Literature DB >> 35023826

Drosophila p53 isoforms have overlapping and distinct functions in germline genome integrity and oocyte quality control.

Ananya Chakravarti1, Heshani N Thirimanne1, Savanna Brown1, Brian R Calvi1.   

Abstract

p53 gene family members in humans and other organisms encode a large number of protein isoforms whose functions are largely undefined. Using Drosophila as a model, we find that a p53B isoform is expressed predominantly in the germline where it colocalizes with p53A into subnuclear bodies. It is only p53A, however, that mediates the apoptotic response to ionizing radiation in the germline and soma. In contrast, p53A and p53B are both required for the normal repair of meiotic DNA breaks, an activity that is more crucial when meiotic recombination is defective. We find that in oocytes with persistent DNA breaks p53A is also required to activate a meiotic pachytene checkpoint. Our findings indicate that Drosophila p53 isoforms have DNA lesion and cell type-specific functions, with parallels to the functions of mammalian p53 family members in the genotoxic stress response and oocyte quality control.
© 2022, Chakravarti et al.

Entities:  

Keywords:  D. melanogaster; DNA damage; Drosophila; developmental biology; genetics; genomics; meiosis; oogenesis; p53; pachytene checkpoint

Mesh:

Substances:

Year:  2022        PMID: 35023826      PMCID: PMC8758136          DOI: 10.7554/eLife.61389

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

The p53 protein is best known as a tumor suppressor that plays a central role in the response to DNA damage and other types of stress (Lane and Crawford, 1979; Linzer and Levine, 1979; Levine, 2020). p53 mostly acts as a homotetrameric transcription factor to induce cell cycle arrest, apoptosis, or autophagy, although it also has other non-transcription factor activities (Levine, 2020). It is now clear, however, that p53 regulates a growing list of other biological processes, including metabolism, stem cell division, immunity, and DNA repair (Levine, 2019). Vertebrate genomes encode two other p53 paralogs, p63 and p73, which also have diverse functions in stress response and development (Jost et al., 1997; Yang et al., 1998; Dötsch et al., 2010; Candi et al., 2014). Adding to this complexity, each of these three p53 paralogs encode a large number of isoforms which can form homo- or hetero-complexes, both within and among gene paralogs (Fujita et al., 2009; Aoubala et al., 2011; Joruiz and Bourdon, 2016; Anbarasan and Bourdon, 2019; Fujita, 2019). However, the function of only a small subset of these isoform complexes have been defined. In this study, we use the p53 gene in Drosophila as a simplified genetic system to examine the function of p53 isoforms and find that they have critical overlapping and distinct functions during oogenesis. The Drosophila melanogaster genome has a single p53 family member (Ingaramo et al., 2018). Similar to human p53 (TP53), it has a C terminal oligomerization domain (OD), a central DNA-binding domain (DBD) and an N terminal transcriptional activation domain (TAD), and functions as a tetrameric transcription factor (Jin et al., 2000; Ollmann et al., 2000). This single p53 gene expresses four mRNAs that encode three different protein isoforms (Figure 1A; Ingaramo et al., 2018). A 44 kD p53A protein isoform was the first to be identified and is the most well characterized (Brodsky et al., 2000; Jin et al., 2000). Later RNA-Seq and other approaches revealed that alternative promoter usage and RNA splicing results in a 56 kD p53B protein isoform, which differs from p53A by a 110 amino acid longer N-terminal TAD that is encoded by a unique p53B 5’ exon (Figure 1A; Roy et al., 2010; Ingaramo et al., 2018). Because the p53A isoform differs from p53B by a shorter N terminus, p53A is also known as ΔNp53 (Dichtel-Danjoy et al., 2013). A p53C transcript starts at a different promoter than p53A but is predicted to encode the same 44 kD protein (Figure 1A). A short p53E mRNA isoform is predicted to encode a protein of 38 kD that contains the DNA-binding domain but lacks the longer N-terminal TADs of p53A and p53B (Figure 1A; Roy et al., 2010; Zhang et al., 2015).
Figure 1.

The p53B protein isoform is expressed in the germline where it colocalizes with p53A in nuclear bodies.

(A) Drosophila p53 mRNA and protein isoforms. Left: The four p53 mRNA isoforms with introns as lines, translated regions of exons as orange boxes, and 5’ and 3’ untranslated regions as black boxes. Right: The p53 protein isoforms encoded by those four mRNA isoforms. Numbers indicate amino acid coordinates of transactivation domain (TAD) (green), DNA-binding domain (black) and oligomerization domain (white). p53A and p53C mRNAs encode the same protein. (B) Drosophila oogenesis: One ovariole with germarium at anterior (left) and egg chambers migrating posteriorly (to right) as they mature. Arrows indicate germline nurse cells and oocyte and epithelium of somatic follicle cells (pink) in one egg. (C-D’) Immunofluorescent detection of GFP-p53A (C, C’) or mCh-p53B (D, D’) expression in stage seven egg chambers, with DNA counterstained with DAPI (blue). Follicle cells (red arrow), nurse cells (white arrow), oocyte (blue arrow). Scale bar 10 μm (E-E”) Colocalization of GFP-p53A and mCh-p53B in subnuclear foci of nurse cells. Scale bars 5μm. (F) Quantification of GFP-p53A and mCh-p53B fluorescence along the 6 μm line shown in E”. (G-G”) Colocalization of GFP-p53A and mCh-p53B in subnuclear foci of an oocyte. Scale bars 1 μm. (H) Quantification of GFP-p53A and mCh-p53B fluorescence along the 6 μm line shown in G”.

(A, B) mCh-p53B in nuclear bodies in a small group of follicle cells in a mCh-p53B female (A), and colocalization with GFP-p53A in follicle cells in a mCh-p53B / GFP-p53A female (B). White arrows indicate two examples of DAPI-bright pericentric heterochromatin, near which p53 bodies are often located. (C) Quantification of GFP-p53A and mCh-p53B labeling in one nuclear body in (B) (dotted yellow arrow), measured along a 6 μm line (inset). Scale bar is 10 μm.

A testis expressing GFP-p53A (A, A’) or mCh-p53B (B, B’), with labeling with anti-Hts (germline fusomes) and DAPI (blue) shown in A’, B’. Scale bar is 20 μm.

The p53B protein isoform is expressed in the germline where it colocalizes with p53A in nuclear bodies.

(A) Drosophila p53 mRNA and protein isoforms. Left: The four p53 mRNA isoforms with introns as lines, translated regions of exons as orange boxes, and 5’ and 3’ untranslated regions as black boxes. Right: The p53 protein isoforms encoded by those four mRNA isoforms. Numbers indicate amino acid coordinates of transactivation domain (TAD) (green), DNA-binding domain (black) and oligomerization domain (white). p53A and p53C mRNAs encode the same protein. (B) Drosophila oogenesis: One ovariole with germarium at anterior (left) and egg chambers migrating posteriorly (to right) as they mature. Arrows indicate germline nurse cells and oocyte and epithelium of somatic follicle cells (pink) in one egg. (C-D’) Immunofluorescent detection of GFP-p53A (C, C’) or mCh-p53B (D, D’) expression in stage seven egg chambers, with DNA counterstained with DAPI (blue). Follicle cells (red arrow), nurse cells (white arrow), oocyte (blue arrow). Scale bar 10 μm (E-E”) Colocalization of GFP-p53A and mCh-p53B in subnuclear foci of nurse cells. Scale bars 5μm. (F) Quantification of GFP-p53A and mCh-p53B fluorescence along the 6 μm line shown in E”. (G-G”) Colocalization of GFP-p53A and mCh-p53B in subnuclear foci of an oocyte. Scale bars 1 μm. (H) Quantification of GFP-p53A and mCh-p53B fluorescence along the 6 μm line shown in G”.

Rare mCh-p53B expression in somatic follicle cells.

(A, B) mCh-p53B in nuclear bodies in a small group of follicle cells in a mCh-p53B female (A), and colocalization with GFP-p53A in follicle cells in a mCh-p53B / GFP-p53A female (B). White arrows indicate two examples of DAPI-bright pericentric heterochromatin, near which p53 bodies are often located. (C) Quantification of GFP-p53A and mCh-p53B labeling in one nuclear body in (B) (dotted yellow arrow), measured along a 6 μm line (inset). Scale bar is 10 μm.

p53A and p53B are expressed in the male germline.

A testis expressing GFP-p53A (A, A’) or mCh-p53B (B, B’), with labeling with anti-Hts (germline fusomes) and DAPI (blue) shown in A’, B’. Scale bar is 20 μm. Like its human ortholog, Drosophila p53 regulates apoptosis in response to genotoxic stress and mediates other stress responses and developmental processes (Brodsky et al., 2000; Sogame et al., 2003; Wells et al., 2006; Dichtel-Danjoy et al., 2013; de la Cova et al., 2014; Napoletano et al., 2017; Tasnim and Kelleher, 2018; Zhou, 2019). To promote apoptosis, p53 induces transcription of several proapoptotic genes at one locus called H99 (Brodsky et al., 2000; Sogame et al., 2003; Zhou, 2019). Early analyses of p53 function in apoptosis focused on the p53A isoform because the others had yet to be discovered (Brodsky et al., 2000; Jin et al., 2000; Ollmann et al., 2000; Sogame et al., 2003). Using BAC rescue transgenes that were mutant for either p53A or p53B, we previously showed that in larval tissues it is the shorter p53A, and not p53B, that is both necessary and sufficient for the apoptotic response to DNA damage caused by ionizing radiation (Zhang et al., 2015). In contrast, when each isoform was overexpressed, p53B was much more potent than p53A at inducing proapoptotic gene transcription and the programmed cell death response, likely because of the longer p53B TAD (Dichtel-Danjoy et al., 2013; Zhang et al., 2015). Other evidence suggests that p53B may regulate tissue regeneration and has a redundant function with p53A to regulate autophagy in response to oxidative stress (Dichtel-Danjoy et al., 2013; Robin et al., 2019). It is largely unknown, however, why the Drosophila genome encodes a separate p53B isoform and what its array of functions are. The p53 gene family is ancient with orthologs found in the genomes of multiple eukaryotes, including single-celled Choanozoans, which are thought to be the ancestors of multicellular animals (Rutkowski et al., 2010). Evidence suggests that the ancestral function of the p53 gene family was in the germline, with later evolution of tumor suppressor functions in the soma (Gebel et al., 2017; Levine, 2020). In mammals, p63 mediates a meiotic pachytene checkpoint arrest in response to DNA damage or chromosome defects, and also induces apoptosis of a large number of oocytes with persistent defects, thereby enforcing an oocyte quality control (Di Giacomo et al., 2005; Suh et al., 2006; Gebel et al., 2017; Rinaldi et al., 2017; Rinaldi et al., 2020). It has been shown that in the Drosophila germline p53 regulates stem cell divisions, responds to programmed meiotic DNA breaks, and represses mobile elements (Lu et al., 2010; Wylie et al., 2014; Wylie et al., 2016). In this study, we have uncovered that the Drosophila p53A and p53B isoforms have overlapping and distinct functions during oogenesis to protect genome integrity and mediate the meiotic pachytene checkpoint arrest, with parallels to the germline function of mammalian p53 family members in oocyte quality control.

Results

The p53B isoform is more highly expressed in the germline

Our previous results indicated that p53B does not mediate the apoptotic response to radiation in larval imaginal discs and brains (Zhang et al., 2015). One explanation for this lack of function was that p53B protein is expressed at very low levels in those somatic tissues (Zhang et al., 2015). Given the ancestral germline function of the p53 gene family, we considered the possibility that p53B may be expressed and function in the germline. To address this question, we evaluated p53 isoform expression and function in the ovary. During Drosophila oogenesis, egg chambers migrate down a structure called the ovariole as they mature through 14 morphological stages (Figure 1B; King, 1970). Each egg chamber is composed of an oocyte and 15 sister germline nurse cells, all interconnected by intercellular bridges (Figure 1B; Spradling, 1993). The nurse cells become highly polyploid through repeated G / S endocycles during stages 1–10 of oogenesis, which facilitates their biosynthesis of large amounts of maternal RNA and protein that are deposited into the oocyte. The germline cells are surrounded by an epithelial sheet of somatic follicle cells that divide mitotically up until stage 6, and then undergo three endocycles from stages 7 to 10 (Calvi et al., 1998; Deng et al., 2001; Jia et al., 2015). Both germline and somatic follicle cell progenitors are continuously produced by germline and somatic stem cells that reside in a structure at the tip of the ovariole known as the germarium (King, 1970; Drummond-Barbosa, 2019). To evaluate p53A and p53B expression during oogenesis, we used fly strains transformed with different p53 genomic BAC transgenes in which the p53 isoforms are tagged on their unique N-termini. In one strain, GFP is fused to p53A (GFP-p53A), while in another strain mCherry is fused to p53B (mCh-p53B), with each expressed under control of their normal regulatory regions in these genomic BACs (Zhang et al., 2015). To enhance detection, we immunolabeled these strains with antibodies that recognize GFP and mCherry. Immunofluorescent analysis of the somatic follicle cells revealed that GFP-p53A localized to nuclear bodies, ranging in size from ~0.25 to 1 μm, often in close proximity to the DAPI bright pericentric heterochromatin (Figure 1C–C’). The expression of mCh-p53B, however, was only rarely detected in somatic follicle cells ( < 1 / 50,000 cells) (Figure 1D–D’, Figure 1—figure supplement 1). Thus, similar to our previous results in larval tissues, p53A is expressed at much higher levels than p53B in somatic cells (Zhang et al., 2015). In contrast, both GFP-p53A and mCh-p53B bodies were detected in all germline cells. Early stage nurse cells had one to a few p53 bodies, whereas later stage nurse cells had more bodies that were regionally distributed in the nucleus (Figure 1D–D’). This dynamic pattern suggests that p53 bodies, like some other nuclear bodies, may associate with the polytene chromatin fibers that become dispersed in these nurse cells after stage 4 of oogenesis (Dej and Spradling, 1999; Liu et al., 2006; White et al., 2007; Liu et al., 2009). The oocyte nucleus also had both GFP-p53A and mCh-p53B nuclear bodies, often appearing as one large (~1 μm) and several smaller (~0.25 μm) bodies (Figure 1C–D’). In addition to distinct nuclear bodies, there were low levels of GFP-p53A and mCh-p53B dispersed throughout the nuclei of nurse cells and the oocyte.
Figure 1—figure supplement 1.

Rare mCh-p53B expression in somatic follicle cells.

(A, B) mCh-p53B in nuclear bodies in a small group of follicle cells in a mCh-p53B female (A), and colocalization with GFP-p53A in follicle cells in a mCh-p53B / GFP-p53A female (B). White arrows indicate two examples of DAPI-bright pericentric heterochromatin, near which p53 bodies are often located. (C) Quantification of GFP-p53A and mCh-p53B labeling in one nuclear body in (B) (dotted yellow arrow), measured along a 6 μm line (inset). Scale bar is 10 μm.

