8%). Among these samples, 14 (54%) had consensus sequences corresponding to at least two different viruses.

Porcine astroviruses strains detected among our samples were closed to pig strains from different countries: Hungary (JQ340310 90.81–92% of identity); United States (KJ495987 93.36% of identity) and New Zealand (KJ495990 92.8% of identity). The main astroviruses found, were Mammastrovirus 3, Porcine Astrovirus 2 and 4. Concerning Bocaviruses strains detected, identity of 97.08% was determined with pigs from: a Hungrian domestic pig (KF206167), 95–97.65% with a Chinese pigs (KX017193; KM402139 and HM053693), 94.13–96.48% with an American pigs (KF025394 and KF025484) and 95.28% with a Croatian pig (KF206161). Concerning, the sequences obtained for the Sapelovirus, the strongest homologies were observed when compared with strain MH513612 also isolated in Corsica (92–99.91% of identity) [24].

For the other results, Table 5 summarizes all the sequences obtained, their length, the reference sequence to which each corresponds and the percentage of nucleotide identity with this sequence. Six of the recovered sequences had a quality score required for submission to Genbank and the accession numbers range from OL739527 to OL739532.

Table 5

Diversity of sequences found in pig feces and percentage of identity with strains in the literature.

Samples	Accession number	Viruses	Sequence of reference	Accession number of the sequence of reference	Consensus length	% Cover	% Identity
1	/	/	/	/	/	/	/
2	OL739527	Sapelovirus	Sapelovirus A strain OPY-1-Corsica-2017 polyprotein gene, complete cds	MH513612	5,927	96	92.46
	/	Bocavirus	Porcine bocavirus strain G85-1AT-HU, complete genome	KF206167	3,507	100	97.08
	/	Bocavirus	Porcine bocavirus 3C isolate pig/ZJD/China/2006, complete genome	JN681175	3,683	99	91.61
	/	Porcine Astrovirus	Mamastrovirus 3 isolate PAstV_GER_L00855-K14_14–04_2014 genome assembly, complete genome: monopartite	LT898434	1,508	52	90.88
3	/	Sapelovirus	Sapelovirus A strain OPY-1-Corsica-2017 polyprotein gene, complete cds	MH513612	492	100	93.09
4	/	Bocavirus	Porcine bocavirus strain CH/HNZM, complete genome	KX017193	2,105	99	97.22
	/	Porcine Astrovirus	Astrovirus wild boar/WBAstV-1/2011/HUN, complete genome	JQ340310	428	100	91.59
	/	Porcine serum-associated circular virus	Porcine serum-associated circular virus isolate BR3, complete genome	KU203353	531	86	86.33
	/	Enterovirus G	Enterovirus G isolate GER/F9-6/12-02-2013 polyprotein gene, partial cds	MF113376	956	100	86.72
5	/	Sapelovirus	Porcine Sapelovirus isolate PSV_P1-3-3_Contig(g12h12) polyprotein gene, partial cds	KF705647	498	98	92.77
	/	Sapelovirus	Sapelovirus A strain OPY-1-Corsica-2017 polyprotein gene, complete cds	MH513612	1,687	100	92.12
	/	Sapelovirus	Sapelovirus A isolate HuN21 polyprotein gene, complete cds	MF440649	1,230	100	86.59
	/	Sapelovirus	Sapelovirus A isolate PSV_GER_L00798-K11_14–02_2014 genome assembly, complete genome: monopartite	LT900497	1,894	100	87.08
	/	Bocavirus	Porcine bocavirus strain 644-1DI-HR, complete genome	KF206161	4,580	100	95.28
	/	Bocavirus	Porcine bocavirus isolate GD11, complete genome	KM402139	4,580	100	95.09
	/	Porcine Astrovirus	Porcine astrovirus 2 clone KDC-6 ORF1ab gene, partial cds; and ORF2 gene, complete cds	KJ495987	466	100	93.36
	/	Porcine Astrovirus	Porcine astrovirus 2 genes for ORF1ab, ORF1a, ORF2, complete cds, strain: PoAstV2/JPN/HgYa2-3/2015	LC201588	422	100	87
	/	Porcine Astrovirus	Astrovirus wild boar/WBAstV-1/2011/HUN, complete genome	JQ340310	533	100	90.81
	/	Porcine stool-associated circular virus	Porcine stool-associated circular virus 7 isolate EP2-B, complete genome	KJ577813	1,191	99	82.59
6	/	Posavirus	Posavirus 1 isolate PsaV_GER_L01017-K01_15–07_2015 genome assembly, complete genome: monopartite	LT898419	741	100	96.63
	/	Posavirus	Posavirus sp. isolate 12144_61, complete genome	KX673217	559	100	97.5
	/	Bocavirus	Porcine bocavirus 3 isolate IA159-3 NS1 and NP1 genes, complete cds; and VP1/VP2 gene, partial cds	KF025387	491	100	84.85
	OL739528	Porcine serum-associated circular virus	Porcine serum-associated circular virus isolate BR3, complete genome	KU203353	929	99	86.03
7	/	/	/	/	/	/	/
8	/	/	/	/	/	/	/
9	OL739529	Circovirus	Circovirus sp. isolate PoCirV_VIRES_JL01_C5 capsid protein gene, partial cds	MK377643	1,038	100	85.17
