Ping Zhang1, Fang Zhao1, Ke Jia1, Xiaoli Liu1. 1. Department of Gynaecology, The Frist People's Hospital of Zhangjiagang Affiliated to Suzhou University, Zhangjiagang, China.
Abstract
As the fourth commonest malignancy among females worldwide, cervical cancer (CC) poses a huge challenge to human health. The pivotal regulatory roles of lncRNAs in cancers have been highlighted. LOXL1 antisense RNA 1 (LOXL1-AS1) has been reported to play a key role in cervical squamous cell carcinoma and other various cancers. Thus, we investigated the roles and mechanisms of lncRNA LOXL1-AS1 in CC. The in vivo experiments demonstrated that LOXL1-AS1 downregulation inhibited tumor growth and metastasis and proliferation of CC cells. The results of RT-qPCR demonstrated that LOXL1-AS1 and ectodermal-neural cortex 1 (ENC1) expression levels were upregulated in CC cells and tissues, while microRNA-423-5p (miR-423-5p) level was downregulated. As subcellular fractionation assays, RNA pull down assays and luciferase reporter assays revealed, LOXL1-AS1 bound to miR-423-5p and miR-423-5p targeted ENC1. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays, wound healing and colony formation assays demonstrated that miR-423-5p upregulation and LOXL1-AS1 downregulation inhibited CC cell proliferation and migration, while ENC1 upregulation attenuated the inhibitory effects of miR-423-5p upregulation on the malignant phenotypes of CC cells. Western blotting was conducted to measure protein levels and the results showed that ENC1 knockdown inhibited the activation of ERK/MEK pathway. In summary, the LOXL1-AS1/miR-423-5p/ENC1 axis accelerates CC development through the MEK/ERK pathway.
As the fourth commonest malignancy among females worldwide, cervical cancer (CC) poses a huge challenge to human health. The pivotal regulatory roles of lncRNAs in cancers have been highlighted. LOXL1 antisense RNA 1 (LOXL1-AS1) has been reported to play a key role in cervical squamous cell carcinoma and other various cancers. Thus, we investigated the roles and mechanisms of lncRNA LOXL1-AS1 in CC. The in vivo experiments demonstrated that LOXL1-AS1 downregulation inhibited tumor growth and metastasis and proliferation of CC cells. The results of RT-qPCR demonstrated that LOXL1-AS1 and ectodermal-neural cortex 1 (ENC1) expression levels were upregulated in CC cells and tissues, while microRNA-423-5p (miR-423-5p) level was downregulated. As subcellular fractionation assays, RNA pull down assays and luciferase reporter assays revealed, LOXL1-AS1 bound to miR-423-5p and miR-423-5p targeted ENC1. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays, wound healing and colony formation assays demonstrated that miR-423-5p upregulation and LOXL1-AS1 downregulation inhibited CC cell proliferation and migration, while ENC1 upregulation attenuated the inhibitory effects of miR-423-5p upregulation on the malignant phenotypes of CC cells. Western blotting was conducted to measure protein levels and the results showed that ENC1 knockdown inhibited the activation of ERK/MEK pathway. In summary, the LOXL1-AS1/miR-423-5p/ENC1 axis accelerates CC development through the MEK/ERK pathway.