We examined females with both GFP-p53A and mCh-p53B to address if they colocalize to the same nuclear bodies. In some cells, co-expression of GFP-p53A reduced the expression of mCh-p53B, perhaps a manifestation of a protein trans-degradation effect that we had described previously (Zhang et al., 2014). Nonetheless, the results indicated that GFP-p53A and mCh-p53B colocalize to the same subnuclear bodies of both nurse cells and oocytes, although the ratio of these two isoforms differed somewhat among bodies (Figure 1E–H). mCh-p53B also co-localized with GFP-p53A in those rare follicle cells that expressed mCh-p53B (Figure 1—figure supplement 1B-C). Examination of the testis indicated that GFP-p53A and mCh-p53B are also expressed and localized to nuclear bodies in the male germline (Figure 1—figure supplement 2A-B'; Mauri et al., 2008; Monk et al., 2012). Altogether, these results indicated that while the p53A isoform is expressed in both somatic and germline cells, the p53B isoform is primarily expressed in the germline.
Figure 1—figure supplement 2.

p53A and p53B are expressed in the male germline.

A testis expressing GFP-p53A (A, A’) or mCh-p53B (B, B’), with labeling with anti-Hts (germline fusomes) and DAPI (blue) shown in A’, B’. Scale bar is 20 μm.

p53A is necessary and sufficient for the apoptotic response to ionizing radiation in somatic follicle cells

We next asked which of the p53 isoforms mediate the apoptotic response to DNA damage in the ovary. We had previously addressed this question in larval imaginal discs and brains using mutant BAC rescue transgenes (Zhang et al., 2015). For this study, we used CRISPR/Cas9 to create isoform-specific mutants at the endogenous p53 locus. Since our previous study indicated that the short p53E is a repressor, we focused on making mutants of p53A and p53B isoforms. The resulting p53 allele is a 23 bp deletion and 7 bp insertion within the unique p53A 5’ exon (Figure 2A, Figure 2—figure supplement 1A). This deletion extends downstream into the first p53A intron removing both p53A coding sequence and first RNA splice donor site (Figure 2A, Figure 2—figure supplement 1A; Robin et al., 2019). This coding sequence and splice donor site are shared with p53C mRNA, which is predicted to encode a p53 protein isoform that is identical to that encoded by p53A mRNA (Figure 1A). Therefore, p53 disrupts both p53A and p53C protein coding. The p53 allele is a 14 bp deletion plus 1 bp insertion in the unique second coding exon of p53B, removing p53B coding sequence and creating a frameshift with a stop codon soon afterward (Figure 2B, Figure 2—figure supplement 1A). We had previously shown that p53A mRNA structure is perturbed and p53A protein is undetectable in homozygous p53 animals, whereas p53B mRNA is still expressed (Figure 2—figure supplement 1B; Robin et al., 2019). Conversely, RT-PCR indicated that in the p53 strain the p53A isoform is still expressed (Figure 2—figure supplement 1B). Thus, p53 and p53 alleles are specific to each isoform and do not disrupt expression of the other isoform. This is in contrast to the p53 null allele which deletes the common C-terminus of all the isoforms. To be clear about which of these isoforms are expressed from different p53 alleles, we will annotate wild type p53 as (A+B+), the p53 null allele as (A-B-), the p53A specific mutant p53 as (A-B+) and the p53B specific mutant p53 as (A+B-) (Figure 2A and B).
Figure 2.

p53A is necessary and sufficient for IR-induced apoptosis in the soma.

(A–B) The p53 isoform-specific mutants created at the endogenous p53 locus with CRISPR / Cas9. Each allele is a small deletion (red asterisk) in the unique 5’ coding exon of p53A (A) and p53B (B) mRNAs. The p53 (A-B+) mutant impairs expression of isoforms p53A and p53C (gray shading) but not p53B, whereas the p53 (A+B-) mutant eliminates expression of p53B (gray shading) but not p53A (see Figure 2—figure supplement 1). (C–H) Apoptotic response to IR of stage six somatic follicle cells, assayed by TUNEL (red), with DNA stained with DAPI (gray). (C–D) TUNEL-labeled follicle cells from a p53 (A+B+) wild type female without (C) or 4 hr after IR (D). (E–G) TUNEL labeling of follicle cells after IR from p53 (A-B-) null (E), p53 (A-B+) (F), and p53 (A+B-) (G) mutant females. Scale bars are 10 μm. (H) Quantification of the average number of TUNEL-labeled follicle cells in stage six egg chambers for the genotypes and treatments shown in (C–G). Averages are based on 10 egg chambers per genotype with two biological replicates. Error bars are S.E.M. ****: p < 0.0001 by unpaired Student’s t test.

(A) Left: Shown are the location of p53 and p53 deletion alleles and the coordinates of primers (red font) used for RT-PCR. Expanded maps below indicate the coordinates of the deletion endpoints within the p53A and p53B mRNA isoforms (dotted lines and straight arrows). Right: DNA Sequence of p53 and p53 deletion alleles (top) aligned with Drosophila reference genome sequence (WT, bottom). Red nucleotides indicate unique nucleotide insertions. All genomic coordinates are based on Drosophila melanogaster genome release 6.32. (B, B’) RT-PCR with the primer pairs indicated in (A) that are specific to p53A mRNA (B) or p53B mRNA (B’) from p53 (A+B+), p53 (A-B+), p53 (A+B-), p53 (A-B-). Black arrows indicate position of p53A and p53B PCR products.

Figure 2—figure supplement 1.

p53 isoform-specific alleles.

(A) Left: Shown are the location of p53 and p53 deletion alleles and the coordinates of primers (red font) used for RT-PCR. Expanded maps below indicate the coordinates of the deletion endpoints within the p53A and p53B mRNA isoforms (dotted lines and straight arrows). Right: DNA Sequence of p53 and p53 deletion alleles (top) aligned with Drosophila reference genome sequence (WT, bottom). Red nucleotides indicate unique nucleotide insertions. All genomic coordinates are based on Drosophila melanogaster genome release 6.32. (B, B’) RT-PCR with the primer pairs indicated in (A) that are specific to p53A mRNA (B) or p53B mRNA (B’) from p53 (A+B+), p53 (A-B+), p53 (A+B-), p53 (A-B-). Black arrows indicate position of p53A and p53B PCR products.

p53A is necessary and sufficient for IR-induced apoptosis in the soma.

(A–B) The p53 isoform-specific mutants created at the endogenous p53 locus with CRISPR / Cas9. Each allele is a small deletion (red asterisk) in the unique 5’ coding exon of p53A (A) and p53B (B) mRNAs. The p53 (A-B+) mutant impairs expression of isoforms p53A and p53C (gray shading) but not p53B, whereas the p53 (A+B-) mutant eliminates expression of p53B (gray shading) but not p53A (see Figure 2—figure supplement 1). (C–H) Apoptotic response to IR of stage six somatic follicle cells, assayed by TUNEL (red), with DNA stained with DAPI (gray). (C–D) TUNEL-labeled follicle cells from a p53 (A+B+) wild type female without (C) or 4 hr after IR (D). (E–G) TUNEL labeling of follicle cells after IR from p53 (A-B-) null (E), p53 (A-B+) (F), and p53 (A+B-) (G) mutant females. Scale bars are 10 μm. (H) Quantification of the average number of TUNEL-labeled follicle cells in stage six egg chambers for the genotypes and treatments shown in (C–G). Averages are based on 10 egg chambers per genotype with two biological replicates. Error bars are S.E.M. ****: p < 0.0001 by unpaired Student’s t test.

p53 isoform-specific alleles.

(A) Left: Shown are the location of p53 and p53 deletion alleles and the coordinates of primers (red font) used for RT-PCR. Expanded maps below indicate the coordinates of the deletion endpoints within the p53A and p53B mRNA isoforms (dotted lines and straight arrows). Right: DNA Sequence of p53 and p53 deletion alleles (top) aligned with Drosophila reference genome sequence (WT, bottom). Red nucleotides indicate unique nucleotide insertions. All genomic coordinates are based on Drosophila melanogaster genome release 6.32. (B, B’) RT-PCR with the primer pairs indicated in (A) that are specific to p53A mRNA (B) or p53B mRNA (B’) from p53 (A+B+), p53 (A-B+), p53 (A+B-), p53 (A-B-). Black arrows indicate position of p53A and p53B PCR products. To determine which p53 isoforms mediate the apoptotic response to DNA damage, we irradiated adult females from these strains with 40 Gray (Gy) of ionizing radiation (IR) and evaluated cell death 4 hr later by TUNEL. We focused on the follicle cells in the mitotic cycle up until stage six because we had previously shown that endocycling follicle cells in later stage egg chambers repress the p53 apoptotic response to DNA damage (Mehrotra et al., 2008; Hassel et al., 2014; Zhang et al., 2014; Qi and Calvi, 2016). In wild type p53 (A+B+) ovaries that express both isoforms, approximately 30 follicle cells were TUNEL positive in stage six after IR, whereas the p53 (A-B+) mutant had very few TUNEL-positive follicle cells (~1 / stage 6), which was not significantly different than irradiated p53 (A-B-) null or unirradiated controls (Figure 2C–F and H). In contrast, the p53 (A+B-) mutant strain had 30 TUNEL-positive follicle cells, a fraction similar to that of wild type (Figure 2D, G and H). These results suggested that p53A, but not p53B, is required for the apoptotic response to DNA damage. A possible caveat, however, is that both the p53 and p53 alleles also delete part of a non-coding RNA of unknown function (CR46089), which overlaps the 5’ end of p53 and is transcribed in the opposite direction (Roy et al., 2010; Thurmond et al., 2019). Given that this noncoding RNA is mutated in both p53 isoform-specific alleles, its disruption cannot explain the impaired apoptosis specifically in the p53 allele. Moreover, similar results were obtained when p53 or p53 alleles were transheterozygous to the p53 null allele that does not delete portions of this non-coding RNA. These results strongly suggest that mutation of non-coding RNA CR46089, or possible cryptic mutations on the p53 and p53 chromosomes, are not contributing to the apoptotic phenotypes. Thus, the p53A protein isoform is both necessary and sufficient for the apoptotic response to IR in somatic ovarian follicle cells.

p53A is necessary and sufficient for the apoptotic response to ionizing radiation in the female germline

The low level of expression of p53B in somatic tissues may explain why it does not mediate the apoptotic response. We wondered, therefore, whether p53B participates in the apoptotic response in the germline where it is more highly expressed. Given that endocycling nurse cells and the meiotic oocyte repress p53-mediated apoptosis, we analyzed the apoptotic response of mitotically-dividing germline cells during early oogenesis in the germarium (Mehrotra et al., 2008; Hassel et al., 2014; Zhang et al., 2014; Qi and Calvi, 2016). At the anterior tip of the germarium, the germline stem cells (GSCs) reside in a niche and divide asymmetrically into a GSC and cystoblast (CB) (Figure 3A; Hinnant et al., 2020). This cystoblast and its daughter cells undergo four rounds of divisions with incomplete cytokinesis as they migrate posteriorly through germarium region 1, finally resulting in an interconnected 16-cell germline cyst (Figure 3A; Drummond-Barbosa, 2019; Hinnant et al., 2020). In region 2a, multiple cells in the cyst initiate meiotic breaks and synaptonemal complex formation, but only one cell is eventually specified to be the oocyte, with the 15 other cells of the cyst destined to become nurse cells that enter a polyploid endocycle by germarium region 3 (stage 1 of oogenesis) (Figure 3A). To evaluate which cells in the germarium express GFP-p53A and mCh-p53B, we co-labeled with an antibody against the fly adducin protein ortholog called Hu-li tai shao (Hts), which labels a spherical cytoplasmic spectrosome in GSCs, and a cytoskeletal structure called the fusome that branches through the ring canals that connect the 16 cells of a germline cyst (Figure 3A; Lin et al., 1994). Similar to later stages of oogenesis, both GFP-p53A and mCh-p53B were expressed in GSCs and their daughter germline cells of the germarium where the p53 isoforms colocalized in distinct p53 nuclear bodies (Figure 3B–C).
Figure 3.

p53A and p53B are expressed in the early female germline, but only p53A is required for IR-induced germline apoptosis.

(A) Illustration of three regions of the germarium: germline stem cells (GSC), their primary daughter cystoblasts (CB), dividing cystocytes (CC), GSC spherical cytoskeletal spectrosome (S), branched fusome (F, green lines), oocyte (O, red), nurse cell (NC, blue), somatic follicle cells (FC, green). (B, C) Expression of GFP-p53A (B) and mCh-p53B (C) in subnuclear bodies of GSC and cystocytes of the germarium. The GSCs were identified by the presence of the spectrosome (yellow arrows). Scale bars are 5 μm. (D–E) TUNEL (green) and anti-Hts labeling (red) in germaria from p53 (A+B+) wild-type females without IR (D) or with IR (E). Spectrosomes and fusomes were labeled with anti-Hts antibody to identify GSC and cystocytes, respectively. (F–H) TUNEL after IR of p53 (A-B-) null (F), p53 (A-B+) (G) and p53 (A+B-) (H) females. The GSCs (white arrows in E and H) were not TUNEL positive. Scale bars are 10 μm. (I) Quantification of the average number of TUNEL-labeled cystocytes in region 1 of the germarium for the genotypes and treatments shown in D–H. Averages are based on 10 germaria per genotype and three biological replicates. Error bars are S.E.M. ****: p < 0.0001 by unpaired Student’s t test.

p53A and p53B are expressed in the early female germline, but only p53A is required for IR-induced germline apoptosis.

(A) Illustration of three regions of the germarium: germline stem cells (GSC), their primary daughter cystoblasts (CB), dividing cystocytes (CC), GSC spherical cytoskeletal spectrosome (S), branched fusome (F, green lines), oocyte (O, red), nurse cell (NC, blue), somatic follicle cells (FC, green). (B, C) Expression of GFP-p53A (B) and mCh-p53B (C) in subnuclear bodies of GSC and cystocytes of the germarium. The GSCs were identified by the presence of the spectrosome (yellow arrows). Scale bars are 5 μm. (D–E) TUNEL (green) and anti-Hts labeling (red) in germaria from p53 (A+B+) wild-type females without IR (D) or with IR (E). Spectrosomes and fusomes were labeled with anti-Hts antibody to identify GSC and cystocytes, respectively. (F–H) TUNEL after IR of p53 (A-B-) null (F), p53 (A-B+) (G) and p53 (A+B-) (H) females. The GSCs (white arrows in E and H) were not TUNEL positive. Scale bars are 10 μm. (I) Quantification of the average number of TUNEL-labeled cystocytes in region 1 of the germarium for the genotypes and treatments shown in D–H. Averages are based on 10 germaria per genotype and three biological replicates. Error bars are S.E.M. ****: p < 0.0001 by unpaired Student’s t test. To determine which p53 isoforms are required for IR-induced germline apoptosis, we irradiated wild type and p53 mutant females with 40 Gy of gamma rays and TUNEL labeled their ovaries 4 hr later. In wild type p53 (A+B+) controls, there were an average of ~13 TUNEL-positive germline cells in region 1 of each germarium (Figure 3D–E,I). Although earlier GSCs and later meiotic cells express both p53 isoforms, they did not label with TUNEL (Figure 3E). In p53 (A-B-) null ovaries, only ~1 germline cell per germarium was TUNEL-positive in region 1, a number similar to that in unirradiated controls, indicating that most of the germline cell death 4 hr after IR is p53-dependent (Figure 3D, F,I). Similar to p53 null, the p53 (A-B+) mutant also had ~1 TUNEL-positive germline cell per germarium (Figure 3G,I). In contrast, the p53 (A+B-) mutant ovaries had ~12 TUNEL positive cells per germarium, a number similar to that in wild type and significantly greater than that in p53 null and p53 mutants (Figure 3H–I). These results suggest that, although p53A and p53B are both expressed, only the p53A isoform that is necessary and sufficient for the apoptotic response to IR in the germline. To further evaluate p53 isoform function, we determined whether p53A or p53B protein isoforms induce transcription of proapoptotic genes after IR. Previous studies showed that among the proapoptotic p53 target genes, the gene hid plays a prominent role for inducing germline apoptosis in response to DNA damage (Xing et al., 2015; Park et al., 2019). We therefore used a GFP promoter-reporter for hid (hid-GFP), which contains the hid promoter but not coding region, together with GFP antibody labeling to assay p53 transcription factor activity (Tanaka-Matakatsu et al., 2009). Similar to the results for TUNEL, expression of the hid-GFP reporter in region one cystocytes was significantly induced by IR in p53(A+B+) wild type and p53 (A+B-) mutants, but not in p53 (A-B-) null or p53 (A-B+) mutants (Figure 4A–I). Together, these results indicate that, similar to the soma, p53A is necessary and sufficient for induction of proapoptotic gene expression and the apoptotic response to IR in the germline.
Figure 4.

p53A is necessary and sufficient for IR-induced expression of proapoptotic genes in the germline.