	/	Circovirus	Circovirus sp. isolate PoCirV_VIRES_GX05_C4 replicase gene, partial cds	MK377558	639	64	89.54
	/	Porcine Astrovirus	Porcine astrovirus 2 genes for ORF1ab, ORF1a, ORF2, complete cds, strain: PoAstV2/JPN/Ishi-Ya4/2015	LC201589	879	78	82.61
	OL739530	Porcine Astrovirus	Porcine astrovirus 4 genes for ORF1ab, ORF1a, ORF2, complete cds, strain: PoAstV4/JPN/Bu5-10-2/2014	LC201603	989	100	83.64
10	/	Bocavirus	Porcine bocavirus 1 pig/ZJD/China/2006, complete genome	HM053693	383	100	97.65
11	/	Porcine Astrovirus	Porcine astrovirus 4 isolate 15–12, complete genome	KU764486	1,624	99	87.98
	/	Porcine Astrovirus	Porcine astrovirus 4 isolate 15–13, complete genome	KU764484	1,624	99	88.21
	/	Porcine stool-associated circular virus	Porcine stool-associated circular virus 7 isolate EP3-C, complete genome	KJ577814	719	100	86.77
12	/	Posavirus	Posavirus sp. isolate 17668_12, complete genome	KX673279	1,606	93	85.53
13	/	Porcine Astrovirus	Porcine astrovirus 4 strain JXJA, complete genome	KX060808	1,187	100	89.9
	/	Bocavirus	Porcine bocavirus 3 isolate IL330 NS1 and NP1 genes, complete cds; and VP1/VP2 gene, partial cds	KF025394	483	100	96.48
14	/	Porcine Astrovirus	Porcine astrovirus 4 strain 35/USA, complete genome	JF713713	1,798	100	90.12
	/	Porcine Astrovirus	Porcine astrovirus 4 strain CH/JXZS/2014, complete genome	KX060809	1813	100	90.13
15	OL739531	Porcine Astrovirus	Mamastrovirus 3 isolate PoAstV_VIRES_HeB02_C4 ORF1ab and ORF1a genes, partial cds	MK378508	2,192	100	90.81
	/	Circovirus	Circovirus sp. isolate PoCirV_VIRES_SD02_C2 replicase gene, partial cds	MK377699	557	100	88.6
16	OL739532	Circovirus	Circovirus sp. isolate PoCirV_VIRES_HeB04_C3 capsid protein gene, partial cds	MK377607	777	100	90.27
17	/	Porcine Astrovirus	Porcine astrovirus 4 genes for ORF1ab, ORF1a, ORF2, complete cds, strain: PoAstV/JPN/MoI2-1-2/2015	LC201610	869	100	89.31
	/	Porcine Astrovirus	Porcine astrovirus 2 clone NZP-93_Subtype_2 ORF1ab gene, partial cds	KJ495990	375	100	92.8
	/	Bocavirus	Porcine bocavirus 3 isolate IA13-1 VP1/VP2 gene, complete cds	KF025484	931	100	94.13
	/	Porcine Astrovirus	Mamastrovirus 2 isolate U083, complete genome	KY940077	2,043	100	80.33
	/	Porcine Astrovirus	Mamastrovirus 3 isolate PoAstV_VIRES_GZ04_C10 ORF1ab and ORF1a genes, partial cds	MK378502	869	100	89.77
18	/	Porcine Astrovirus	Porcine astrovirus 4 genes for ORF1ab, ORF1a, ORF2, complete cds, strain: PoAstV4/JPN/Ishi-Ya7-1/2015	LC201613	1,970	91	89.22
	/	Porcine Astrovirus	Mamastrovirus 2 isolate U083, complete genome	KY940077	5,230	85	87.06
	/	Porcine Astrovirus	Mamastrovirus 3 isolate PAstV_GER_L00855-K14_14–04_2014 genome assembly, complete genome: monopartite	LT898434	4,050	100	85.87
19	/	/	/	/	/	/	/
20	/	Sapelovirus	Sapelovirus A strain OPY-1-Corsica-2017 polyprotein gene, complete cds	MH513612	2,360	100	99.91
	/	Pasivirus	Swine pasivirus SPaV1/US/17-50816IA60467-1/2001 polyprotein gene, complete cds	MG674090	1,186	100	77.88
	/	Porcine stool-associated circular virus	Porcine serum-associated circular virus isolate BR2, complete genome	KU203352	1,168	99	92.76
21	/	/	/	/	/	/	/
22	/	Rotavirus	Porcine rotavirus B isolate PoRVB_VP2_VIRES_NM01_C2 VP2 gene, partial cds	MK379346	55	100	98.18
23	/	/	/	/	/	/	/
24	/	Posavirus	Posavirus sp. isolate 17668_12, complete genome	KX673279	3,003	100	88.71
	/	Pasivirus	Pasivirus A isolate SPaV-A GER L01061-K07 15–03 2015 genome assembly, complete genome: monopartite	LT898422	451	100	83.44
	/	Porcine stool-associated circular virus	Porcine stool-associated circular virus 7 isolate EP3-C, complete genome	KJ577814	702	100	83.25
25	/	/	/	/	/	/	/
26	/	Posavirus	Posavirus sp. isolate 17668_13_2, complete genome	KX673281	1,282	99	89.31
	/	Posavirus	Posavirus 3 strain 10611 polyprotein gene, complete cds	KT833079	860	100	94.07
	/	Posavirus	Posavirus strain 7048 polyprotein gene, partial cds	KT833076	1.121	99	87.92

Discussion

This study investigated the detection rate of three enteric viral infections, PKoV, Astrovirus-1 and Sapelovirus, in 908 pigs of different ages and breeding systems. To our knowledge, this work is the first to study factors associated with presence of viral RNA of PSV, PKoV and PAstV-1 in stools of domestic pigs in France.