Cervical cancer (CC) is the fourth leading cause of cancer death among women worldwide [1]. As estimated, there are approximately 570,000 new CC cases and 310,000 female deaths from CC globally [2]. Persistent human papilloma virus (HPV) infection is causative for over 91% of CC cases [3]. High-risk HPV genotypes arise from sexual transmission, lifestyle, and environmental conditions [4]. Currently, radical hysterectomy or definitive chemoradiation depending on the clinical stage of the cancer is widely accepted for CC treatment [5]. Systemic cisplatin-based chemotherapy is concurrently administrated with radiation, which has been shown to improve local control as well as overall survival outcomes compared to radiation alone in randomized controlled clinical trials [6]. However, there are no established guidelines for clinical HPV testing of primary cervix tumors, yet [7]. A previous study has demonstrated that 7–11% of cervical tumors do not have detectable HPV DNA or RNA, hereafter referred to as HPV undetectable (HPVU) tumors [8]. HPVU is an indicator for poor overall survival and the overall failure rates for standard of care chemoradiation are up to 67% for patients with HPVU tumors [9]. Therapeutic options are still limited for patients with advanced or recurrent CC [10]. Therefore, a further understanding of the underlying mechanisms of CC pathology is significant to improve its diagnosis, prevention, and treatment.There are increasing studies focusing on revealing the underlying mechanisms of CC [11,12]. In addition to the canonical tumor suppressors and oncogenes implicated in CC, many non-coding RNAs with dysregulated expression in CC have been identified via high throughput transcriptomic sequencings [13]. Long noncoding RNAs (lncRNAs) are possessed of over 200 nucleotides, and they do not encode protein [14]. Previous studies reported that lncRNAs play a critical role in CC progression. For example, lncRNA PITPNA antisense RNA 1 (PITPNA-AS1) promotes cell proliferation and inhibits cell apoptosis in CC [15]. LncRNA plasmacytoma variant translocation 1 (PVT1) accelerates the growth of CC cells by advancing the cell cycle and inhibiting cell apoptosis [16]. LncRNA KCNQ1 opposite strand/antisense transcript 1 (KCNQ10T1) facilitates CC progression and tumor growth [17]. Previous research demonstrated that lncRNA LOXL1-antisense RNA 1 (LOXL1-AS1) is a pro-cancer regulator in various cancers. LOXL1-AS1 increases medulloblastoma metastasis by regulating the PI3K/AKT signaling pathway [18]. LOXL1-AS1 accelerates gastric cancer through the miR-142-5p/phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) axis [19]. Additionally, LOXL1-AS1 was reported to play a key role in cervical squamous cell carcinoma [20]. However, its biological functions and underlying mechanisms in CC tumorigenesis and progression remain unclear.MicroRNAs (miRNAs) are small noncoding RNAs, which are possessed of 18–22 bases in length and can target the specific mRNAs to degrade their translation [21,22]. As reported, miRNAs serve as critical regulators in CC initiation and progression. For example, miR-587 promotes CC by repressing interferon regulatory factor 6 [23]. MiR-96 facilitates the proliferation of CC cells by targeting forkhead box O1 (FOXO1) [24]. As tumor suppressors, miR-362 suppresses CC progression by targeting B-cell receptor-associated protein 31 (BAP31) and activating transforming growth factor β (TGFβ)/mothers against dpp (Smad) pathway [25]. MiR-216a-3p suppresses the proliferation and invasion of CC cells by targeting Actin-Like Protein 6A (ACTL6A) and inactivating Yes-associated protein (YAP) signaling pathway [26].Ectodermal-neural cortex 1 (ENC1) is an actin-binding protein expressed primarily in nerve cells. A various study discovers that ENC1 downregulation significantly recues the phosphorylation levels of 3 mitogen-activated protein kinases (MAPK), extracellular signal-regulated kinase (ERK) and p38 [27].Here, we aimed to investigate the biological role and mechanisms of LOXL1-AS1 in CC progression in vitro and in vivo. We hypothesized that LOXL1-AS1 promotes cellular phenotypes in CC and facilitates CC progression. We believe that our study would offer a promising target for CC treatment.
Materials and Methods
Tissue samples
A total of 40 pairs of CC tissue samples and normal tissues were acquired from CC patients with informed consents at The Frist People’s Hospital of Zhangjiagang Affiliated to Suzhou University (Jiangsu, China). The collected samples were promptly frozen in liquid nitrogen. Neither radiotherapy nor chemotherapy was performed on patients. No patients had infectious diseases or treatment history aimed at CC. This research was approved by Ethics Committee of The Frist People’s Hospital of Zhangjiagang Affiliated to Suzhou University (Jiangsu, China). The clinical features of CC patients are shown in Table 1.
Table 1.