(A-H’) Confocal micrographs of the expression of the p53 activity reporter, hid-GFP, in germaria of females with the indicated p53 allele genotypes (rows), without IR (left two columns) or with IR (right two columns). Shown are single channel hid-GFP (A–H) and double label with DAPI (A’-H’). Scale bar in panel A is 10 μm for all panels. (I) Quantification of hid-GFP fluorescent intensity in the germaria of females with the indicated p53 genotypes. Bars represent mean fluorescent intensity and error bars S.E.M. from three biological replicates. Statistical significance of expression differences between irradiated and unirradiated within a genotype are indicated by red font and lines, and comparison of nonirradiated p53 wild type to all nonirradiated p53 mutants are indicated by black font and lines. ***: p < 0.001, **: p < 0.01, n.s.: not significant based on ANOVA.

Hid-GFP expression in wild type (A) and mei-W68 (B). Scale bars are 25 μm.

p53A is necessary and sufficient for IR-induced expression of proapoptotic genes in the germline.

(A-H’) Confocal micrographs of the expression of the p53 activity reporter, hid-GFP, in germaria of females with the indicated p53 allele genotypes (rows), without IR (left two columns) or with IR (right two columns). Shown are single channel hid-GFP (A–H) and double label with DAPI (A’-H’). Scale bar in panel A is 10 μm for all panels. (I) Quantification of hid-GFP fluorescent intensity in the germaria of females with the indicated p53 genotypes. Bars represent mean fluorescent intensity and error bars S.E.M. from three biological replicates. Statistical significance of expression differences between irradiated and unirradiated within a genotype are indicated by red font and lines, and comparison of nonirradiated p53 wild type to all nonirradiated p53 mutants are indicated by black font and lines. ***: p < 0.001, **: p < 0.01, n.s.: not significant based on ANOVA.

hid-GFP expression in region 2a responds to meiotic DNA breaks.

Hid-GFP expression in wild type (A) and mei-W68 (B). Scale bars are 25 μm.

Meiotic DNA breaks activate the p53A transcription factor

We noticed that in the unirradiated wild type controls hid-GFP was constitutively expressed in region 2 of the germarium at levels that were less than 50% that of IR. This hid-GFP fluorescence was reduced to background levels in p53 null mutants indicating that it is reporting a low level of p53 transcription factor activity (Figure 4C–C’). hid-GFP fluorescence was also reduced to background levels in strains mutant for the fly ortholog of Spo-11, mei-W68, which induces DNA double-strand breaks at the onset of meiosis in late region 1/ early region 2 (Figure 4—figure supplement 1 Mehrotra and McKim, 2006). These results suggest that meiotic DNA breaks induce a low level of p53 transcription factor activity, consistent with a previous report from the Abrams lab who used a reporter for another p53 target gene, reaper (rpr-GFP) (Lu et al., 2010). To determine which isoforms respond to meiotic DNA breaks, we quantified hid-GFP expression in the isoform-specific mutants in the absence of IR. The expression of hid-GFP in the p53 (A+B-) mutant was not significantly different than wild type p53 (A+B+), suggesting that the p53A isoform responds to meiotic DNA breaks (Figure 4A–A’ and G–G’). Surprisingly, hid-GFP expression in the p53 (A-B+) mutant was significantly higher than in p53 (A+B+), and expression occurred earlier in oogenesis in region 1, including GSCs (Figure 4E–E’). Although hid-GFP reporter expression in p53(A-B+) was higher than in p53wild type without IR, it was significantly lower than p53 wild type with IR and did not induce apoptosis at any stage. This hid-GFP expression in the p53 (A-B+) mutant is not a response to meiotic DNA breaks because they are not induced until late region 1, nor did we detect evidence of DNA damage before region 2 (see below) (Mehrotra and McKim, 2006). Based on evidence from our previous studies and other systems, a likely explanation is that in the absence of p53A the more active p53B homotetramers have a low-level transcription factor activity in the absence of DNA breaks (see discussion) (Zhang et al., 2014; Zhang et al., 2015). Nevertheless, the level of hid-GFP reporter expression was less than that after IR and was not associated with apoptosis. All together, the comparison of hid-GFP expression in p53 (A+B+), p53 null (A-B-), p53 (A-B+), and mei-W68 suggest that meiotic DNA breaks induce low level activity of the p53A transcription factor.
Figure 4—figure supplement 1.

hid-GFP expression in region 2a responds to meiotic DNA breaks.

Hid-GFP expression in wild type (A) and mei-W68 (B). Scale bars are 25 μm.

Dynamic p53B isoform abundance in p53 bodies during early meiosis

To investigate the relationship of p53 isoforms to meiosis further, we examined their localization in the early germline. The level of GFP-p53A in p53 bodies was comparable among germline cells in all regions of the germarium, including GSC, dividing cystocytes in region 1, and during early stages of meiosis in regions 2a-2b (Figure 5A–A’). mCh-p53B was also abundant in p53 bodies in GSCs and most region one cystocytes, but then decreased at the onset of meiosis in late region 1/ early region 2, remained low in regions 2a-2b, and then increased again in most cells in late region 2b / early region 3 (Figure 5B–B’). This transient decrease of p53B in bodies coincides with known timing of meiotic break induction in late region 1/ region 2a followed by their subsequent repair by region 3 (Hughes et al., 2018). Quantification of GFP-p53A and mCh-p53B levels within the same p53 bodies of GFP-p53A / mCh-p53B females confirmed that although mCh-p53B and GFP-p53A intensity in the bodies is approximately equal in region 1, p53B levels decrease to ~41% that of p53A in regions 2a-2b, and then increase again to levels comparable to p53A in regions 2b-3 (Figure 5C–G, Figure 5—figure supplement 1). This transient reduction in p53B levels in p53 bodies occurs during ~24 hr of oogenesis. These p53B protein dynamics may reflect its degradation and rapid resynthesis or its relocalization from the p53 body to the nucleoplasm and then back again (King, 1970; Morris and Spradling, 2011). The low magnitude and high variance of the nucleoplasmic fluorescence precluded a determination as to whether the decrease of mCh-p53B in bodies is associated with a commensurate increase in the nucleoplasm (Figure 5E, Figure 5—figure supplement 1C-C''). These results suggest that there may be a functional relationship between p53B protein dynamics and meiotic DNA breaks.
Figure 5.

p53B protein levels fluctuate in p53 bodies during early meiosis.

(A-C’) Micrographs p53 bodies in germaria from GFP-p53A (A-A’, green) and mCh-p53B (B-B’, red), and GFP-p53A / mCh-p53B females (C-C’). (D–F) Representative quantification of GFP-p53A and mCh-p53B fluorescent intensity within p53 bodies along the line shown in micrograph insets for region 1 (D), region 2 (E), and region 3 (F), indicated by white arrows in C’. A-B’ are single confocal z sections, whereas C-C’ are a composite stack of several z sections. Scale bars are 10 μm. (G) Quantification of the ratio of mCh-p53B to GFP-p53A within bodies in gemarium regions 1, 2, and 3. Shown are mean and S.E.M. **** = p < 0.0001 and n.s. = not significant by unpaired Student’s t test. n = 10 foci for regions 1 and 3 and 23 foci for region 2. See Figure 5—figure supplement 1 for more examples of quantification of p53A and p53B in nuclear bodies in regions 1–3.

(A, A’) A germarium from a GFP-p53A / mCh-p53B female showing localization of p53A and p53B proteins to p53 nuclear bodies in germarium regions 1, 2, and 3, with DAPI labeling of DNA (blue) shown in A’. Arrows in A’ indicate the bodies within which GFP-p53A and mCh-p53B were quantified and the letters within the figure indicate the corresponding panels shown below. Scale bar is 10 μm. (B-D”) Four examples each of fluorescent quantification along a 6 μm line within nuclear bodies from regions 1 (B-B”’), 2 (C-C”’), and 3 (D-D”’), which are indicated by arrows in A’. Related to Figure 5.

Figure 5—figure supplement 1.

mCh-p53B levels fluctuate in p53 bodies during early meiosis.

(A, A’) A germarium from a GFP-p53A / mCh-p53B female showing localization of p53A and p53B proteins to p53 nuclear bodies in germarium regions 1, 2, and 3, with DAPI labeling of DNA (blue) shown in A’. Arrows in A’ indicate the bodies within which GFP-p53A and mCh-p53B were quantified and the letters within the figure indicate the corresponding panels shown below. Scale bar is 10 μm. (B-D”) Four examples each of fluorescent quantification along a 6 μm line within nuclear bodies from regions 1 (B-B”’), 2 (C-C”’), and 3 (D-D”’), which are indicated by arrows in A’. Related to Figure 5.

p53B protein levels fluctuate in p53 bodies during early meiosis.

(A-C’) Micrographs p53 bodies in germaria from GFP-p53A (A-A’, green) and mCh-p53B (B-B’, red), and GFP-p53A / mCh-p53B females (C-C’). (D–F) Representative quantification of GFP-p53A and mCh-p53B fluorescent intensity within p53 bodies along the line shown in micrograph insets for region 1 (D), region 2 (E), and region 3 (F), indicated by white arrows in C’. A-B’ are single confocal z sections, whereas C-C’ are a composite stack of several z sections. Scale bars are 10 μm. (G) Quantification of the ratio of mCh-p53B to GFP-p53A within bodies in gemarium regions 1, 2, and 3. Shown are mean and S.E.M. **** = p < 0.0001 and n.s. = not significant by unpaired Student’s t test. n = 10 foci for regions 1 and 3 and 23 foci for region 2. See Figure 5—figure supplement 1 for more examples of quantification of p53A and p53B in nuclear bodies in regions 1–3.

mCh-p53B levels fluctuate in p53 bodies during early meiosis.

(A, A’) A germarium from a GFP-p53A / mCh-p53B female showing localization of p53A and p53B proteins to p53 nuclear bodies in germarium regions 1, 2, and 3, with DAPI labeling of DNA (blue) shown in A’. Arrows in A’ indicate the bodies within which GFP-p53A and mCh-p53B were quantified and the letters within the figure indicate the corresponding panels shown below. Scale bar is 10 μm. (B-D”) Four examples each of fluorescent quantification along a 6 μm line within nuclear bodies from regions 1 (B-B”’), 2 (C-C”’), and 3 (D-D”’), which are indicated by arrows in A’. Related to Figure 5.

p53A and p53B are required for timely repair of meiotic DNA breaks

To investigate whether p53 isoforms regulate germline DNA breaks, we labeled ovaries with antibodies against the phosphorylated form of the histone 2A variant (γ-H2Av), which marks sites of DNA damage and repair, evident as distinct nuclear DNA repair foci (Madigan et al., 2002; Lake et al., 2013). It has been shown that labeling for γ-H2Av detects repair foci at meiotic DNA breaks beginning in late region 1/ early region 2 a of the germarium (Jang et al., 2003; Mehrotra and McKim, 2006; Lake et al., 2013). Mei-W68 induces breaks in most cells of the 16-cell cyst, but γ-H2Av repair foci are most abundant in four cells, one of which will become the oocyte while the others are destined to become nurse cells (Carpenter, 1975; Jang et al., 2003; Mehrotra and McKim, 2006; Lake et al., 2013; Hughes et al., 2018). Consistent with these previous reports, we observed that ovaries from wild type females had four cells per cyst with prominent γ-H2Av labeling, first appearing at the onset of meiotic recombination in germarium region 2a, decreasing in region 2b, and then undetectable in 97% of oocytes by germarium region 3 (oogenesis stage 1), a time when most meiotic DNA breaks have been repaired (Figure 6A–A”; Jang et al., 2003; Mehrotra and McKim, 2006; Lake et al., 2013).
Figure 6.

p53A and p53B mutants have persistent germline DNA damage.

(A-D’) Images of ovarioles of indicated genotypes immunolabeled with anti-γ-H2Av (red) (A–D) to detect DNA breaks, and counterstained with the DNA dye DAPI (blue) (A’-D’). The ovarioles are oriented with the anterior germarium to left (square bracket). Scale bars are 25 µm. (A”-D”) Quantification of percent of ovarioles with γ-H2Av-positive nurse cells (blue squares) and oocyte (red ovals) for the indicated genotypes. Values are means of three biological replicates and >20 ovarioles, with error bars representing S.E.M. Values with low variance have very small error bars that are not visible in the graphs. See Figure 6—figure supplement 1 for higher magnification images of germaria, and Supplementary file 1 for p values.

(A-F’) Images of germarium and stage one labeled for γ-H2Av (red) and oocyte marker Orb (green) (A–F), and with DAPI DNA stain (blue) (A’-F’). (G) Quantification of percent stage one with γ-H2Av and Orb positive oocyte. (H) Quantification of percent stage one with a γ-H2Av -bright nurse cell adjacent to a Orb-positive oocyte. n = 20 ovarioles for each genotype.

Each dot represents a single oocyte or nurse cell. Horizontal lines represent mean and standard deviation. Asterisks represent adjusted p values of a two-way, pair-wise ANOVA computed through a Tukey test between p53A+B+ (wild type) and all other genotypes for oocyte (red asterisks) and nurse cells (blue asterisks). * p < 0.05; **p < 0.01; ***p < 0.01; ****p < 0.0001. Statistical analyses were performed using GraphPad Prism (version 9.1.2). See Supplementary file 2 for p values.

γ-H2Av labeling of wild type (A), mei-W68 (B), and mei-68 (C).

p53A and p53B mutants have persistent germline DNA damage.