RNA detection rate of the three enteric viruses

PSV was the most prevalent (62%) and observed rates are higher than those described in the US, Brazil and India (7–31%) [9, 17, 20]. However, the existing results for PSV are not all performed with the same method (SYBR, classical RT-qPCR, NGS) so it is complicated to compare the results in the literature.

PKoV RNA was detected in almost half of samples, which is similar to data reported from pig farms in China (45.7%) [42] and Japan (45.4%) [43]. In five European countries, PKoV infections have been described previously as highly prevalent in both diarrheic and healthy pigs, 54.5% and 58.2%, respectively [8].

PAstV-1 RNA was detected in less than 10% of our samples, but comparison is difficult because other studies were performed at the genus level (Mamastrovirus: 52% positive) [9] or for all PAstVs combined (Thailand: 6.5%; MN, USA: 62%; Slovakia: 93.2%) [44-46].

Very early exposure of pigs

The analysis of the detection of viral RNA according to pig age showed that for all viruses tested, pigs < 4 months old were consistently the age group exhibiting the highest rate. This association between age and rate of infection was confirmed for PKoV and PAstV-1 in the multivariate analysis. It may correlate with high exposure after weaning (about 2 months after birth) but also suggest persisting presence of viruses in the breeding environment and loss of maternal immunity. Piglet passive immunity is derived from colostrum and not from breastfeeding [47], with a decrease in immunoglobulins A, G and M after farrowing [48]. This trend was also observed during our previous study of HEV) [34]. Correlation of decreasing positivity rates and increasing age of pigs is described for Kobuviruses in Italy [49] and East Africa [50]. A higher PKoV detection rate in young piglets has also been reported in other studies [10, 51, 52]. However, the kinetics of infection were different in each study and may depend on the organization of each farm and other environmental characteristics. Study in different age-group 0-1months, 1-2months, etc. or follow-up of individual animals could help confirming this hypothesis.

In traditional Corsican farms, the average slaughter age is higher (12–18 months) compared with industrial farms. Therefore, at the time of slaughtering the majority of Nustrale Corsican pigs will have cleared replicative viral infection. The same finding was already reported for hepatitis E virus [34]. In contrast, the situation is different for Sapeloviruses with rates of replicating infection at 60% in adult pigs. Farming type does not seem to influence the detection rates of studied viruses but still need confirmation from future studies.

A potentially very broad spectrum of viruses in pig feces

In this study, 37.9% of pigs were coinfected with at least two different viruses (including HEV). Strong trends were observed in the multivariate analysis regarding the associations between different viral infections (PKoV/PSV, PKoV/PAstV-1, PSV/HEV and PSV/PKoV). This wide variety of viruses in the feces was confirmed with the NGS method, which showed the presence of other viruses frequently found in pigs: Posavirus, other Astroviruses, Bocavirus, Enterovirus G, Circovirus, Pasivirus and Rotavirus. Coinfections were also evidenced in the NGS results, with more than half of the samples containing consensus sequences corresponding to at least two different viruses. These results are in line with previous studies reporting multiple coinfections of farmed pigs with porcine enteric viruses [6, 37], especially in pigs with diarrhea [53-55]. Our results are also interesting concerning the epidemiological cycle of HEV because co-infections can diminish the immune system of pigs, change the symptomatology of infections, [56, 57]. For example, experimental co-infection of HEV with Porcine Reproductive and Respiratory Syndrome Virus significantly prolongated HEV shedding [58].

Our study has several limitations. First, it was not initially designed to study these three viruses but to determine the prevalence of the HEV in pig farms in Corsica. Differences in detection could exist depending on criteria such as sampling time and place, age of pigs and clinical background of the tested animal population (diarrheic or healthy pigs). The lack of collection of clinical information (diarrhea or other symptoms) for the pigs included may have led to a bias in the analysis of the data; these data could have been essential for the improvement of knowledge concerning the studied viruses. The number of viruses studied could also have been larger to better assess the presence of major enteric viruses in Corsican pig farms. Finally, the lack of phylogenetic analysis of the different strains found is also a major limitation of our study. Indeed, the sequences obtained being in very varied zones of the genome of the various viruses, the phylogenetic analyses could not be realized.

In future studies, information about possible symptoms in pigs should be collected. It would also be useful to evaluate the phylogeny of the different strains found and to set up an RT–qPCR primer system to distinguish the different strains of Sapelovirus. Moreover, in view of the large variety of viruses present in the pig feces and the availability of microfluidic PCR technology, it would be helpful to set up microarrays that can detect all the principal known porcine enteric viruses. Moreover, the real impact of Kobuvirus, Astroviruses, Sapelovirus and other enteric viruses on animal health and breeding systems remains largely unknown and needs further epidemiological studies.

In conclusion, this study provides first insight on the presence of three common porcine enteric viruses in France and showed that they are frequently encountered in Corsica in pig farms using the traditional extensive breeding. The three viruses studied were found on almost all the farms, indicating widespread distribution. Moreover, the pigs tested were born and bred in Corsica, which demonstrates endemic local circulation. Whether such infections and co-infections can affect the productivity, impact the growth of pigs or cause immune weakness remains to be established. So far, this study has to be considered as a first step in the study of enteric viruses in Corsican pig farms.

