Evaluating CagA and VacA Oncoproteins of Helicobacter pylori in Oral Potentially Malignant Disorders.

Oral Potentially Malignant Disorders such as leukoplakia, lichenplanus, Oral Submucous Fibrosis are most commonly encountered precancerous lesions in India. Although, usage of smoking tobacco has been decreased yet incidence of oral cancer seems to be in increasing trend. Apart from tobacco many non-tobacco causes are associated with the disease. Helicobacter pylori is a curved, flagellated bacterium that has been declared as group I carcinogen by WHO. They are proven causative agent for gastric carcinoma. They have been shown to harbour oral cavity by many authours. They produce onco-protein that causes DNA damage. CagA and VacA are such proteins that modulate certain oncogenes and tumour suppressor genes. In this study we have identified the organism from sub gingival plaque by PCR and those who harboured the organism were further subjected for identification of oncoproteins CagA and VacA by ELISA. This study shows that presence of organism in Oral leucoplakia, oral lichenplanus and Oral Submucous Fibrosis are statistically significant in comparison to control group (p>0.05). The presence of oncoproteins was also statistically significant in comparison to control group. These proteins are shown to accelerate inflammatory pathway thereby hasten the process of tumorigenesis. H.pylori infection as well the virulent strains can be diagnosed from oral cavity in the most non-invasive way at the earliest. Copyright:

INTRODUCTION

Helicobacter pylori (H. pylori) is a microaerophilic, flagellated, Gram-negative bacterium, commonly found in the gastrointestinal tract of about half the human population in the world. It persists in the host for life and produces infectious effects when favorable factors are present. They seem to infect an individual from childhood. The bacteria have about 6–8 unipolar sheathed flagella with which it moves and attaches itself in the gastric mucosa.[1] The transmission of the infection is mainly by oral–oral route and fecal–oral route. Consumption of infected food and water is sources of infection.[2] Most infected patients remain asymptomatic, while some patients develop chronic gastritis, peptic ulcer, and adenocarcinoma. H. pylori infection varies in children and adults. Children usually develop nodular gastritis while adults develop atrophic gastritis and intestinal metaplasia.[3] H. pylori was the 1st WHO authorized bacterial species known to cause cancer and has been categorized as Group I carcinogen by the International Agency for Research on Cancer. H. pylori-associated gastric adenocarcinoma is one of the three causes of cancer-related death accounting about 5.5% worldwide.[4] The pathogenesis is partly dependent on colonization and virulence factors of the bacteria. External factors such as age, geographic area, and socioeconomic status also determine the pathogenicity. Individuals from crowded environment with low socioeconomic status and poor hygiene are more susceptible.[3] Virulence factors such as cytotoxin-associated antigen A (CagA), vacuolating cytotoxin (VacA), duodenal ulcer promoting gene A protein (DupA), outer inflammatory protein (OipA), and gamma–glutamate transaminase increase the potential pathogenicity of the bacteria. CagA modifies the morphology of epithelial cells. VacA is the determinant protein for the pathogenicity of H. pylori. DupA helps in making the bacteria resistant to acid. OipA involves in adhesion of the bacteria to the gastric tract.[2] Patients treated for H. pylori are reported for recurrence, thereby, oral cavity was thought to be the residence of this organism. They tend to flourish in areas such as subgingival plaque and root canal where a favorable environment can be achieved. Oral premalignancy (OPMD) is of more importance, as their early diagnosis may improve the decree of life. Commonly diagnosed lesions include leukoplakia, lichen planus, and oral submucous fibrosis. In our study, we have identified H. pylori in saliva and its virulent proteins CagA and VacA in subgingival plaque of participants with oral potentially malignant disorders by real-time reverse transcription-polymerase chain reaction (PCR) and ELISA, respectively.

Aims and objectives

The present study was aimed to identify the H. pylori and its virulent status in oral cavity. We have investigated the relation between oral potentially malignant disorders, oral hygiene, and socioeconomic status with H. pylori infection.