(A-D’) Images of ovarioles of indicated genotypes immunolabeled with anti-γ-H2Av (red) (A–D) to detect DNA breaks, and counterstained with the DNA dye DAPI (blue) (A’-D’). The ovarioles are oriented with the anterior germarium to left (square bracket). Scale bars are 25 µm. (A”-D”) Quantification of percent of ovarioles with γ-H2Av-positive nurse cells (blue squares) and oocyte (red ovals) for the indicated genotypes. Values are means of three biological replicates and >20 ovarioles, with error bars representing S.E.M. Values with low variance have very small error bars that are not visible in the graphs. See Figure 6—figure supplement 1 for higher magnification images of germaria, and Supplementary file 1 for p values.
Figure 6—figure supplement 1.

Double labeling for oocyte marker Orb and γ-H2Av in stage 1.

(A-F’) Images of germarium and stage one labeled for γ-H2Av (red) and oocyte marker Orb (green) (A–F), and with DAPI DNA stain (blue) (A’-F’). (G) Quantification of percent stage one with γ-H2Av and Orb positive oocyte. (H) Quantification of percent stage one with a γ-H2Av -bright nurse cell adjacent to a Orb-positive oocyte. n = 20 ovarioles for each genotype.

Double labeling for oocyte marker Orb and γ-H2Av in stage 1.

(A-F’) Images of germarium and stage one labeled for γ-H2Av (red) and oocyte marker Orb (green) (A–F), and with DAPI DNA stain (blue) (A’-F’). (G) Quantification of percent stage one with γ-H2Av and Orb positive oocyte. (H) Quantification of percent stage one with a γ-H2Av -bright nurse cell adjacent to a Orb-positive oocyte. n = 20 ovarioles for each genotype.

Quantification of γ-H2Av fluorescence intensity in oocytes (red) and nurse cells (blue) of stage one egg chambers.

Each dot represents a single oocyte or nurse cell. Horizontal lines represent mean and standard deviation. Asterisks represent adjusted p values of a two-way, pair-wise ANOVA computed through a Tukey test between p53A+B+ (wild type) and all other genotypes for oocyte (red asterisks) and nurse cells (blue asterisks). * p < 0.05; **p < 0.01; ***p < 0.01; ****p < 0.0001. Statistical analyses were performed using GraphPad Prism (version 9.1.2). See Supplementary file 2 for p values.

DNA repair foci in p53 mutants depends on DNA meiotic breaks.

γ-H2Av labeling of wild type (A), mei-W68 (B), and mei-68 (C). In contrast, females homozygous mutant for the p53 (A-B-) null allele had more than four germline cells per cyst with strong γ-H2Av labeling (Figure 6B–B”). This phenotype is similar to that previously reported for mutants required for meiotic DNA break repair, which increase the steady state number of unrepaired meiotic DNA breaks, and thereby the number of cells per cyst that label strongly for γ-H2Av in germarium stage 2 (Mehrotra and McKim, 2006; Wei et al., 2019). Also similar to known DNA repair mutants, repair foci in p53 persisted into later stages, with 56% of ovarioles having γ-H2Av labeling in both nurse cells and oocytes in stage 1, and 8% of ovarioles having γ-H2Av labeling as late as stage 4 (Figure 6B–B”, Supplementary file 1 for p values). Females homozygous for the p53 (A-B+) allele also had more than four cells per cyst that labeled intensely for γ-H2Av, as well as γ-H2Av labeling in oocytes up to stage 1 in 25% of ovarioles, not as frequent as that in the p53 (A-B-) null (56%) (Figure 6C–C”). Another difference with p53 (A-B-) null was that the in p53 (A-B+) the frequency of γ-H2Av labeling in oocytes was higher than in nurse cells (Figure 6C”, see Supplementary file 1 for p values). Females homozygous for p53 (A+B-) also had more than four γ-H2Av-positive cyst cells and repair foci that persisted up to stage 2, later in oogenesis than in p53 (A-B+) (stage 1), but not as late as in the p53 (A-B-) null (stage 4) (Figure 6D–D”). To confirm scoring of oocyte and nurse cells in stage 1, we marked oocytes with anti-Orb antibody, which yielded similar results (Figure 6—figure supplement 1A-G). These experiments also revealed that the nurse cell adjacent to the Orb-positive oocyte was often more intensely labeled for γ-H2Av than other nurse cells (Figure 6—figure supplement 1H). This cell may be the descendant of one of the two ‘pro-oocytes’ in the germarium that are known to have the most numerous meiotic DNA breaks, and which then became a nurse cell while its sister cell adopted the oocyte fate. To test whether the increased DNA damage in p53 mutants is the result of a defect in repair of meiotic breaks, we asked whether the failure to form these breaks in a mei-W68 mutant would suppress the persistent DNA break phenotype of p53 mutants. Labeling of mei-W68; p53 (A-B+) and mei-W68; p53 (A+B-) double mutants with anti-γH2Av indicated that the persistent γ-H2Av labeling in the p53 mutants is dependent on the creation of DNA breaks by Mei-W68 (Figure 6—figure supplement 3). We also quantified the intensity of γ-H2Av labeling in stage one oocytes and nurse cells, which showed that the p53 mutants had significantly more unrepaired DNA breaks per cell than wild type (Figure 6—figure supplement 2, Supplementary file 2 for p values). γ-H2Av foci were not observed in egg chambers after stage six in any genotype, suggesting that DNA breaks are eventually repaired in the p53 mutants. All together these data reveal that p53A and p53B protein isoforms are required for the timely repair of meiotic DNA breaks.
Figure 6—figure supplement 3.

DNA repair foci in p53 mutants depends on DNA meiotic breaks.

γ-H2Av labeling of wild type (A), mei-W68 (B), and mei-68 (C).

Figure 6—figure supplement 2.

Quantification of γ-H2Av fluorescence intensity in oocytes (red) and nurse cells (blue) of stage one egg chambers.

Each dot represents a single oocyte or nurse cell. Horizontal lines represent mean and standard deviation. Asterisks represent adjusted p values of a two-way, pair-wise ANOVA computed through a Tukey test between p53A+B+ (wild type) and all other genotypes for oocyte (red asterisks) and nurse cells (blue asterisks). * p < 0.05; **p < 0.01; ***p < 0.01; ****p < 0.0001. Statistical analyses were performed using GraphPad Prism (version 9.1.2). See Supplementary file 2 for p values.

p53A and p53B isoforms are crucial for germline genome integrity when meiotic recombination repair is compromised

To further explore the role of p53 isoforms in DNA break dynamics, we tested whether p53 plays a prominent role in the germline when there are defects in meiotic DNA recombination. We examined females doubly mutant for p53 and okra (okr), the fly ortholog of Rad54L, which is required for homologous recombination (HR) DNA repair in meiotic germline and somatic cells (Ghabrial et al., 1998; Sekelsky, 2017; Hughes et al., 2018). It was previously reported that females doubly mutant for okra and a p53 null allele result in egg chambers with extra nurse cells and shorter eggs, which was partially suppressed by mutation of mei-W68, but the relationship of this genetic interaction to DNA break repair, and the possible role of the different p53 isoforms, have not been explored (Lu et al., 2010). Females that were transheterozygous for two mutant okra alleles (okra) had more than four cells per cyst with strong γ-H2Av labeling in the germarium, which abnormally persisted into germarium region 3 (stage 1), consistent with previous reports that meiotic HR repair is delayed in okra mutants (Figure 7A–B”; Ghabrial et al., 1998; Jang et al., 2003; Mehrotra and McKim, 2006; Lake et al., 2013). Analysis of the timing and intensity of γH2Av labeling in the different okra; p53 double mutants indicated that they all had severe DNA break repair defects (Figure 7C–E”, Figure 6—figure supplement 1D-H, Supplementary files 1 and 2). In okra (A-B-) double mutants, γ-H2Av foci persisted up to stage 2 in 100% of ovarioles, with some ovarioles having repair foci in nurse cells and oocyte up to stage 5–6, ~ 30 hr later in oogenesis than wild type (Figure 7C–C”, Figure 6—figure supplement 1D-D'; Lin and Spradling, 1993). The okra (A-B+) double mutants also had repair foci up to stage six in almost all ovarioles (Figure 7D–D”, Figure 6—figure supplement 1E-E', G). Unlike okra (A-B-), however, the okra (A-B+) ovaries had much less damage in the nurse cells than in the oocyte, which was not significantly different than γH2Av labeling in wild type nurse cells in either frequency or intensity (Figure 7D–D”, Figure 6—figure supplement 1E-E', G, Figure 6—figure supplement 2, Supplementary files 1 and 2). Given that p53 expresses p53B but not p53A, these results suggest that in okra mutants the p53A isoform is required to protect genome integrity in the oocyte, while the p53B isoform plays a prominent role in DNA break repair within nurse cells. okra (A+B-) also had repair foci up to stage 6, but in these ovaries lacking p53B there were numerous repair foci in both the nurse cells and oocyte (Figure 7E–E”, Figure 6—figure supplement 1F-G, Figure 6—figure supplement 2, Supplementary files 1 and 2). Thus, p53B is required for DNA repair in nurse cells and oocytes. These data suggest that p53 isoforms are crucial when HR is compromised, and that they have both overlapping and distinct functions in nurse cells and oocytes to protect genome integrity.
Figure 7.

p53A and p53B have overlapping and distinct functions in germline genome integrity and the meiotic pachytene checkpoint.

(A-E’) Drosophila ovarioles of indicated genotypes were immunolabeled for γ-H2Av (red A-E) to detect DNA breaks and counterstained with the DNA dye DAPI (blue A’-E’). The ovarioles are shown with the anterior germarium to left (square bracket). Scale bars are 25 µm. (A”-E”) Quantification of percent of ovarioles with γ-H2Av-positive nurse cells (blue squares) and oocyte (red ovals) at different stages. Values are means of five biological replicates and >20 ovarioles with error bars representing S.E.M. Those values that had low variance have very small error bars that are not visible in the graphs. See Figure 6—figure supplement 1 for higher mag images of germaria, and Supplementary file 1 for p values. (F–K) p53A is required for activation of the pachytene checkpoint. (F–J) Oocyte nuclei from stage 3 to 4 egg chambers labeled with antibodies against synaptonemal protein C(3)G (red) and DNA dye DAPI (blue). (F) Wild type with spherical compact karyosome. (G) okra with diffuse chromatin indicating activation of the pachytene checkpoint. (H) okra (A-B-) null with compact spherical karyosome. (I) okra (A-B+) p53A mutant with spherical karyosome. (J) okra (A+B-) with elliptical nucleus. Scale bars are 3 µm. (K) Quantification of karyosome formation. Data are means based on two biological replicates with ~30 nuclei per strain per replicate, with error bars representing S.E.M. * p < 0.05, ** p < 0.01, n.s. = not significant by unpaired Student’s t test.

p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Class I- wild type; Class II: ventralized; Class III: short or missing dorsal appendages. Class IV: Small collapsed eggs with thin eggshells. See Figure 7—figure supplement 2 for quantification.

p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Class I- wild type; Class II: ventralized; Class III: short or missing dorsal appendages. Class IV: Small collapsed eggs with thin eggshells.

Hatch rates of eggs from p53 and okr single or double mutant mothers. The hatch rate for all okr single and double mutants was zero (complete female sterility). p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Shown are mean and standard deviation based on four to five biological replicates of 30–50 eggs per genotype. *p < 0.05, **p < 0.01 versus wild type by unpaired student’s t test.

p53A and p53B have overlapping and distinct functions in germline genome integrity and the meiotic pachytene checkpoint.

(A-E’) Drosophila ovarioles of indicated genotypes were immunolabeled for γ-H2Av (red A-E) to detect DNA breaks and counterstained with the DNA dye DAPI (blue A’-E’). The ovarioles are shown with the anterior germarium to left (square bracket). Scale bars are 25 µm. (A”-E”) Quantification of percent of ovarioles with γ-H2Av-positive nurse cells (blue squares) and oocyte (red ovals) at different stages. Values are means of five biological replicates and >20 ovarioles with error bars representing S.E.M. Those values that had low variance have very small error bars that are not visible in the graphs. See Figure 6—figure supplement 1 for higher mag images of germaria, and Supplementary file 1 for p values. (F–K) p53A is required for activation of the pachytene checkpoint. (F–J) Oocyte nuclei from stage 3 to 4 egg chambers labeled with antibodies against synaptonemal protein C(3)G (red) and DNA dye DAPI (blue). (F) Wild type with spherical compact karyosome. (G) okra with diffuse chromatin indicating activation of the pachytene checkpoint. (H) okra (A-B-) null with compact spherical karyosome. (I) okra (A-B+) p53A mutant with spherical karyosome. (J) okra (A+B-) with elliptical nucleus. Scale bars are 3 µm. (K) Quantification of karyosome formation. Data are means based on two biological replicates with ~30 nuclei per strain per replicate, with error bars representing S.E.M. * p < 0.05, ** p < 0.01, n.s. = not significant by unpaired Student’s t test.

Images of eggshell phenotype classes produced by p53 and okr single or double mutant mothers.

p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Class I- wild type; Class II: ventralized; Class III: short or missing dorsal appendages. Class IV: Small collapsed eggs with thin eggshells. See Figure 7—figure supplement 2 for quantification.
Figure 7—figure supplement 2.

Quantification of eggshell phenotype classes produced by p53 and okr single or double mutant mothers.

p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Class I- wild type; Class II: ventralized; Class III: short or missing dorsal appendages. Class IV: Small collapsed eggs with thin eggshells.

Quantification of eggshell phenotype classes produced by p53 and okr single or double mutant mothers.

p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Class I- wild type; Class II: ventralized; Class III: short or missing dorsal appendages. Class IV: Small collapsed eggs with thin eggshells.

p53 mutant mothers have reduced fertility.

Hatch rates of eggs from p53 and okr single or double mutant mothers. The hatch rate for all okr single and double mutants was zero (complete female sterility). p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Shown are mean and standard deviation based on four to five biological replicates of 30–50 eggs per genotype. *p < 0.05, **p < 0.01 versus wild type by unpaired student’s t test.

p53A is required for the meiotic pachytene checkpoint

Defects in meiotic DNA recombination and repair are known to activate a meiotic pachytene checkpoint arrest in multiple organisms (Bähler et al., 1994; Gebel et al., 2017). During oogenesis in mice and humans, the pachytene arrest is mediated by p63 and p53 (Suh et al., 2006; Bolcun-Filas et al., 2014; Coutandin et al., 2016; Gebel et al., 2017; Marcet-Ortega et al., 2017; Rinaldi et al., 2020). In Drosophila, it is known that defects in the repair of meiotic DNA breaks activate the pachytene checkpoint, but it is not known whether this checkpoint response requires p53 (Ghabrial et al., 1998; Joyce and McKim, 2011; Hughes et al., 2018). To address this question, we used an established assay that depends on a visible manifestation of the Drosophila pachytene checkpoint arrest, which is a failure of the oocyte nucleus to form a compact spherical structure known as the karyosome, which normally occurs during stage 3 of oogenesis (Ghabrial et al., 1998). It has been shown that activation of the pachytene checkpoint results in an oocyte nucleus with either a diffuse or ellipsoidal morphology (Ghabrial et al., 1998). We examined karyosome formation by labeling with antibodies against the synaptonemal complex (SC) protein C(3)G and DAPI (Page and Hawley, 2001). In wild type females, 95% of ovarioles had a spherical compact karyosome beginning in stage 3 (Figure 7F and K). In okra mutants, compaction was normal in only 5% of ovarioles, with the oocytes in 95% of ovarioles appearing either diffuse or ellipsoidal, consistent with previous reports that DNA repair defects in these okra mutants activate the pachytene checkpoint (Figure 7G and K; Ghabrial et al., 1998). In okra (A-B-) null double mutants, however, karyosome compaction was normal in 68% of ovarioles, a fraction that is significantly different than the okra single mutant, suggesting that p53 is required for normal activation of the pachytene checkpoint (Figure 7H and K). Similarly, in okra (A-B+) double mutants karyosome compaction was normal in 68% of ovarioles (Figure 7I and K). In contrast, okra (A+B-) mutants had normal karyosome compaction in only 9% of ovarioles, a fraction that was not significantly different than okra single mutants, indicating that the pachytene checkpoint was activated in most of these ovarioles that expressed p53A but not p53B (Figure 7J and K). Altogether these data suggest that the p53A isoform is required for normal pachytene checkpoint activation when meiotic DNA recombination is impaired, analogous to the functions of mammalian p53 and p63.