Positivity rates for the three viruses by pig farm.

(DOCX)

Click here for additional data file.

(DOCX)

Click here for additional data file.

11 Sep 2021

PONE-D-21-15693Detection of porcine enteric viruses (Kobuvirus, Mamastrovirus and Sapelovirus) in domestic pigs in Corsica, France.PLOS ONE

Dear Dr. Capai,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. See the reviewers' comments on your manuscript.

The work is well designed, written and the results are interesting; however, there are several important points of concern that need to be addressed.

Sincerely

Please submit your revised manuscript by Oct 25 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Humberto Rodney Colina Muñoz, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“The authors are grateful to all breeders for their participation in the study. Part of this study was funded by the territorial collectivity of Corsica (CDC) and the National Institute of Health and Medical Research (INSERM). The Hepatitis E Virus project of UR BIOSCOPE was also financed by the CDC.”

We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“Part of this study was funded by the territorial collectivity of Corsica (CDC) and the National Institute of Health and Medical Research (INSERM). The Hepatitis E Virus project of UR BIOSCOPE was also financed by the CDC.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

3. "In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

"Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter

4. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.

5. Please include a caption for figure 1.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is a nice, descriptive work, aimed to study the frequency of detection of 3 porcine, enteric viruses in herds form Corsica, previously investigated for HEV infection. The study is of interest to the field given that these are very poorly studied pathogens, and thus very little is known concerning their epidemiology and distribution.

The research was properly designed, the draft is well written, and the results are satisfactorily presented in general. However I have several major concerns that must be addressed.

Major points

1. Authors should re define the main objective of the study. Should clarify what is " to investigate the circulation....". The objective should not be a mere statement, but must be descriptive.

2. Sampling:

a. Were the animals healthy? Please clarify this in Mat and Meth section.

b. How di you collect stool samples' individually' from te ground? Can you be sure that that feces you collected corresponded to only 1 animal?

c. Related to b. Did the pigs (E or SE-farm) share breeding area with other animals? Including occasional feral mammals? Did you investigate presence of feces coming from animals, others than pigs?

c. Th amount of samples per breeding system should be included also in the text.

3. How were the 26 samples selected for NGS analysis? Which was the criterion? Please clarify.

4. Two phages was used as QC of the extraction process. However, it is not clear which was the % of recovery after processing the samples. Please include this information.

5. It is quite surprising that the younger animals (1-2 months), supposed to still have maternally-derived antibodies, presented the highest frequency rate for all viruses. I would expected that for animals > 3 or 4 months, after loosing those protective antibodies (as seen,i.g, for HEV). Maybe vertical transmission is not negligible in the enteric viruses investigated in this work, and it indeed may be playing a role in a scenario of heavy endemic viral transmission. Please provide a deeper discussion in this issue.

6. Related to point 5, and considering some technical issues, please provide a summary (mean, SD, etc) of Ct values for the samples, particularly for the SYBR green detection approach. Did the authors performed end-point PCR approaches to confirm the findings? Please discuss the first point.

7. Authors must perform a preliminary phylogenetic reconstruction for PAstV sequences, at least using ORF2. Please submit and provide Genbank accession numbers for the employed sequences.

8. Delete lines 260-263.

Minor points

Line 150: Check spelling

Line 241: Percentage of homology is not correct. Substitute by: percentage of nucleotide identity. Same for 231-232, etc.

Table 4: No of Pig Farm

Color should be avoided in the tables.

Thank you.

Reviewer #2: Capai et al present a study investigating the presence of three viruses (Porcine Sapelovirus, Porcine Kobuvirus and

porcine Astrovirus in 908 fresh pig stool samples using differents molecular assays. Additionally, they investigated the presence of enteric viruses in 26 samples using NGS.

Although in many cases, these viruses have been detected in animals without clinical disease, the impact of these viruses on pig disease is not well understood and consequently the information generated may be of interest in this field.

The first part of this work is well designed and represents the main results that indicate a high circulation of the viruses studied and its relationship with the presence of other viruses and the age group. However, I find some inconsistencies in the second part of this study. Data from the analysis by NGS of 26 samples are added and it is not explained which was the selection criteria of these samples or the relationship with the previous study. Furthermore, since a phylogenetic analysis was not possible, the information provided cannot be considered representative of the strains detected in this study. Consequently, I consider that this manuscript should be revised to improve its value.

Other minor comments

1-Line 88-92: in these lines it is proposed to relate the epidemiological cycle of HEV with coinfectant viruses. However, no mention is made of the results obtained in the discussion.

2- Line 96: The time period in which the samples were collected is not described. It should be clarified in the manuscript.

3- Line 243. Table 4. I find this table unnecessary in the manuscript. It could be placed as supplementary material. I do not find in it that the importance of these results is discussed.

4- Line 258: What is the influence of using Syber Green PCR for the detection of PSV? RT-qPCR was used for the other 2 viruses. Can the use of this method explain the differences in prevalences found by other researchers?

5- Line 329: How did you demonstrate the endemic circulation of these viruses?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

1 Nov 2021

Dear Reviewers,

We would like to thank you for the constructive and helpful comments to our manuscript.

We have revised the manuscript and submitted a revised manuscript using the “Track Changes” tool in Microsoft Word for your consideration.

Please find below our point-by-point response.

All co-authors have read and approved the manuscript.

Should you have any further questions please do not hesitate to contact us.

Kind regards,

Lisandru Capai.