MATERIALS AND METHODOLOGY

Our study included four groups, Group I – 30 participants with oral leukoplakia, Group II – 30 participants with oral lichen planus, Group III – 30 participants with oral submucous fibrosis, and Group IV – 30 control participants. Participants with comorbidities such as diabetes, hypertension, and usage of antibiotics within 3-month period were excluded in all the groups. Group IV included participants without smoking habits and dyspepsia. A detailed case history was obtained from all the patients. The study was explained, and informed consent was obtained from all the participants. Paired subgingival plaque[5] sample was collected from all the patients. Subgingival plaque sample was collected in Eppendorf with 0.5 ml of 1X phosphate-buffered saline and was stored in −80°C. The samples were centrifuged, and pellets obtained were again suspended in 500 μl of sterile water. Before isolation of DNA, the samples were preserved for ELISA. Kit method was used for isolation of DNA, and to the isolated DNA samples master mix, forward and reverse primer, template DNA, and sterile water were added and PCR was done. The PCR primers used in this study include 16srRNA gene F: CAGCTTGTTGGTAAGGTAATGGC; R: GATCTCTACGGATTTTACCCCTACAC[6] with the bp as 439, denaturation temperature step as 95°c, annealing 63°c, and extension 72°c. 35 cycles were run. The samples which showed positivity for H. pylori were tested for the presence of oncoprotein CagA and VacA by ELISA using KIT method. Positive control and negative control were used in both the molecular techniques.

Statistical analysis

The results obtained were analyzed using IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp. The values were analyzed, and the mean and standard deviation were calculated. Chi-square test and Fisher's exact test were done to estimate the significance. Probability P < 0.05 was considered as significant association.

RESULTS

A total of 120 participants were included in this study in four groups. Each group had gender and age-matched participants. Groups I, II, and III were considered as disease group which in total includes 90 participants and Group IV is control group which in total includes 30 participants. An overall prevalence of 70% was observed in disease group [Table 1]. Moreover, on comparing identification of H. pylori in diseased groups with control group, P < 0.05 was obtained. ELISA was used to evaluate the virulent organisms that induce pro-inflammatory cytokines. CagA and VacA oncoproteins were found in 67% of the H. pylori participants. According to the statistical analysis, a significant association is present between the protein and disease condition [Tables 2 and 3]. Poor oral hygiene, increased incidence of periodontal disease, smoking, and low socioeconomic status were also observed in H. pylori-positive patients [Table 4].

Table 1

Number of participants showing the presence of Helicobacter pylori in each group

Participants	Presence of Helicobacter Pylori (n=30)	Percentage of presence of organism in each group
Group I	20	66.6
Group II	19	63.3
Group III	25	83
Group IV	2	6

The above result depicts the presence of Helicobacter pylori in diseased and control group and has been expressed in percentage

Table 2

Estimation of cytotoxin-associated antigen A and vacuolating cytotoxin A protein

Group	Presence of Helicobacter pylori (n=120)	Presence of CagA in positive individuals (n=66)	Presence of VacA in positive individuals (n=66)	Presence of both (CagA and VacA) in positive individuals (n=66)
Group I	20	15	18	13
Group II	19	15	19	9
Group III	25	23	25	21
Group IV	2	0	0	0

CagA: Cytotoxin-associated antigen A, VacA: Vacuolating cytotoxin

Table 3

Statistical analysis of association between the presence of oncoprotein in diseased and control group

	Value	df	Asymptotic significance (two-sided)	Exact significance (two-sided)	Exact significance (one-sided)
Pearson χ2	38.769a	1	0.000
Continuity correctionb	36.347	1	0.000
Likelihood ratio	52.498	1	0.000
Fisher’s exact test				0.000	0.000
Linear-by-linear association	38.446	1	0.000
Number of valid cases	120

b p <0.001

Table 4

Aggregation of data associated with Helicobacter pylori-positive participants

Serial number	Helicobacter pylori	Males	Females	Socioeconomic status (low)	Habits +	Dyspepsia
Group I	20	18	2	17	20	12
Group II	19	4	15	11	-	13
Group III	25	20	5	22	25	19
Group IV	2	2	-	-	-	2

+ Indicates patients with tobacco habit.