Mutation of p53 isoforms result in defects in egg patterning and embryo survival

The DNA repair defects in the p53 mutants prompted an inquiry into what consequences this genome damage has on oogenesis and female fertility. It is known that mutation of okra and other genes required for meiotic DNA break repair disrupt patterning signals from the oocyte, resulting in ventralized eggs and eggshells and embryos that fail to hatch (Ghabrial et al., 1998; Ghabrial and Schüpbach, 1999; Hughes et al., 2018). Analysis of okra females confirmed that they have a variably expressive, maternal-effect eggshell phenotype, producing eggs that ranged from wild type to different degrees of ventralization, evident as closely spaced or fused eggshell dorsal appendages, while other eggs were small and misshapen with thin shells (Figure 7—figure supplements 1–2). None of the eggs produced by the okra mothers hatched, consistent with previous reports that they are completely female sterile (Figure 7—figure supplement 3; Ghabrial et al., 1998). The p53 (A-B-) null and p53 (A+B-) isoform-specific mutant females also produced eggs with abnormal eggshells, but this phenotype was less severe than in the okra mutants, and only the p53 (A+B-) mothers produced clearly ventralized eggs (Figure 7—figure supplements 1–2). The phenotype of p53 (A-B+) was much less severe, with most eggs appearing normal (Figure 7—figure supplements 1–2). Egg hatch rates for all of the p53 mutants were significantly lower than wild type controls, indicating that all the p53 mutant alleles have a partial maternal-effect embryonic lethal phenotype (Figure 7—figure supplement 3). The eggshell phenotypes of okra; p53 double mutants were much more severe than either single mutant. The okra and okr mothers produced eggs that were shorter and severely ventralized, with dorsal appendages often fused, shortened, or missing (Figure 7—figure supplements 1–2). The okra null mothers produced eggs with the most severe phenotypes, which ranged from completely fused dorsal appendages to very small eggs with extremely thin shells (Figure 7—figure supplements 1–2). Similar to okra single mutants, none of the eggs produced by okra; p53 double mutant mothers hatched (Figure 7—figure supplement 3). These results indicate that mutation of p53 isoforms result in defects in egg patterning and embryo survival that are enhanced by mutation in other genes required for meiotic DNA break repair.
Figure 7—figure supplement 1.

Images of eggshell phenotype classes produced by p53 and okr single or double mutant mothers.

p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Class I- wild type; Class II: ventralized; Class III: short or missing dorsal appendages. Class IV: Small collapsed eggs with thin eggshells. See Figure 7—figure supplement 2 for quantification.

Figure 7—figure supplement 3.

p53 mutant mothers have reduced fertility.

Hatch rates of eggs from p53 and okr single or double mutant mothers. The hatch rate for all okr single and double mutants was zero (complete female sterility). p53A+B+ = wild type. okr; p53A+B+ = okra single mutant. Shown are mean and standard deviation based on four to five biological replicates of 30–50 eggs per genotype. *p < 0.05, **p < 0.01 versus wild type by unpaired student’s t test.

Discussion

A common property of the p53 gene family across organisms is that they encode multiple protein isoforms whose functions are still being defined. We found that the Drosophila p53B protein isoform is more highly expressed in the germline where it colocalizes with a shorter p53A isoform in subnuclear bodies. Despite this p53B germline expression, it is the p53A isoform that was necessary and sufficient for the apoptotic response to IR in both the germline and soma. Although apoptosis is repressed in meiotic oocytes and endocycling nurse cells, we found that both p53 isoforms are required in these cells for the timely repair of meiotic DNA breaks. The role of the p53 isoforms in DNA repair was cell type specific, with p53B playing the most prominent role in the nurse cells, whereas both p53B and p53A were required in the oocyte. Our data has also uncovered a requirement for the Drosophila p53A isoform in the meiotic pachytene checkpoint response to unrepaired DNA breaks. Overall, these data suggest that Drosophila p53 isoforms have evolved overlapping and distinct functions to mediate different responses to different types of DNA damage in different cell types. These findings are relevant to understanding the evolution of p53 isoforms, and have revealed interesting parallels to the function of mammalian p53 family members in oocyte quality control.

p53 localizes to subnuclear bodies in Drosophila and humans

p53 isoforms colocalized to subnuclear bodies in the Drosophila male and female germline (Figure 8A). This finding is consistent with a previous study that reported p53 bodies in the Drosophila male germline, although that study did not examine individual isoforms (Monk et al., 2012). We deem it likely that these p53 bodies form by phase separation, an hypothesis that remains to be formally tested (Mitrea and Kriwacki, 2016; Alberti, 2017). Drosophila p53 subnuclear bodies are reminiscent of human p53 protein localization to subnuclear PML bodies (Mauri et al., 2008). Evidence suggests that trafficking of human p53 protein through PML bodies mediates p53 post-translational modification and function, although the relationship between nuclear trafficking and the functions of different p53 isoforms has not been fully evaluated (Fogal et al., 2000; Chang et al., 2018). Similarly, we observed a decline in abundance of p53B within p53 bodies in germarium region 2a, followed by a restoration of p53B within bodies in region 3. This fluctuation of p53B in bodies temporally correlates with the onset of meiotic DNA breaks in region 2a and their repair in regions 2b - 3. These observations are consistent with the idea that nuclear trafficking of p53B out of bodies may mediate its response to meiotic breaks, although it is also possible that p53B is degraded and rapidly resynthesized during this 24 hr period (Figure 8A). Future analysis of Drosophila p53 bodies will help to define how p53 isoform trafficking mediates the response to genotoxic and other stresses.
Figure 8.

Model: Drosophila p53 isoforms colocalize to nuclear bodies and have DNA lesion and cell type specific functions in the germline genotoxic stress response.

(A) The p53A (green) and p53B (red) isoforms are concentrated in p53 bodies of germline nuclei (blue). Trafficking of p53 isoforms through these bodies (double arrow) may mediate their functions in transcription, transposable element (T.E.) repression, and DNA repair. (B) The p53A isoform mediates the apoptotic response to IR in dividing germline cells in region 1 of the germarium. This apoptotic response is repressed in germline stem cells (GSCs) and meiotic cells. The data lead to the proposal that p53B is required for repair of meiotic DNA breaks in nurse cell (blue) and oocyte (red) nuclei, whereas p53A is required for DNA repair and activation of the meiotic pachytene checkpoint in oocytes when homologous recombination (HR) is defective.

Model: Drosophila p53 isoforms colocalize to nuclear bodies and have DNA lesion and cell type specific functions in the germline genotoxic stress response.

(A) The p53A (green) and p53B (red) isoforms are concentrated in p53 bodies of germline nuclei (blue). Trafficking of p53 isoforms through these bodies (double arrow) may mediate their functions in transcription, transposable element (T.E.) repression, and DNA repair. (B) The p53A isoform mediates the apoptotic response to IR in dividing germline cells in region 1 of the germarium. This apoptotic response is repressed in germline stem cells (GSCs) and meiotic cells. The data lead to the proposal that p53B is required for repair of meiotic DNA breaks in nurse cell (blue) and oocyte (red) nuclei, whereas p53A is required for DNA repair and activation of the meiotic pachytene checkpoint in oocytes when homologous recombination (HR) is defective.

p53A mediates the apoptotic response to IR in the soma and germline

TUNEL labeling indicated that p53A is necessary and sufficient for apoptosis in both the germline and soma. IR induced apoptosis to a similar frequency in p53 (A+B+) wild type and p53 (A+B-) mutants, whereas the frequency of apoptosis in p53 (A-B+) mutants was equivalent to that of p53 (A-B-) null and unirradiated controls. Consistent with this, hid-GFP reporter expression was not induced by IR in the p53 (A-B-) null mutant, whereas IRinduced hid-GFP expression in the p53 (A+B-) mutant was equivalent to p53 (A+B+) wild type, indicating that the p53A isoform is required for the transcriptional response to IR-induced DNA breaks. It is interesting to note that while germline cystocytes in germarium region one apoptosed after IR, their ancestor GSCs and descendent meiotic cells did not (Figure 8B). The observed IR-induced expression of the hid-GFP promoter reporter in GSCs is consistent with previous evidence that apoptosis is repressed in these stem cells downstream of hid transcription by the miRNA bantam (Wylie et al., 2014; Xing et al., 2015; Ma et al., 2016). How meiotic cells repress apoptosis is not known, although it is crucial that they do so because they have programmed DNA breaks. Together, these data suggest that p53A is necessary and sufficient for induction of proapoptotic gene expression and apoptosis in response to IR-induced DNA breaks in the soma and germline. While our manuscript was in preparation, it was reported that p53A and p53B both participate in the apoptotic response to IR in the ovary (Park et al., 2019). That study used the GAL4/ UAS system to express either p53A or p53B rescue transgenes in a p53 null background. In contrast, we created and analyzed loss-of-function, isoform-specific alleles at the endogenous p53 locus, which we believe more accurately reflect the physiological function of p53 isoforms. We favor the conclusion, therefore, that it is the p53A isoform that has the primary function of mediating the apoptotic response to IR in the soma and germline.

Meiotic DNA breaks activate p53A transcription factor activity

In the absence of IR, there was a lower but detectable hid-GFP expression at the onset of meiosis in germarium region 2. This region 2 expression was dependent on p53 and formation of meiotic breaks by Mei-W68, consistent with previous reports that used a rpr-GFP reporter to show that p53 responds to meiotic DNA breaks (Lu et al., 2010). This low level of hid-GFP expression in region two without IR was similar between p53 (A+B+) wild type and p53 (A+B-) mutants, suggesting that the p53A transcription factor activity responds to meiotic DNA breaks. The results for the p53 (A-B+) mutant were not informative, however, because in that mutant hid-GFP expression was constitutively higher than wild type beginning in early region 1 of the germarium. We did not observe γ-H2Av labeling before late region 1/ region 2 a indicating that this low-level activity of p53B is not a response to DNA breaks. While further experiments are required to define the mechanism, a cogent hypothesis is that in the absence of the p53A subunit p53B homotetramers have somewhat higher basal activity. This hypothesis is consistent with our previous evidence that the p53B isoform with a longer transactivation domain is a much stronger transcription factor than p53A, and that p53A and p53B can form heterocomplexes (Zhang et al., 2015). It is also consistent with evidence that the shorter p53 isoforms in humans and other organisms repress the transcriptional activity of longer isoforms in heterotetramers (Anbarasan and Bourdon, 2019). It is important to note, however, that while hid expression was higher in the p53A mutants than in wild type, it was not associated with apoptosis. Overall, while the hid-GFP reporter evidence suggests that p53A responds to meiotic DNA breaks, it is unclear whether this low-level activation of p53A transcription factor activity is related to its role in meiotic DNA break repair or checkpoint activation, which we discuss further below.

p53 isoforms have overlapping and distinct requirements to prevent germline DNA damage

Our evidence suggests that both p53 isoforms are required for the timely repair of meiotic DNA breaks in the Drosophila female germline. p53 null and isoform-specific mutants had a persistent germline DNA break phenotype that was dependent on the creation of double-strand DNA breaks by Mei-W68 (Figure 8B). Further consistent with a role in meiotic DNA break repair, p53 mutants had an increased number of cells with γ-H2Av foci beginning in germarium stage 2a, the time when Mei-W68 induces programmed meiotic DNA breaks. Moreover, the number of persistent breaks per cell was higher in oocyte and adjacent nurse cell, the presumptive pro-oocyte, which are known to have more meiotic breaks. This p53 DNA break mutant phenotype is similar to that of okra (RAD54L) and other genes required for meiotic break repair and was enhanced in okra; p53 double mutants. It was previously shown using p53 null alleles that p53 also protects the germline genome by restraining mobile element activity, but we did not evaluate whether one or both of the p53 isoforms are required for this function (Wylie et al., 2016; Wei et al., 2019). Overall, our data strongly suggest that both p53 isoforms have an important role in the repair of meiotic DNA breaks. Our analysis also revealed that p53 isoforms have overlapping and distinct requirements for meiotic break repair in different cell types (Figure 8B). Both p53A and p53B were required in the oocyte, whereas p53B played the more prominent role in nurse cells, even though nurse cells express both p53A and p53B isoforms. This differential requirement for p53 isoforms may reflect differences in how meiotic breaks are repaired in nurse cells versus oocytes. While it is not known whether DNA repair pathways differ between nurse cells and oocytes, evidence suggests that the creation of meiotic breaks does, with breaks in pro-oocytes but not pro-nurse cells depending on previous SC formation (Mehrotra and McKim, 2006). Important questions motivated by our results are how distinct responses to DNA damage in different cells are determined by different types of DNA lesions, checkpoint signaling and repair pathways, and p53 isoform structure. The consequences of p53 null and isoform-specific alleles for oogenesis were also similar to okra mutants in that they caused reduced female fertility and defects in eggshell patterning and synthesis. Previous evidence suggested that defective meiotic DNA break repair causes these maternal effect phenotypes in part through disrupting patterning signals from the oocyte to somatic follicle cells (Ghabrial and Schüpbach, 1999). The maternal effect on egg hatch rates, however, was much more severe in the okra mutants, which were completely female sterile, consistent with previous studies (Ghabrial et al., 1998). Thus, although the p53 and okra null mutants had similar levels of germline DNA damage, the severity of their maternal-effect on egg patterning and embryo viability differ, suggesting that some of their pleiotropic effects on oogenesis are distinct. Together, the results indicate that defects in repair of meiotic DNA breaks in both p53 and okra mutant females negatively impact embryo patterning and female fertility. The requirement for Drosophila p53 in the repair of meiotic DNA breaks is consistent with evidence from other organisms that p53 has both indirect and direct roles in DNA repair. It is known that Drosophila p53 and specific isoforms of human p53 induce the expression of genes that are required for different types of DNA repair (Brodsky et al., 2004; Gong et al., 2015; Williams and Schumacher, 2016). p53 also acts locally at DNA breaks in a variety of organisms, including humans, where it can mediate the choice between HR versus non-homologous end joining (NHEJ) repair (Moureau et al., 2016; Williams and Schumacher, 2016). In fact, it has been shown that human p53 directly associates with RAD54 at DNA breaks to regulate HR repair, consistent with our finding that p53; okra (RAD54L) double mutants have severe DNA repair defects (Linke et al., 2003). Moreover, the C. elegans p53 ortholog CED-4 localizes to DNA breaks to promote HR and inhibit NHEJ repair in the germline (Mateo et al., 2016). Although the hid-GFP reporter indicated that meiotic DNA breaks induce a low level of p53A transcription factor activity, Hid has no known role in DNA repair, and it remains unknown whether p53-regulated expression of DNA repair genes is required for the timely repair of meiotic DNA breaks. We deem it likely that the persistent DNA damage that we observe in the germline of Drosophila p53 mutants may, in part, reflect a local requirement for p53 protein isoforms to regulate meiotic DNA repair (Figure 8A–B). Important remaining questions include whether different p53 isoforms participate indirectly in DNA repair by inducing transcription and directly at DNA breaks to influence the choice among different DNA repair pathways.