Reviewer(s)' Comments to Author:

• Reviewer #1:

“This is a nice, descriptive work, aimed to study the frequency of detection of 3 porcine, enteric viruses in herds form Corsica, previously investigated for HEV infection. The study is of interest to the field given that these are very poorly studied pathogens, and thus very little is known concerning their epidemiology and distribution.

The research was properly designed, the draft is well written, and the results are satisfactorily presented in general. However, I have several major concerns that must be addressed.”

Major points

1. Authors should re define the main objective of the study. Should clarify what is " to investigate the circulation....". The objective should not be a mere statement, but must be descriptive.

Author’s response: We changed the sentence “The main aim of this study was to detect and characterize three common porcine enteric viruses (PKoV, PAstV-1 and PSV) by molecular detection analysis of faeces collected within Corsican pigfarms.” Line 92 to 94.

2. Sampling:

a. Were the animals healthy? Please clarify this in Mat and Meth section.

Author’s response: We added a sentence on the Mat and Meth section: “Information on the individual health status of the pigs was not collected by a case report form. However, there is no apparent disease in the farms during the collect.” Line 107 to 110.

b. How did you collect stool samples' individually' from the ground? Can you be sure that that feces you collected corresponded to only 1 animal?

Author’s response: We have collected individually from the ground (the individual level was control for each sample; feces were collected directly after defecation). Precision added on the Mat and met part Line 101.

c. Related to b. Did the pigs (E or SE-farm) share breeding area with other animals? Including occasional feral mammals? Did you investigate presence of feces coming from animals, others than pigs?

Author’s response: Indeed, in extensive or semi-extensive farms pigs can share the area of breeding with other wild/domestics animals (like wild boars, cows, or sheep) that get through the fences (SE) or that the pigs cross during their routes (E). However, in this study we have only collected pig samples.

d. The amount of samples per breeding system should be included also in the text.

Author’s response: We added a sentence on the Results part “Overall, 908 samples were available for the detection of the three virus of interest, 310 were from E-farms, 396 from SE-farm and 201 from C-farm.” Line 187 to 188.

3. How were the 26 samples selected for NGS analysis? Which was the criterion? Please clarify.

Author’s response: Only, 26 analyses could be realized for financial reason and these 26 samples were randomly selected among the overall samples. We added a sentence in the material and methods part. Line 153-154

4. Two phages was used as QC of the extraction process. However, it is not clear which was the % of recovery after processing the samples. Please include this information.

Author’s response: We added a sentence on the Mat et Methods part “Each pool was spiked before extraction with a predefined amount of MS2 bacteriophage in order to monitor the subsequent steps (nucleic acid purification, reverse transcription and PCR amplification) and to detect the presence of inhibitors and enzymatic reactions as described. All extractions and RT-qPCRs were checked with the presence of a curve for phage and positive and negative controls respectively.” Line 118 to 123.

5. It is quite surprising that the younger animals (1-2 months), supposed to still have maternally-derived antibodies, presented the highest frequency rate for all viruses. I would expected that for animals > 3 or 4 months, after loosing those protective antibodies (as seen,i.g, for HEV). Maybe vertical transmission is not negligible in the enteric viruses investigated in this work, and it indeed may be playing a role in a scenario of heavy endemic viral transmission. Please provide a deeper discussion in this issue.

Author’s response: This point confirms the hypotheses that passive immunity of piglets is due to colostrum and not to breastfeeding. Furthermore, we believe that it is possible that the highest percentages of infections occur when the piglets leave the mother and are more strongly exposed to viruses in their new environment. In Corsica, these occurs 40 and 60 days after the birth. Study in different age-group 0-1months, 1-2months, etc. or follow-up of individual animals could help answering this question.

6. Related to point 5, and considering some technical issues, please provide a summary (mean, SD, etc) of Ct values for the samples, particularly for the SYBR green detection approach. Did the authors performed end-point PCR approaches to confirm the findings? Please discuss the first point.

Author’s response: We added a Summary table concerning the results of qRT-PCR for the three viruses of interest in the supplemental data (Supplementary Table 2). All our results were checked with classical positive and negative controls.

7. Authors must perform a preliminary phylogenetic reconstruction for PAstV sequences, at least using ORF2. Please submit and provide Genbank accession numbers for the employed sequences.

Author’s response: The different sequences obtained cannot be analyzed in phylogeny because they do not concern the same areas of the genome. Even for PAstV sequences it is not possible to do phylogeny on ORF2 because they are on other regions of the genome and the alignment is not feasible. We will be attentive to this in our next studies in order to deepen the results with phylogeny. We have submitted the sequences and are waiting for the accessions numbers. You will find the proof of submission attached. The accession numbers of our sequences will be add in the Table 5.

8. Delete lines 260-263.

Author’s response: We deleted these lines.

Minor points

Line 150: Check spelling � Done

Line 241: Percentage of homology is not correct. Substitute by: percentage of nucleotide identity. Same for 231-232, etc. � Done

Table 4: No of Pig Farm � Done

Color should be avoided in the tables. � Done

Thank you.

• Reviewer #2:

Capai et al present a study investigating the presence of three viruses (Porcine Sapelovirus, Porcine Kobuvirus and porcine Astrovirus in 908 fresh pig stool samples using differents molecular assays. Additionally, they investigated the presence of enteric viruses in 26 samples using NGS.

Although in many cases, these viruses have been detected in animals without clinical disease, the impact of these viruses on pig disease is not well understood and consequently the information generated may be of interest in this field. The first part of this work is well designed and represents the main results that indicate a high circulation of the viruses studied and its relationship with the presence of other viruses and the age group.