DISCUSSION

Oral cancer a multifactorial disease involves numerous biological processes working in a pathological way. Of which pro-inflammatory cytokines play a major role in progression of the disease.[7] Infection results in inflammation and infection with H. pylori results in accumulation of interleukin (IL)-1, IL-8, IL-10, IL-17, tumor necrosis factor-α.[8] Sequential accumulation of cytokines results in cytokine storm. These cytokines can result in oxidative damage which may result in aberrant behavior of cellular processes such as proliferation and apoptosis.[9]

This study was aimed to identify H. pylori in oral cavity of participants with potentially malignant disorders using PCR and to estimate the presence of virulent proteins (CagA and VacA) in positive patients by ELISA.

For about a decade, there seems to be increasing trend in associating microorganisms with oral cancer. Number of organism such as human papilloma virus, Epstein–Barr Virus, and Porphyromonas gingivalis has been studied a lot in association with cancers.[10]

Dental plaque has been used as the sample in number of studies since it can render a perfect environment for the microorganism to grow. Several studies done on H. pylori show that plaque acts as a nidus for this organism to grow. There are many methods to detect H. pylori culture, urease test, IHC, PCR, and ELISA. Since PCR is the most sensitive technique, we have adopted it and protein analysis can be best explored by ELISA.[11]

Many studies have been conducted to associate H. pylori and OPMDs. In our study, we found that about 70% of the total samples were positive for H. pylori of which about 67% of the positive H. pylori samples had both the oncoproteins. These positive participants were also associated with poor oral hygiene and inflammatory disease such as periodontitis and gingivitis with periodontal pockets and dyspepsia. Studies by few authors suggest that there is no strong association between H. pylori and periodontitis or gingivitis. This might be due to selection of sample, storage, or technique adapted.[12]

The oncogenic potential of CagA has been explained at molecular level in number of studies. CagA not only act as adhesin once they enter the cell by type IV secretion system,[8] they interact with β-catenin and modulates E-cadherin, and they also promote oncogenic potential of p53. Apart from these mutational effects, they induce number of cytokines resulting in activation of NF-κB pathway inducing cell proliferation and inhibiting apoptosis.[13] In this study, we found that about 80% of the individuals with the infection had CagA protein and 96% had VacA protein. Authors who identified CagA and VacA gene also showed similar results.

Many studies have been done to correlate OPMDs and H. pylori; study by Kazanowska-Dygdała et al. suggested that there could be a possible relationship between H. pylori and oral leukoplakia and lichen planus, their results show that no organism was identified in healthy controls whereas they identified organism in diseased group by PCR in supra and subgingival plaque.[14]

Study done by Rajendran et al. and Sharma et al. relating the infection and oral submucous fibrosis concluded that the organism plays an evident role in diseased status and they pose important clinical implication.[1516]

Study by Attia et al., Pourshahidi et al., and Hulimavu et al. related the infection and oral lichen planus. They used PCR, ELISA, and IHC, respectively. The results were contradictory Hulimavu concluded by questioning the role of H. pylori in pathogenesis of oral lichen planus. The other two cross-sectional study posed a possible association of H. pylori in lichen planus.[171819] Each study had different approach, different technique, apart from their association with premalignant condition most of the studies inferred significant association with poor oral hygiene and periodontal health.[20]

In our study, we apart from association with the premalignant disorders, the influence of the oncoproteins secreted by the microorganism in inducing cytokines causing cytokine storm resulting in aberrant induction of inflammatory pathways such as NF-κB,[21] thereby, causing mutation or may cause sequential genetic hits. This may fasten the process of progression of premalignant lesions to malignancy. Thereby, the presence of H. pylori in oral cavity cannot be underestimated.

CONCLUSION

On conclusion, H. pylori in oral cavity could be a potent inducer of inflammation apart from directly associated with premalignant and malignant lesions of oral cavity; it could act as an adjuvant in progression of the disease. In future, a case–control study with evaluation of inflammatory signaling molecules and pathway will help us to decipher the role of H. pylori in inducing inflammation. Thereby, their role as a causative agent in oral carcinogenesis can be studied in detail.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.