Similar to the mammalian p53 family, Drosophila p53A is required for the meiotic pachytene checkpoint

Our study has also uncovered a requirement for Drosophila p53 in the meiotic pachytene checkpoint. This function was isoform-specific, with p53A, but not p53B, being required for full checkpoint activation in oocytes with persistent DNA breaks. The failure to engage the pachytene checkpoint in the majority of okra; p53 double mutant oocytes is more striking given that these cells had more severe DNA repair defects than the okra single mutants that strongly engaged the checkpoint. While the pachytene arrest was compromised to similar extents in okra; p53 null and okra; p53 mutants, some egg chambers in both genotypes did engage a pachytene arrest. This observation suggests that there are p53-independent mechanisms that also activate the checkpoint, perhaps in response to secondary defects in chromosome structure, which are known to independently trigger the pachytene checkpoint in flies and mammals (San-Segundo and Roeder, 1999; Wu and Burgess, 2006; Li et al., 2007; Joyce and McKim, 2009). Moreover, although the pachytene checkpoint was strongly compromised in the p53 null and p53A mutant alleles, it did not suppress okra female sterility, suggesting that other mechanisms ensure that oocytes with excess DNA damage do not contribute to future generations. Altogether, the results indicate that p53A is required for both DNA repair and full pachytene checkpoint activation in the oocytes. Evidence suggests that the ancient function of the p53 family was of a p63-like protein in the germline (Levine, 2020). Consistent with this, our findings in Drosophila have parallels to mammals where the TAp63α isoform and p53 mediate a meiotic pachytene checkpoint arrest, and the apoptosis of millions of oocytes that have persistent defects (Di Giacomo et al., 2005; Suh et al., 2006; Bolcun-Filas et al., 2014; Gebel et al., 2017; Rinaldi et al., 2017; Rinaldi et al., 2020). Our evidence suggests that the different isoforms of the sole p53 gene in Drosophila may subsume the functions of vertebrate p53 and p63 paralogs to protect genome integrity and mediate the pachytene arrest. Unlike p53 and p63 in mammals, however, Drosophila p53 does not trigger apoptosis of defective oocytes. Instead, the activation of the pachytene checkpoint disrupts egg patterning, resulting in inviable embryos that do not contribute to future generations (Hughes et al., 2018). Thus, in both Drosophila and mammals, the p53 gene family participates in an oocyte quality control system that protects the integrity of the transmitted genome.

Materials and methods

Drosophila genetics

Fly strains were reared at 25°C and were obtained from the Bloomington Drosophila Stock Center (BDSC, Bloomington, IN, USA) unless otherwise noted. The hid-GFP fly strain was a generous gift from W. Du (Tanaka-Matakatsu et al., 2009). y w and w strains were used as wild type. The okra mutant strains were obtained from T. Schupbach. mei-W68 alleles were obtained from K. McKim and the BDSC. The mei-W68 null genotype for Figure 6—figure supplement 3 was mei-W68. See the Key Resources Table for a complete list of fly strains used in this study.

Creation and characterization of p53A and p53B isoform-specific alleles

Isoform-specific alleles of p53 were generated by injection of gRNA encoding plasmid into embryos of a nanos-Cas9 strain using standard methods (Gratz et al., 2014; Ren et al., 2013). Candidate lines for p53B-specific alleles were initially identified by screening for co-knockout of white (Ge et al., 2016). Injections were performed by Rainbow Transgenics (USA). Alleles were identified and characterized by PCR genotyping / sequencing. The p53 allele is a 23 bp deletion (coordinates 23053346–23053368 in the D. melanogaster genome version 6.32), and has a seven base-pair insertion (Robin et al., 2019). The p53 allele is a 14 bp deletion (coordinates 23053726–23053739) with an insertion of a single Adenine. RT-PCR analysis of p53 isoform-specific mutants was performed on mRNA from adult flies using standard methods. See Figure 2—figure supplement 1 and Key Resources Table for further information about alleles, gRNAs and primers.

Gamma irradiation and cell death assays

Adult females were mated and conditioned on wet yeast for three days. They were then irradiated with a total of 4000 rad (40 Gy) from a Cesium source and were allowed to recover at 25 °C for 4 hr before TUNEL labeling. TUNEL labeling (In Situ cell death detection kit, Fluorescein, Roche) was performed according to manufacturer’s instructions. Follicle cell death in Figure 2 was quantified by counting TUNEL-positive cells in oogenesis stage 6.