Author’s response: We thanked the reviewer for his comment.

However, I find some inconsistencies in the second part of this study. Data from the analysis by NGS of 26 samples are added and it is not explained which was the selection criteria of these samples or the relationship with the previous study.

Author’s response: Only, 26 analyses could be realized for financial reason and these 26 samples were randomly selected among the overall samples. We added a sentence in the material and methods part. Line 153-154

Furthermore, since a phylogenetic analysis was not possible, the information provided cannot be considered representative of the strains detected in this study. Consequently, I consider that this manuscript should be revised to improve its value.

Author’s response: We have submitted the sequences and are waiting for the accessions numbers. You will find the proof of submission attached. The accession numbers of our sequences will be add in the Table 5.

Other minor comments

1-Line 88-92: in these lines it is proposed to relate the epidemiological cycle of HEV with coinfectant viruses. However, no mention is made of the results obtained in the discussion.

Author’s response: We added sentences in the discussion part Line 314-318.

2- Line 96: The time period in which the samples were collected is not described. It should be clarified in the manuscript.

Author’s response: We had a sentence on the Mat et Methods part “All the samples were collected between April and September 2017.” Line 110-111.

3- Line 243. Table 4. I find this table unnecessary in the manuscript. It could be placed as supplementary material. I do not find in it that the importance of these results is discussed.

Author’s response: We transferred this table on the Supplementary material.

4- Line 258: What is the influence of using Syber Green PCR for the detection of PSV? RT-qPCR was used for the other 2 viruses. Can the use of this method explain the differences in prevalences found by other researchers?

Author’s response: Indeed, the different method used to detect the virus make the results not comparable. We added a sentence to precise this point. Line 272-274

5- Line 329: How did you demonstrate the endemic circulation of these viruses?

Author’s response: In our opinion, the presence of the different viruses in numerous farms across the island and the observed prevalences may lead to the hypothesis of a real endemic circulation on the island.

De : gb-admin@ncbi.nlm.nih.gov [mailto:gb-admin@ncbi.nlm.nih.gov]

Envoyé : mercredi 27 octobre 2021 17:43

À : Lisandru CAPAI ; lisandru.capai@gmail.com

Objet : GenBank Submissions grp 8269814

Dear Dr. Capai:

We have received the following 55 sequence submission(s) from you:

BankIt2512508 : (55)

It appears that these may be metagenomically derived virus sequences.

Please clarify whether you:

[a] Purified viral particles and sequenced the DNA.

[b] Sequenced mixed DNA from a metagenomic source and then

binned the viral sequences into assemblies.

[c] assembled third party reads obtained from a public database.

Please explain exactly how these sequences were generated.

Send your reply to: gb-admin@ncbi.nlm.nih.gov

If we do not hear from you by Nov 10, 2021, all of your submission(s)

will be deleted from the processing queue.

Thank you for your attention. We will not assign GenBank Accession

Numbers or further process your submissions until we hear from you.

For your reference, please find your preliminary records below.

Please reply using the current Subject line.

Sincerely,

Linda Frisse, PhD

The GenBank Submissions Staff

Bethesda, Maryland USA

*******************************************************************

gb-admin@ncbi.nlm.nih.gov (for replies and updates to current records)

info@ncbi.nlm.nih.gov (for general questions regarding GenBank)

*******************************************************************

preliminary GenBank Flatfile(s):

LOCUS Seq01 5927 bp RNA linear VRL 26-OCT-2021

DEFINITION Sapelovirus A strain PSV-1-LC-Corsica-2017.

ACCESSION

VERSION

KEYWORDS .

SOURCE Sapelovirus A

ORGANISM Sapelovirus A

Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;

Picornavirales; Picornaviridae; Sapelovirus.

REFERENCE 1 (bases 1 to 5927)

AUTHORS Capai,L., Piorkowski,G., Maestrini,O., Casabianca,F., de

Lambellerie,X., Charrel,R. and Falchi,A.

TITLE Direct Submission

JOURNAL Submitted (26-OCT-2021) URBIOSCOPE 7310, Universite de Corse

Pasquale Paoli, CAMPUS GRIMALDI BAT PPDB, CORTE, CORSICA 20250,

FRANCE

COMMENT Bankit Comment: LocalID:Seq01.

##Assembly-Data-START##

Assembly Method :: CLC GENOMICS v. WORKBECH 21.0.5

Sequencing Technology :: IonTorrent

##Assembly-Data-END##

FEATURES Location/Qualifiers

source 1..5927

/organism="Sapelovirus A"

/mol_type="genomic RNA"

/isolate="Corsica, France"

/isolation_source="Pig feces sample"

/host="Domestic pig"

/db_xref="taxon:686984"

/country="France"

/collection_date="2017"