Immunofluorescent microscopy

Dissection, fixation, antibody labeling, and immunofluorescent microscopy of testes and ovaries were as previously described (Thomer et al., 2004). Primary antibodies, sources, and concentrations used were rabbit anti-GFP (Invitrogen) 1:500, rabbit anti-dsRed (Clontech) 1:200, mouse anti dsRed (Clontech) 1:200, mouse anti Hts1B1 (DSHB) 1:20 (Zaccai and Lipshitz, 1996), mouse anti-γH2Av (DSHB) 1:1,000 (Lake et al., 2013), and mouse anti-Orb 4H8 isotype IgG1 (DHSB) 1:500. The anti-γH2Av antibody was preabsorbed against fixed wild type ovaries before use. Secondary antibodies were Alexa 488 anti-rabbit, Alexa 488 anti-mouse, Alexa 568 anti-rabbit, and Alexa 568 anti-mouse (Invitrogen) all used at 1:500-1-750. For Figure 6—figure supplement 1, specialty isotype-specific Alexa 488 (IgG1) and Alexa 568 (IgG2b) were used to distinguish between γ-H2Av and orb-4H8 as previously described (Collins et al., 2014). Samples were counterstained with DNA dye 4′,6-diamidino-2-phenylindole (DAPI) at 1 μg/ml. Confocal micrographs were captured on a Leica SP8 confocal using a 63 X multi-immersion lens. Fluorescence intensities were quantified using the LASX software of the Leica Sp8 confocal microscope. The hid-GFP fluorescence intensity of Figure 3 was measured across z-stacks of each germarium. The intensities of GFP-p53A and mCh-p53B in p53 bodies in Figures 1 and 5, Figure 1—figure supplement 1, and Figure 5—figure supplement 1 were quantified along a line. For strains expressing both GFP-p53A and mCh-p53B, the ratio of GFP-p53A: mCh-p53B was quantified within each body. For those expressing a single tagged isoform, the ratios of intensities in germarium regions 1:2 or 2:3 among different bodies was calculated, all within the same germarium to control for technical variation. For all experiments, germline cells were identified by labeling with either anti-Hts, anti-Vasa, or anti-Orb. In Figures 6 and 7, and Figure 6—figure supplement 1, the persistence of γ-H2Av into later stages was quantified by scoring oocyte and nurse cells whose total fluorescent intensity was significantly above that of wild type controls. Similar methods were used in Figure 6—figure supplement 2 to quantify total anti-γH2Av intensity in individual oocytes or nurse cells in stage 1. Statistical analyses were performed using GraphPad Prism. See figure legends and Supplementary files 1 and 2 for sample sizes and p values. p53 is an important factor in maintaining genome integrity across species. The Drosophila genome encodes multiple p53 isoforms, and the authors use genome-editing to make isoform-specific p53 deletions. They then compare responses to ionizing radiation and meiotic double-stranded breaks in these backgrounds in the ovary. The authors reports two significant findings: (1) the apoptotic response depends on the p53A isoform, and (2) both p53A and p53B isoforms have important roles in the response to meiotic double-stranded breaks. Thus, this work provides important insights into the functions of p53 family members in protecting the genome in germ cells. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Decision letter after peer review: Thank you for submitting your article "Drosophila p53 isoforms have overlapping and distinct functions in germline genome integrity and oocyte quality control" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Utpal Banerjee as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: R Scott Hawley (Reviewer #1). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: The authors have generated new and useful p53 reagents, which they have employed in four functional assays – apoptosis (TUNEL after 40 Gy irradiation (Figure 2-3)), transcriptional induction (monitored by hid-GFP (Figure 4-5)), double stranded DNA breaks (DSB) (monitored by gammaH2AV (Figure 7-8)) and activation of pachytene checkpoint (monitored by synaptonemal complex protein C(3)G (Figure 8F-K)). The main findings are: (1) the apoptotic response to ionizing radiation (IR) depends on p53A (2) expression of hid-GFP in region 2a-2b germ cells requires p53B (3) DSBs occur at higher rates in both the p53A and the p53B mutants (4) p53B can repair of meiotic breaks in nurse cells but in not oocytes Essential revisions: Despite the generation of high-quality, new reagents, this paper is currently fairly descriptive. Of 8 figures, two show the expression pattern of the tagged p53 isoforms in various parts of the germarium (Figures1 and 6). Some of the observations based on functional assays remain unexplained and need further experiments, including points 1 and 2 below. 1) The authors conclude that the p53 isoforms respond to meiotic DNA breaks, but there are no experiments which lead to this conclusion. If the authors want to conclude this, they need (a) to analyze hid-GFP expression a mei-W68 mutant and (b) stain the germarium with both HID and gammaH2AV. The authors should also examine meiotic breaks in p53A+B+, p53A-B-, p53A-B+ and p53A+B- in a background that is also mei-W68 mutant. 2) The authors are missing a more detailed analysis of the interesting observation that hid-GFP is stronger in region 1 of p53A-B+ than in the wild type p53A+B+. This observation cannot be explained by meiotic DSBs (which occurs in region 2), but the authors do not provide a mechanism. Is this due to transposable elements? The authors need to supply new data to provide a mechanistic understanding of this observation. 3) The authors are encouraged to provide better data to support the conclusion that the DNA damage phenotypes of p53 and okra mutants are comparable. The images in Figures 7, 8B and B' are not sufficient to assess this. The authors could quantify the number of gammaH2AV foci or intensity (rather than measure the number of positive cells). Related to this, it is surprising that p53 mutants lack the DV defects seen in okra mutants, particular since defects in DSB repair should cause nondisjunction. Okra mutants are sterile. The authors should comment upon the fertility of p53 mutants. 4) Some experiments have only 2 biological replicates (Figures 4 and 8K). Figures 7 and 8 have "2-3 replicates". The authors need to state specifically for each experiment how many replicates were scored. Ideally, they should have at least 3 replicates for each experiment or explain why that is not necessary. Reviewer #1: In this manuscript Chakravarti et al. build on the previous work from the Calvi lab characterizing specific roles for the p53A isoform. In their 2015 paper Zhang et al. showed, using isoform specific loss of function mutants, that p53A is primarily responsible for mediating the apoptotic response to ionizing radiation in the soma and that p53B is very lowly expressed in the cell types studied. They speculated that p53B might function in germline specific roles, such as meiotic checkpoints and DNA repair, identified in mammalian p53 studies. Here Chakravarti et al., have further characterized the functions of the p53A and B isoforms in Drosophila. In the ovary, p53A mediates the apoptotic response to IR and is also required for meiotic checkpoint activation. p53B is both necessary and sufficient for repair of meiotic breaks in nurse cells but not oocytes. p53B is required for expression of a hid-GFP reporter in region 2a-2b cells which may be related to a loss of p53B detection in p53A/B nuclear bodies at that stage. There are no substantive concerns with this manuscript. Reviewer #2: The Drosophila genome encodes multiple p53 isoforms. P53 is an important factor in maintaining genome integrity and having multiple isoforms in flies raises an interesting evolutionary concept because humans have a gene family of p53 members. In this paper, the expression and function of the isoforms is compared in the germ line. There are two significant findings based on investigating these two isoforms. First, the apoptotic response depends on the A form, and both have roles in the response to meiotic DSBs. These results represent a significant and important extensions of previous work from another group that showed p53 suppresses transposon activity. With one important exception, the data are solid and support the conclusions. The data regarding the apoptotic response is based on TUNEL and a hid-GFP reporter. This data shows that irradiation induces a response in the mitotic region but not later regions. Conversely, there is a milder induction in the meiotic region (region 2a). Both could be in response to DSBs. But it is amazing that there is no HID induction following IR in these meiotic regions. Thus, there is a satisfying correlation between the apoptosis and HID responses to IR, and both are diminished in the meiotic region. The most significant concern with this paper is that conclusions that the p53 isoforms respond to meiotic DNA breaks. Indeed, this is the title of the section starting at the end of pg 7, but there are no experiments which lead to this conclusion. Similarly, the sentence "To determine whether p53A or p53B isoforms responds to meiotic DNA breaks" (pg 8), is followed by an experiment which does not do that (it compares HID expression in different p53 genotypes). The data in the paper are correlations between p53 expression and where DSBs occur in the germarium. Two experiments are needed. First, and most important, hid-GFP expression needs to be analyzed in a mei-W68 mutant. In addition, the germarium should be stained for both HID and gH2AV, the latter being the antibody the authors use in later Figures. It would also be satisfying to see the genotypes in Figure 7 performed in a mei-W68 mutant background, to determine if the persistent DNA damage in the p53 mutants depends on meiotic breaks. Reviewer #3: In this manuscript, Chakravarti and colleagues analyzed the functions of several p53 isoforms in the Drosophila germline. They created novel isoform-specific alleles by CRISPR/Cas9 to untangle the functions of p53A and p53B isoforms. They made use of a Phid-GFP reporter line to follow p53 transcriptional activity. The role of p53 in the development of Drosophila germline has been published several times before with a focus on the silencing of retro-transposons (TEs) and meiotic DNA breaks response (Lu, 2010; Wylie, 2014; Wylie, 2016). Despite this published literature, the authors created novel and very valuable tools, which allowed them to make several novel and interesting observations. My main criticism is that most of these observations remain unexplained and the manuscript feels descriptive as it stands. However, this manuscript has great potential if it could follow up some of these novel observations. Some examples are the following: 1) On Figure 5C, the authors made the interesting observation that hid-GFP was stronger in region 1 of p53A-B+ than in the wild type p53A+B+. This activity of p53 cannot be explained by meiotic DSBs as previously published, since meiotic DSBs only occur later in region 2. This observation remains unexplained and is not explored further. One possibility is that it could relate to transposable elements (TEs) activity in this region. TEs can create DSBs (thus non-meiotic) and p53 has been published to silence TEs in Drosophila (Wylie, 2014; Wylie, 2016). It is also particularly interesting that the silencing of TEs is known to be weakened in this specific region of the germarium even in wild type condition (Dufourt J, NAR, 2013; Theron E, NAR, 2018). Could p53A play a role in silencing TEs in this region when Piwi is downregulated? This would bring novel insights on when and where TEs are silenced in germ cells. A transcriptomic analysis of p53A-B+ germ cells could show whether TEs are upregulated in this hid-GFP++ cells. It is probably out of the scope of this manuscript. Another possibility would be to perform FISH for TEs known to be expressed in p53 mutant, such as TAHRE (Wylie, 2016). In addition, do the authors detect DSBs in region 1 in p53A-B+? 2) On Figure 7 and 8, the authors analyzed the role of p53 in "persistent" meiotic DSBs. I am not convinced that these DSBs are only persistent meiotic DSBs. As discussed by the authors themselves (page 13), the origin of these DSBs could be TEs mobilization. I think it is a very important caveat for their conclusions. Another non-exclusive possibility for DSBs appearing in endoreplicating nurse cells is incomplete replication and associated DNA deletions during repair as shown in (Yarosh and Spradling, GD, 2014). To distinguish between these possibilities and strengthen their conclusions, the authors should perform the same experiments in the absence of meiotic DSBs, such as in a meiW68 mutant background (meiW68, p53AB double mutant). meiW68, okra, p53 mutants may be hard to generate but shRNAs against meiW68 are publicly available and effective, while they may also exist for okra or other spindle genes, and could make this combination easier to generate. Other important comments: 3) The authors showed that p53A and p53B levels are developmentally regulated (Figure 6G): does overexpression of one or both of the isoforms have any phenotype? 4) I agree with the authors that karyosome defects are part of an array of phenotypes induced by the activation of DNA damage checkpoints. However, I would not equal it to the activation of a pachytene checkpoint and conclude that p53 is part of that checkpoint. 5) On Figure 7D, in p53A+B-, there seems to be a lot of DNA damages in follicular cells. Is this reproducible? Summary: The authors have generated new and useful p53 reagents, which they have employed in four functional assays – apoptosis (TUNEL after 40 Gy irradiation (Figure 2-3), transcriptional induction (monitored by hid-GFP (Figure 4-5)), double stranded DNA breaks (DSB) (monitored by gammaH2AV (Figure 7-8)) and activation of pachytene checkpoint (monitored by synaptonemal complex protein C(3)G (Figure 8F-K)). The main findings are: (1) the apoptotic response to ionizing radiation (IR) depends on p53A (2) expression of hid-GFP in region 2a-2b germ cells requires p53B (3) DSBs occur at higher rates in both the p53A and the p53B mutants (4) p53B can repair of meiotic breaks in nurse cells but in not oocytes We would like to thank the reviewers for their thoughtful comments and patience as we completed the requested experiments. Progress was slowed by a large number of challenges during this last trying year. These challenges included departure of the first author from the lab and U.S., and medical challenges of the other lab member who picked up the project. In addition, we lost and had to rebuild a number of the compound genotype strains that were required for the experiments. Since the initial submission, I have worked closely with lab members on this project and personally conducted a number of the experiments myself. During the course of these experiments, we realized that we had inadvertently used data for the mutant p53Bac rescue instead of the stated p53B CRISPR allele for the hid-GFP reporter experiments. We apologize for that mistake. Upon rebuilding those strains and repeating the experiment multiple times, we have found that the hid-GFP expression is not reduced 50% in the p53B mutant without IR; and thus, there is currently no evidence for activation of p53B transcription factor activity by meiotic breaks. We have, therefore, de-emphasized those experiments in the current version of the manuscript. The data, now shown in a new Figure 4, do continue to support that p53A is necessary and sufficient for activation of proapoptotic gene expression in response to IR, and is also activated to a lesser extent by meiotic breaks. As we more fully explain in the manuscript and below, that hid-GFP data is fairly tangential to our main findings. That is, it is unclear whether the low-level activation of p53A transcription factor activity by meiotic breaks is related to its role in DNA repair. Therefore, our major novel findings and conclusions remain the same: (1) p53B expression is biased to the germline, (2) p53A is required for the germline apoptotic response to IR, (3) both p53A and p53B are required for the timely repair of meiotic DNA breaks, and (4) p53A is required for the meiotic pachytene checkpoint. We have added new important data that support and extend these conclusions (see below). We believe that our new findings, represented in seven new supplementary figures, increase the rigor and scope of our study. Before a point-by-point response to previous reviews, I thought it would be helpful to summarize the major changes to the manuscript. (1) We removed the previous Figure 5 that had higher laser power images of hid-GFP expression in the absence of IR. As discussed above, the hid-GFP results are now consolidated into Figure 4. We have also edited the manuscript to reflect the new result with p53A+B- hid-GFP that indicates that the expression in region 2a is not reduced by 50%. (2) New Figure 4—figure supplement 1 shows results for mei-W68; hid-GFP that indicate that the hid-GFP reporter expression in region 2 is dependent on meiotic breaks. (3) New Figure 6—figure supplement 1 shows images and quantification of the frequency of g-H2Av labeling in stage 1 nurse cells and oocytes, the latter now marked with anti-Orb. These experiments also led to the new finding that one of the pro-oocytes that becomes a nurse cell often has more DNA damage than other nurse cells, consistent with a failure to repair meiotic breaks (Figure 6—figure supplement 1H). (4) New Figure 6—figure supplement 2 shows new data that quantifies g-H2Av intensity in stage 1 nurse cells and oocytes from p53 and okra single and double mutants, which is consistent with our previous data for frequency of labeling in different stages of oogenesis. (5) New Figure 6—figure supplement 3 shows that the persistent DNA damage in the p53 mutants is dependent on creation of meiotic DNA breaks by Mei-W68, and, therefore, that the persistent DNA damage in p53 mutants is the result of a failure to repair meiotic DNA breaks. (6) New Figure 7—figure supplement 1 shows images of eggs and our new finding that p53 mutants have ventralized and defective eggshells, similar to okra. (7) New Figure 7—figure supplement 2 is a graph that quantifies eggshell defects from p53 and okra single and double mutant mothers. The p53 null and isoform-specific mutant mothers produce eggs with different mutant severities, which are enhanced to different extents in the okra; p53 double mutants. (8) New Figure 7—figure supplement 3 quantifies hatch rates of eggs from p53 and okr single and double mutant mothers. All p53 alleles have a maternal-effect that significantly reduces egg hatch rate relative to wild type. The okra single and all okra; p53 double combinations have a hatch rate of zero, consistent with Trudi Schupbach’s previous finding that okra null mothers are completely sterile. (9) In response to reviewer’s requests, figures now have added panels that show fluorescent channels without DAPI. (10) Because old Figures 4, 5 are now consolidated into a new Figure 4, the old Figures 6-9 are now Figures 5-8. Changes to figures and text are described further below. Essential revisions: Despite the generation of high-quality, new reagents, this paper is currently fairly descriptive. Of 8 figures, two show the expression pattern of the tagged p53 isoforms in various parts of the germarium (Figures1 and 6). Some of the observations based on functional assays remain unexplained and need further experiments, including points 1 and 2 below. (1) The authors conclude that the p53 isoforms respond to meiotic DNA breaks, but there are no experiments which lead to this conclusion. If the authors want to conclude this, they need (a) to analyze hid-GFP expression a mei-W68 mutant and (b) stain the germarium with both HID and gammaH2AV. The authors should also examine meiotic breaks in p53A+B+, p53A-B-, p53A-B+ and p53A+B- in a background that is also mei-W68 mutant. We have conducted both of these suggested experiments. (a) Figure 4—figure supplement 1 shows that the low level hid-GFP expression we see in region 2 of the germarium is abolished in a mei-W68 (Spo11) mutant, and, therefore, that hid-GFP is indeed a reporter for meiotic DNA breaks. (b) Figure 6—figure supplement 3 shows that the persistent g-H2Av repair foci that we observe in p53 mutants is abolished in mei-W68; p53 double mutants. We agree that this is an important result because it strongly supports the model that Drosophila p53 isoforms are required for the timely repair of programmed meiotic DNA breaks. (2) The authors are missing a more detailed analysis of the interesting observation that hid-GFP is stronger in region 1 of p53A-B+ than in the wild type p53A+B+. This observation cannot be explained by meiotic DSBs (which occurs in region 2), but the authors do not provide a mechanism. Is this due to transposable elements? The authors need to supply new data to provide a mechanistic understanding of this observation. We addressed whether higher transposon and resultant DNA breaks could be the reason that the p53A mutant has higher hid-GFP in region 1 of the germarium. However, we did not observe an increase in g-H2Av labeling in stem cells, cystoblasts and region 1 cyst cells. This result is inconsistent with the transposon model. In contrast, the increased hid-GFP expression in the p53A mutant is consistent with our previous observations that p53A and p53B protein isoforms can form heterotetramers, and that p53B isoform is a stronger transcription factor (Zhang et al. 2015). Together with similar evidence from humans, this leads us to suggest that p53B homotetramers in the p53A isoform mutant induce a higher basal activity of the hid-GFP reporter. It should be stressed, however, that although the hid-GFP expression without IR in the p53A isoform mutant is higher than in p53 wild type, it is much lower than that seen after IR of wild type (see Figure 4), and is not associated with cell death. Although the elevated hid-GFP in p53A mutants is an intriguing observation, we believe that not knowing its precise mechanism does not alter the major conclusions of the present study - (1) That p53A is necessary and sufficient for apoptosis and (2) That p53A and p53B are required for repair of meiotic breaks and (3) That p53A is required participates in the pachytene checkpoint. We have edited the results and discussion in an effort to clarify these points and acknowledge that we have not provided evidence for the mechanism of the elevated hid-GFP in the p53A mutants. (pg 7, para 2; pg 12, para 1 and 2) (3) The authors are encouraged to provide better data to support the conclusion that the DNA damage phenotypes of p53 and okra mutants are comparable. The images in Figures 7, 8B and B' are not sufficient to assess this. The authors could quantify the number of gammaH2AV foci or intensity (rather than measure the number of positive cells). We have repeated the g-H2Av labeling multiple times for all the genotypes and have now quantified total g-H2Av intensity per nucleus in oocytes and nurse cells (Figure 6—figure supplements 1 and 2). This new quantification is consistent with the previous phenotypic characterization that showed that p53 null cells have persistent DNA damage that is comparable to okr mutants. It also bolsters our original observations that the p53A-B+ strain has less damage in nurse cells than other mutant genotypes. Thus, we have now quantified both the timing and level of DNA damage in different cell types during oogenesis, both of which support our initial conclusions that p53 isoforms have overlapping and distinct functions for timely repair of meiotic DNA breaks. Related to this, it is surprising that p53 mutants lack the DV defects seen in okra mutants, particular since defects in DSB repair should cause nondisjunction. Okra mutants are sterile. The authors should comment upon the fertility of p53 mutants. We thank the reviewers for prompting us to explore these questions. Figure 7—figure supplements 1-3 are images and quantification of our new analysis of eggshell morphology and fertility in the okr and p53 single and double mutants. The results indicate that p53 null and isoform-specific alleles all have reduced female fertility and eggshell dorsal-ventral patterning and synthesis defects. Moreover, the eggshell phenotypes are enhanced in okr; p53* double mutants. The enhanced eggshell phenotype is consistent with the enhanced DNA damage seen in the okr; p53* double mutants. Altogether, we have now significantly advanced our analysis of the biological impact of DNA repair defects on egg morphology and female fertility. 4) Some experiments have only 2 biological replicates (Figures 4 and 8K). Figures 7 and 8 have "2-3 replicates". The authors need to state specifically for each experiment how many replicates were scored. Ideally, they should have at least 3 replicates for each experiment or explain why that is not necessary. Sorry for the confusion. We have now more clearly indicated the number of replicates for each experiment in the figure legends. Supplementary file 1 has p values for frequency of g-H2Av labeling for oocytes and nurse cells in different stages of oogenesis. We have also now quantified and statistically analyzed g-H2Av intensity in oocyte and nurse cells in stage 1, the results of which are consistent with our previous results and interpretation (new Figures 6—figure supplements 1 and 2, Supplementary file 2 for p values). Reviewer #2: The Drosophila genome encodes multiple p53 isoforms. P53 is an important factor in maintaining genome integrity and having multiple isoforms in flies raises an interesting evolutionary concept because humans have a gene family of p53 members. In this paper, the expression and function of the isoforms is compared in the germ line. There are two significant findings based on investigating these two isoforms. First, the apoptotic response depends on the A form, and both have roles in the response to meiotic DSBs. These results represent a significant and important extensions of previous work from another group that showed p53 suppresses transposon activity. With one important exception, the data are solid and support the conclusions. The data regarding the apoptotic response is based on TUNEL and a hid-GFP reporter. This data shows that irradiation induces a response in the mitotic region but not later regions. Conversely, there is a milder induction in the meiotic region (region 2a). Both could be in response to DSBs. But it is amazing that there is no HID induction following IR in these meiotic regions. Thus, there is a satisfying correlation between the apoptosis and HID responses to IR, and both are diminished in the meiotic region. The most significant concern with this paper is that conclusions that the p53 isoforms respond to meiotic DNA breaks. Indeed, this is the title of the section starting at the end of pg 7, but there are no experiments which lead to this conclusion. Similarly, the sentence "To determine whether p53A or p53B isoforms responds to meiotic DNA breaks" (pg 8), is followed by an experiment which does not do that (it compares HID expression in different p53 genotypes). The data in the paper are correlations between p53 expression and where DSBs occur in the germarium. Two experiments are needed. First, and most important, hid-GFP expression needs to be analyzed in a mei-W68 mutant. In addition, the germarium should be stained for both HID and gH2AV, the latter being the antibody the authors use in later Figures. It would also be satisfying to see the genotypes in Figure 7 performed in a mei-W68 mutant background, to determine if the persistent DNA damage in the p53 mutants depends on meiotic breaks. We conducted both of the suggested experiments. Analysis of hid-GFP expression in a mei-W68 mutant background indicates that it responds to meiotic breaks (Figure 4—figure supplement 1). The persistent DNA breaks that we observed in the p53 mutant were eliminated in a mei-W68; p53 double mutant background (Figure 6—figure supplement 3), which supports the model that p53 is required for the timely repair of meiotic DNA breaks (Figure 8). Reviewer #3: In this manuscript, Chakravarti and colleagues analyzed the functions of several p53 isoforms in the Drosophila germline. They created novel isoform-specific alleles by CRISPR/Cas9 to untangle the functions of p53A and p53B isoforms. They made use of a Phid-GFP reporter line to follow p53 transcriptional activity. The role of p53 in the development of Drosophila germline has been published several times before with a focus on the silencing of retro-transposons (TEs) and meiotic DNA breaks response (Lu, 2010; Wylie, 2014; Wylie, 2016). Despite this published literature, the authors created novel and very valuable tools, which allowed them to make several novel and interesting observations. My main criticism is that most of these observations remain unexplained and the manuscript feels descriptive as it stands. However, this manuscript has great potential if it could follow up some of these novel observations. Some examples are the following: 1) On Figure 5C, the authors made the interesting observation that hid-GFP was stronger in region 1 of p53A-B+ than in the wild type p53A+B+. This activity of p53 cannot be explained by meiotic DSBs as previously published, since meiotic DSBs only occur later in region 2. This observation remains unexplained and is not explored further. One possibility is that it could relate to transposable elements (TEs) activity in this region. TEs can create DSBs (thus non-meiotic) and p53 has been published to silence TEs in Drosophila (Wylie, 2014; Wylie, 2016). It is also particularly interesting that the silencing of TEs is known to be weakened in this specific region of the germarium even in wild type condition (Dufourt J, NAR, 2013; Theron E, NAR, 2018). Could p53A play a role in silencing TEs in this region when Piwi is downregulated? This would bring novel insights on when and where TEs are silenced in germ cells. A transcriptomic analysis of p53A-B+ germ cells could show whether TEs are upregulated in this hid-GFP++ cells. It is probably out of the scope of this manuscript. Another possibility would be to perform FISH for TEs known to be expressed in p53 mutant, such as TAHRE (Wylie, 2016). In addition, do the authors detect DSBs in region 1 in p53A-B+? Reviewer #3: In this manuscript, Chakravarti and colleagues analyzed the functions of several p53 isoforms in the Drosophila germline. They created novel isoform-specific alleles by CRISPR/Cas9 to untangle the functions of p53A and p53B isoforms. They made use of a Phid-GFP reporter line to follow p53 transcriptional activity. The role of p53 in the development of Drosophila germline has been published several times before with a focus on the silencing of retro-transposons (TEs) and meiotic DNA breaks response (Lu, 2010; Wylie, 2014; Wylie, 2016). Despite this published literature, the authors created novel and very valuable tools, which allowed them to make several novel and interesting observations. My main criticism is that most of these observations remain unexplained and the manuscript feels descriptive as it stands. However, this manuscript has great potential if it could follow up some of these novel observations. Some examples are the following: 1) On Figure 5C, the authors made the interesting observation that hid-GFP was stronger in region 1 of p53A-B+ than in the wild type p53A+B+. This activity of p53 cannot be explained by meiotic DSBs as previously published, since meiotic DSBs only occur later in region 2. This observation remains unexplained and is not explored further. One possibility is that it could relate to transposable elements (TEs) activity in this region. TEs can create DSBs (thus non-meiotic) and p53 has been published to silence TEs in Drosophila (Wylie, 2014; Wylie, 2016). It is also particularly interesting that the silencing of TEs is known to be weakened in this specific region of the germarium even in wild type condition (Dufourt J, NAR, 2013; Theron E, NAR, 2018). Could p53A play a role in silencing TEs in this region when Piwi is downregulated? This would bring novel insights on when and where TEs are silenced in germ cells. A transcriptomic analysis of p53A-B+ germ cells could show whether TEs are upregulated in this hid-GFP++ cells. It is probably out of the scope of this manuscript. Another possibility would be to perform FISH for TEs known to be expressed in p53 mutant, such as TAHRE (Wylie, 2016). In addition, do the authors detect DSBs in region 1 in p53A-B+? We addressed whether higher transposon activity and resultant DNA breaks could be the reason that the p53A mutant has higher hid-GFP in region 1 of the germarium. However, we did not observe an increase in g-H2Av labeling in stem cells, cystoblasts and region 1 cyst cells. This result is inconsistent with the transposon model. In contrast, the increased hid-GFP expression in the p53A mutant is consistent with our previous observations that p53A and p53B protein isoforms can form heterotetramers, and that p53B isoform is a stronger transcription factor (Zhang et al. 2015). Together with similar evidence from humans, this leads us to suggest that p53B homotetramers in the p53A isoform mutant induce a higher basal activity of the hid-GFP reporter. It should be stressed, however, that although the hid-GFP expression without IR in the p53A isoform mutant is higher than in p53 wild type, it is much lower than that seen after IR of wild type (see Figure 4), and is not associated with cell death. Although the elevated hid-GFP in p53A mutants is an intriguing observation, we believe that not knowing its precise mechanism does not alter the major conclusions of the present study - (1) That p53A is necessary and sufficient for apoptosis and (2) That p53A and p53B are required for repair of meiotic breaks and (3) That p53A is required participates in the pachytene checkpoint. We have edited the results and discussion in an effort to clarify these points and acknowledge that we have not provided evidence for the mechanism of the elevated hid-GFP in the p53A mutants (pg 7, para 2; pg 12, para 1 and 2). (2) On Figure 7 and 8, the authors analyzed the role of p53 in "persistent" meiotic DSBs. I am not convinced that these DSBs are only persistent meiotic DSBs. As discussed by the authors themselves (page 13), the origin of these DSBs could be TEs mobilization. I think it is a very important caveat for their conclusions. Another non-exclusive possibility for DSBs appearing in endoreplicating nurse cells is incomplete replication and associated DNA deletions during repair as shown in (Yarosh and Spradling, GD, 2014). To distinguish between these possibilities and strengthen their conclusions, the authors should perform the same experiments in the absence of meiotic DSBs, such as in a meiW68 mutant background (meiW68, p53AB double mutant). meiW68, okra, p53 mutants may be hard to generate but shRNAs against meiW68 are publicly available and effective, while they may also exist for okra or other spindle genes, and could make this combination easier to generate. New Figure 4-supplemental figure 1 shows that the low level hid-GFP expression we see in region 2 of the germarium is abolished in a mei-W68 (Spo11) mutant, and, therefore, that hid-GFP is a reporter for meiotic DNA breaks. New Figure 6-Supplementary file 3 shows that the persistent g-H2Av repair foci that we observe in p53 mutants is abolished in mei-W68; p53 double mutants, demonstrating that Drosophila p53 isoforms are required for the timely repair of programmed meiotic DNA breaks. Yarosh and Spradling showed that under-replicated heterochromatic DNA in endocycling cells is associated with DNA breaks and CNVs, likely because of replication fork collapse in these difficult to replicate regions. We were among the first labs to show that under-replicated heterochromatic DNA in polyploid cells results in DNA damage, evident as g-H2Av foci adjacent to the “DAPI bright” heterochromatic chromocenter (Mehrotra 2008). With a close inspection of the wild type panels of Figure 6 and 7, you can see these small foci of heterochromatic g-H2AV labeling in wild type. In contrast to wild type, however, the p53 mutants have many more g-H2Av foci that are spread throughout the nucleus. These pan-nuclear repair foci are not seen in mei-W68; p53 double mutants supporting that they are unrepaired meiotic breaks and not collapsed replication forks in difficult to replicate regions. Consistent with this, the oocyte has the most meiotic breaks and most persistent g-H2Av foci, but does not have the extreme under-replication of endocycling nurse cells. 3) The authors showed that p53A and p53B levels are developmentally regulated (Figure 6G): does overexpression of one or both of the isoforms have any phenotype? We cited our previous studies (Zhang et al. 2014 and 2015) in which we showed that over-expression of UAS-p53A and UAS-p53B both induce apoptosis in the soma, including follicle cells, with p53B being the more potent inducer. We also cited Park 2019 who showed that over-expression of either isoform induced cell death in the germline. 4) I agree with the authors that karyosome defects are part of an array of phenotypes induced by the activation of DNA damage checkpoints. However, I would not equal it to the activation of a pachytene checkpoint and conclude that p53 is part of that checkpoint. The activation of a pachytene checkpoint in response to unrepaired DNA breaks, including in okra mutants, was previously established by work from the Schupbach lab (Ghabrial et al. 1999). Subsequent work from that and other labs have used oocyte nuclear morphology as a read out for pachytene checkpoint activation in response to unrepaired breaks or defects in meiotic chromosome organization. Based on this precedence, therefore, we believe that the suppression of the okr nuclear phenotype by p53A and p53 null mutants is evidence that at least the p53A isoform is required for the pachytene checkpoint, analogous to the role of p53 and p63 in the pachytene checkpoint in humans and other mammals. 5) On Figure 7D, in p53A+B-, there seems to be a lot of DNA damages in follicular cells. Is this reproducible? That labeling is not reproducible and that image has been replaced by a more representative one.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Drosophila melanogaster)w67c23Bloomington Drosophila Stock CenterFBal0095147
Gene (Drosophila melanogaster)w1118Bloomington Drosophila Stock CenterFBal0018186RRID:BDSC_6598
Gene (Drosophila melanogaster)p53 (p535A1-4)Bloomington Drosophila Stock CenterFLYB:FBgn0039044; RRID:BDSC_6815FBal0138188
Gene (Drosophila melanogaster)p53 (p53A2.3) Robin et al., 2019 FLYB:FBgn0039044See Materials and Methods, Section 2
Gene (Drosophila melanogaster)p53 (p53B41.5)this studyFLYB:FBgn0039044See Materials and Methods, Section 2
Gene (Drosophila melanogaster)okra (okraAA) Ghabrial et al., 1998 FLYB:FBgn0002989Obtained from T. Schupbach
Gene (Drosophila melanogaster)okra (okraRU)Bloomington Drosophila Stock CenterFLYB:FBgn0002989; RRID:BDSC_5098FBal0013236;Obtained from T. Schupbach
Gene (Drosophila melanogaster)mei-W68 (Df(2 R)BSC782)Bloomington Drosophila Stock CenterFLYB:FBgn0002716; RRID:BDSC_27354
Gene (Drosophila melanogaster)mei-W68 (mei-W681)Bloomington Drosophila Stock CenterFLYB:FBgn0002716; RRID:BDSC_4932FBal0012191
Genetic reagent (Drosophila melanogaster)hid-GFP Tanaka-Matakatsu et al., 2009 FLYB:FBgn0003997; RRID:BDSC_50751Obtained from W. Du
Genetic reagent (Drosophila melanogaster)GFP-p53A Zhang et al., 2015 FLYB:FBtp0111619
Genetic reagent (Drosophila melanogaster)mCh-p53B Zhang et al., 2015 FLYB:FBtp0098077
Sequence-based reagentp53 gRNAThis study5’:CCTGGAGCACGGAAGATTCTTG; 3’:GATCCACAGGCGTAGCCAGGTGG
Sequence-based reagentprimer #501This studyPCR primerCCAACAAGATCGCTTGATCAGATA
Sequence-based reagentprimer #1,085This studyPCR primerGGCCATGGGTTCCGTGGTCA
Sequence-based reagentprimer #1,061This studyPCR primerGAGTCAGCAGTTCGGGTCTC
AntibodyAnti-GFP (Rabbit polyclonal)InvitrogenCat# A11122IF(1:500)
AntibodyAnti-dsRed (Rabbit polyclonal)ClontechCat# 632,496IF(1:200)
AntibodyAnti-dsRed (mouse polyclonal)ClontechCat# 632,392IF(1:200)
AntibodyAnti-Hts 1B1 (mouse monoclonal)Developmental Studies Hybridoma BankRRID:AB_528070IF(1:20)
AntibodyAnti-γH2Av (mouse monoclonal)Developmental Studies Hybridoma BankRRID:AB_2618077IF(1:1000)
AntibodyAnti-orb 4H8 (mouse monoclonal)Developmental Studies Hybridoma BankRRID:AB_528418IF(1:500)
AntibodyAnti-Vasa (rat monoclonal)Developmental Studies Hybridoma BankRRID:AB_10571464IF(1:100)
AntibodyAlexa Fluor 488 anti-mouse (polyclonal)InvitrogenCat# A11011IF(1:1000)
AntibodyAlexa Fluor 488 anti-rabbit (polyclonal)InvitrogenCat# A11008IF(1:1000)
AntibodyAlexa Fluor 568 anti-mouse (polyclonal)InvitrogenCat# A11004IF(1:1000)
AntibodyAlexa Fluor 568 anti-rabbit (polyclonal)InvitrogenCat# A10042IF(1:1000)
AntibodyAlexa Fluor 488 anti-mouse IgG1 (polyclonal)InvitrogenCat# A21121IF(1:1000)
AntibodyAlexa Fluor 568 anti-mouse IgG2b (polyclonal)InvitrogenCat# A21144IF(1:1000)
  95 in total