BASE COUNT 1809 a 1165 c 1326 g 1627 t

ORIGIN

1 ccttaaggtg gttgtatcca cataccccac cctcccttcc aaagcggatg gacaaacgga

61 ctttgactta tggcgagttt acacggtatg atttttggat acacttgaat ggtagtagcg

121 tggcgagcta tggaaaaatc gcaattgtcg atagccatgt tagtgacgcg cttaggcgtg

181 ctcctttggt gattcggcga ctggttacag gagagtaggc agtgagctat gggcaaacct

241 ctacagtatt acttagaggg aatgtgcaat tgagacttga cgagcgtctc tttgagatgt

301 ggcgcatgct cttggcatta ccatagtgag cttccaggtt gggagacctg gactgggcct

361 atactacctg atagggtcgc ggctggccgc ctgtaactag tatagtcagt tgaaaccccc

421 ccatggaatc tactactact ctttcatttt gcaactggat ccctaagaag cagagagccc

481 gtgtgtacct caccaccagt gtgacacacg agaaatcaat tgggccatat acgtatgtgg

541 tctcagacat gatcatgaaa gaaaatagta gaacctctct tgccatggca tacgtggaag

601 ggaagacact agtgttcaac actggaactc aattgggtca agtacattca gccaacactg

661 gaaacaaacc acaaggtgca tacaatcatg gttctggcag tataacacag gttaactact

721 atggctctga ctactcacag gcatggaatc ccacacaaca acagatggac ccatcgcaat

781 tcaccaaacc cgtcacagaa attgctagta tggtagcagg gtccaacaca ccagcaggac

841 ctgcactcaa ggcacctgac aaggaagaag aaggttacag tgacagactg atgcagctaa

901 cagctggcaa ctcctgtata acaacacagg aggcggcaaa ggcagtggtg gcatatggcc

961 aatggcctag ctataacata gatggaggag aacatttgga cctggccacc actcctggaa

1021 cagcagtaga caggttctat acttttgaca gcttacagtg gactaacact cagataggtg

1081 aatggtcttt acccttgcct ggtggtctaa tggatactgg tgtatttggt caaaatttaa

1141 gatttcacta tctgtctaga atgggttttt gtgtacacgt acaatgtaat gcatcaaagt

1201 tccatcaggg tgcattgata attgctatga tccctgaaca tcaaaccccc acacaggttg

1261 ctaatagttt tgcttatgac cgtgttccca caccaaatca taaatctcag aaccaacaac

1321 tctgcaacaa tagtataccc gtacactaat tgtacacctg caggttttgg attagcacat

1381 aattttgtaa cattagttat tagagtatta gtgcccctta gatataatga tggtgcctcc

1441 acctttgtgc ccataacagt tagtgtagcc ccaatgtgtt cccaatttgc aggcttgaga

1501 tctgctgtag caaggcaagg tttccctgtt agacaggtac caggaagtca acaatttatg

1561 acaacacaaa gagacaatgg tatacctata taccctgaat ttgagaagac acatggtttt

1621 aaactacctg gtagagtgac taacctgcta caagtagccc aagtagggac atttttgaaa

1681 tttaggaata ataccaatga tgtatgattt ctagtcattt ggttacaacc tatctttctc

1741 gtttggcaca aatgtatgca aattatagag ggtctgttgt gtttgaattt atgttttgtg

1801 gcagccaaat ggccactgga aaactgctta ttgcatacac accaccaggt ggctcctcac

1861 caacaacaag aactgatgca atgttggcaa cacatgttat ttgggacatc ggcctacaat

1921 caacatgtaa acttgtggtt ccttatatat ctgcatctca gtacagacaa aacaatgtaa

1981 accaaaccac tttgtcatac aatgggtggg tgactgtgtt ccaacaaaca gcactcgtgg

2041 tacccccagg tgcaccatca acatgtcaac tggtggtcac tgttagtgca gcagataatt

2101 ttgtattgag gattcccact gacacaactt actttgcaga ctaccaaggt gacgtcaagg

2161 atgaggtaca agccagtgtg aacaaagtcc tgcagagtgc gctgaacacc ttacctcagc

2221 gagaacagtc ttcacaaggg gtcatgataa accaagggaa tgcaccagca ctaacagcgg

2281 ctgagactgg agaatccgat accaactcag gggggtccac aatggaatta caggcaacaa

2341 attgtgtttt tagtttgagg gaaacagatt tagaatattt gatgtctagg tattctctta

2401 tgtatgaaga tagattagat tacactaata gccagggcag taggcatttg agatataact

2461 tagattttag gacaatagga tattacaaag tttaaggctt ttacatattg gagatttgac

2521 ttagatgttg tggtaatggt tttggaagat aaaccagctg ctgttaaaaa tcttatgttt

2581 caagtcctgt atacccctca tggtggagtt gtaccaacca ggcacgactc acgagtttgg

2641 aatgcaccca attcaactag tgtgtacaca agagtgggaa attgtccagc ttcttttagg

2701 atacctttta tgtctgtttg caattactat acatcctttt atgatggtga tgggaatttt

2761 gatcggaatg gtgcctccta tggcattaac ccaggtaatt ttatagggac aatcttttag

2821 agttaaggta tttcttagac ctgtaaatat agaagcttat atgcccagac ccttaattgc

2881 ttataaagcc aatggtgatg cagtacaaga tagttcaaca tattatcccg caacacaggc

2941 aggatattac ccagctaccc agacaggacc atatgagatc tgtcaaacta gaaatgccac

3001 agagttagtg gaaaccaaat gggccaagta ttcatgctca gtcaaatttg acagaggttc

3061 atttacagca tggtttgtgg gagaagacct gttattggta ccctaccacg ctgctagcaa

3121 ttggagtcag acaacacatg tgttcctctg gagagcatgg gagaggaatt ggagggatca

3181 ccccgaaatg gagatgaaga tccccattgt agacatgtgg acagattcaa ccagggacat

3241 aacatttctt aaacttgcct atgcaacacc atactggctg gagatgcccc gcaagggctc

3301 tgcaattgga gaatacgtgg ttgtcgtcaa ttcagcacac tttccctgga agcaatatac

3361 aggacccaaa ccatttagac acccttactt acacattggt caacataccc agtacagact

3421 ctggatggca aaaggtgatg ctgataatgg cttctgtgga gccgggttaa tatctaaagg

3481 gaaactttat ggcatagtta cagctagaac tgagagcaag tcaggggaca tctatgtggc

3541 ctacaatgaa ttggatgagg atactttcct ccagacacag cagaggtgct ttgattttgg

3601 aatggataca cacttcaacc tgggaatgca tgactgggtc caaggactcg gccaagtctt

3661 tggtgagggt gtgtctggag aagttaagaa gcaggtagag gactatctag gccaaattaa

3721 acccatcata gatgcgggta ccaataaagt taaggatgtt attaaagatg agatggttag

3781 tgctagcatg tctttattag ttaaagttgt agcttctctt gcttggcgct ttgttaggtg

3841 tagatatatt tatgactgat ccaataatgt acttgtatag taagattact ggagagccac

3901 acaaacaagg tccatctgac tggctgaaag attttaaggc caaaggtatg tgcaaaagtg

3961 cttgaattta agaattgtaa aactacacta ggacaggaag acatttgcca gataaaggtt

4021 tatatagata aattgattga attgggtaac aaatatggcc ataaatttaa cctgcaaatg

4081 tctcagttac tgcaatgttc aaacataata aacaaagctt acagtaacat gacaagatct

4141 agacatgaac ccgtggcaat gcttatacat ggttccccca gatcccaagc attttgatgg

4201 atataatcaa cagaaagtag ttataatgga tgatttagga caaaacccag atggtgagga

4261 ttgcaagatg ttttgtcaga tggtgtctac caccacctac ataccaccta tggcttccct

4321 agatgagaaa ggattaccat ttatttctga ttttgtcttg gcctctacta accaacatgc

4381 cctgacccct cgcaccatag ctgaaccaga tgctataaat aggagatggt ttatgaatgt

4441 tgatattcac ctcaagaaag aattcaagga tgacagagga agattggaca tgtcaaagtg

4501 cttgccttgc aaggattgca aaccaaccaa ctttaggaag tgcaacccat tagtttgtgg

4561 taaagcaatt attttattag acagaaaaac ccagaaaaat tggactgttg atacagctgt

4621 tacccactta ttagaagaat ctgaaagaag aaagggtttc ttgaatgtgg ttgatgcgat

4681 cttccaaggg ccagtgcaga ttccagaatg tgttagggaa gatgaggtga agaagaagaa

4741 ggtaaattca gagagagata tcccacatga tgtgatggaa ttagttaggt gcacaaagtc

4801 tcctgtaata atagatgagc ttgagaaggc tggctttatt attcctgtgg aagctgaagt

4861 tatacgccag accaataatg tgaataatgt aacccaaatt gtttcagcaa ctcttgctag

4921 tttagctgct ataatttctg taggtactgt agtttattta atggttaggt tattctcctc

4981 aaaacaaggg gcatactctg gtgcacccag accagaaaca aggaaacctg tgctcaggaa

5041 agctgtagtt cagggtcctg acatggaatt cgccaagtcc ataatgagat ctaacttgtg

5101 tcaggttact acaagtgtgg gacctttcac tggacttggt atctatgaca acatcttagt

5161 gctaccaaga catgcctatg taagtggaaa tgtagtaata gatggtgttg atattcctgt

5221 tatagatgca gtagaattag aggcagagga aggaaattta gaattagtac agctaaccct

5281 taagaggaat gaaaagttta gagatattag aaagtttttg agcaatggct ttcatagtga

5341 gaatgattgt tggctttgca taaattctga gatgttttct aatgtgtaca tacctcttaa

5401 gaatgtgtct gcctttgggt ttcttaacct gtctatgact cccacctata ggacccttgt

5461 ttataattac cccaccaaga tgggaaaata taagggcaat gttgatgcta cattaccaga

5521 agaagccctc atagctattg atcatttggt gtccaaattt aaagcaatag tgccagacaa

5581 tttgaccgag aagatgtcat tcaatcacta tctcctctta ttaaggcttt agatctttat

5641 ggatatgatt tacctttcac cacttacctt aaggatgagt taagaccaaa agaaaaagtg

5701 aagatgggca aaaccagggt cattgagtgt tcatcgctta atgataccat aatgatgaag

5761 caaactttcg gccacctgtt ccagacatgt cacaagaatc ctggaactta cactggtgtg

5821 gccgttggct gcaatccaga tgttgactgg tcaaagtttg ctgctgaaat tggtgatgcc

5881 tatgtttgtg cttttgatta caccaactgg gatgccagcc tgtcacc

//

4 Nov 2021

Detection of porcine enteric viruses (Kobuvirus, Mamastrovirus and Sapelovirus) in domestic pigs in Corsica, France.

PONE-D-21-15693R1

Dear Dr. Lisandru Capai

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Humberto Rodney Colina Muñoz, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

All the questions and suggestions made by the reviewers have been correctly answered and added by the authors.

Reviewers' comments:

5 Jan 2022

PONE-D-21-15693R1

Detection of porcine enteric viruses (Kobuvirus, Mamastrovirus and Sapelovirus) in domestic pigs in Corsica, France

Dear Dr. Capai:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Humberto Rodney Colina Muñoz

Academic Editor

PLOS ONE