Review 1.  Phylogeny and function of the invertebrate p53 superfamily.

Authors:  Rachael Rutkowski; Kay Hofmann; Anton Gartner
Journal:  Cold Spring Harb Perspect Biol       Date:  2010-05-05       Impact factor: 10.005

2.  Nuclear bodies in the Drosophila germinal vesicle.

Authors:  Ji-Long Liu; Michael Buszczak; Joseph G Gall
Journal:  Chromosome Res       Date:  2006       Impact factor: 5.239

3.  Meiotic recombination provokes functional activation of the p53 regulatory network.

Authors:  Wan-Jin Lu; Joseph Chapo; Ignasi Roig; John M Abrams
Journal:  Science       Date:  2010-06-04       Impact factor: 47.728

4.  Electron microscopy of meiosis in Drosophila melanogaster females. I. Structure, arrangement, and temporal change of the synaptonemal complex in wild-type.

Authors:  A T Carpenter
Journal:  Chromosoma       Date:  1975       Impact factor: 4.316

5.  Compensatory proliferation in Drosophila imaginal discs requires Dronc-dependent p53 activity.

Authors:  Brent S Wells; Eri Yoshida; Laura A Johnston
Journal:  Curr Biol       Date:  2006-08-22       Impact factor: 10.834

6.  Regulation of p53 activity in nuclear bodies by a specific PML isoform.

Authors:  V Fogal; M Gostissa; P Sandy; P Zacchi; T Sternsdorf; K Jensen; P P Pandolfi; H Will; C Schneider; G Del Sal
Journal:  EMBO J       Date:  2000-11-15       Impact factor: 11.598

7.  Drosophila melanogaster MNK/Chk2 and p53 regulate multiple DNA repair and apoptotic pathways following DNA damage.

Authors:  Michael H Brodsky; Brian T Weinert; Garson Tsang; Yikang S Rong; Nadine M McGinnis; Kent G Golic; Donald C Rio; Gerald M Rubin
Journal:  Mol Cell Biol       Date:  2004-02       Impact factor: 4.272

8.  Pch2 links chromatin silencing to meiotic checkpoint control.

Authors:  P A San-Segundo; G S Roeder
Journal:  Cell       Date:  1999-04-30       Impact factor: 41.582

9.  p53 genes function to restrain mobile elements.

Authors:  Annika Wylie; Amanda E Jones; Alejandro D'Brot; Wan-Jin Lu; Paula Kurtz; John V Moran; Dinesh Rakheja; Kenneth S Chen; Robert E Hammer; Sarah A Comerford; James F Amatruda; John M Abrams
Journal:  Genes Dev       Date:  2015-12-23       Impact factor: 11.361

Review 10.  FlyBase 2.0: the next generation.

Authors:  Jim Thurmond; Joshua L Goodman; Victor B Strelets; Helen Attrill; L Sian Gramates; Steven J Marygold; Beverley B Matthews; Gillian Millburn; Giulia Antonazzo; Vitor Trovisco; Thomas C Kaufman; Brian R Calvi
Journal:  Nucleic Acids Res       Date:  2019-01-08       Impact factor: 16.971

View more
  2 in total

1.  Distinct p53 isoforms code for opposing transcriptional outcomes.

Authors:  Annika Wylie; Amanda E Jones; Simanti Das; Wan-Jin Lu; John M Abrams
Journal:  Dev Cell       Date:  2022-07-11       Impact factor: 13.417

Review 2.  Structural diversity of p63 and p73 isoforms.

Authors:  Christian Osterburg; Volker Dötsch
Journal:  Cell Death Differ       Date:  2022-03-21       Impact factor: 12.067

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.