Correlation between LOXL1-AS1/miR-423-5p/ENC1 expression and the clinicopathological characteristics of cervical cancer patients
Correlation between LOXL1-AS1 expression and the clinicopathological characteristics of cervical cancer patients
Characteristics
Cases
LINC00662 expression
P value
High n = 20
Low n = 20
Age
≤45
21
11
10
0.752
>45
19
9
10
Tumor size (cm)
<4.0
20
9
11
0.527
≥4.0
20
11
9
TNM stage
I–II
21
6
15
0.004
III–IV
19
14
5
Distant metastasis
No
17
5
12
0.025
Yes
23
15
8
Lymph node metastasis
No
21
6
15
0.004
Yes
19
14
5
Histological grade
Well
20
9
11
0.527
Moderately/Poorly
20
11
9
Correlation between miR-423-5p expression and the clinicopathological characteristics of cervical cancer patients
Characteristics
Cases
miR-423-5p expression
P value
High n = 20
Low n = 20
Age
≤45
21
10
11
0.752
>45
19
10
9
Tumor size (cm)
<4.0
20
11
9
0.527
≥4.0
20
9
11
TNM stage
I–II
21
14
7
0.027
III–IV
19
6
13
Distant metastasis
No
17
12
5
0.025
Yes
23
8
15
Lymph node metastasis
No
21
14
7
0.027
Yes
19
6
13
Histological grade
Well
20
11
9
0.527
Moderately/Poorly
20
9
11
Correlation between ENC1 expression and the clinicopathological characteristics of cervical cancer patients
Characteristics
Cases
ENC1 expression
P value
High n = 20
Low n = 20
Age
≤45
21
11
10
0.752
>45
19
9
10
Tumor size (cm)
<4.0
20
9
11
0.527
≥4.0
20
11
9
TNM stage
I–II
21
7
14
0.027
III–IV
19
13
6
Distant metastasis
No
17
5
12
0.025
Yes
23
15
8
Lymph node metastasis
No
21
7
14
0.027
Yes
19
13
6
Histological grade
Well
20
9
11
0.527
Moderately/Poorly
20
11
9
P < 0.05 is considered statistically significant. (Chi-squared test or Fisher’s exact test).
Correlation between LOXL1-AS1/miR-423-5p/ENC1 expression and the clinicopathological characteristics of cervical cancer patientsP < 0.05 is considered statistically significant. (Chi-squared test or Fisher’s exact test).
Follow up
We follow up the patients via phone or return visit continued until December 2020 with the overall survival rate of these patients. The 36 cases had follow-up of duration 60 months, with 4 cases lost to follow up.
Cell culture
Normal human cervical epithelial cells (H8), human embryonic kidney cells HEK293, and CC cell lines (HeLa, SiHa, CaSki, and ME-180) were offered by ATCC (USA) and conducted to cell-line authentication using Short Tandem Repeat (STR) profiling by GeneChem (Shanghai, China), which were incubated in DMEM supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin (Lonza, Verviers, Belgium). And then the cells were incubated at 37°C with 5% CO2 in a humidified condition.
Cell transfection
Cell transfection was conducted in accordance with previous method [28]. For cell transfection, HeLa, SiHa, CaSki, Me-180 and HEK293 cells were seeded into 6-well plates (2 × 105 cells/well) and cultured for 24 h. After the cells reached 70–80% confluence, transfection was conducted. Short hairpin RNA (shRNA) targeting LOXL1-AS1 or ENC1 was utilized to silence LOXL1-AS1 or ENC1, respectively. For upregulating ENC1, full length of ENC1 was cloned into the pcDNA3.1 vector. MiR-423-5p was upregulated using MiR-423-5p mimics, and miR-423-5p inhibitor was used to knockdown miR-423-5p. Transfection was done using Lipofectamine 3000 (Invitrogen, USA) for 48 h. The transfection efficacy was determined by RT-qPCR analysis. All plasmids were synthesized by GenePharma (Shanghai, China).
Transfection efficiency detection
The transfection efficiency detection was performed as previously described [29]. The transfected cells were collected and digested with 0.25% trypsin and then resuspended in phosphate-buffered saline (PBS). Cells were prepared into a single-cell suspension and centrifuged at a speed of 800 rpm for 5 min. After the supernatant was removed, cells were washed with PBS. Then, cells (1 × 104 cells/ml) were subjected to transfection efficiency detection by a FACScan flow cytometer (Becton–Dickinson, Franklin Lakes, USA). The experiment was repeated three times.
TRIzol reagent (Takara, Japan) was utilized to extract total RNAs. And total RNAs were then reverse transcribed into cDNA using PrimeScript RT Master Mix (Takara, Tokyo, Japan) according to the manufacturer’s instructions. With ABI7500 Real-time PCR system (Applied Biosystems, USA), RT-qPCR was performed using SYBR-Green Real-Time PCR Kit (Takara). U6 and GAPDH acted as the internal references. Relative quantification was analyzed adopting the 2−∆∆Ct method [30]. The experiments were performed three times. The primer sequences used in this study were listed in Table 2. Thermal cycling was 2 min at 50°C, 10 min at 95°C, followed by 40 cycles of amplification of 1 s at 95°C (denaturation), 60 s at 65°C (blocker annealing), and 35 s at 55°C (primer annealing and extension, fluorescence acquisition). The experiment was repeated three times.
Table 2.
Sequences of primers used for reverse transcription-quantitative PCR
Gene
Sequence (5ʹ→3ʹ)
LOXL1-AS1 forward
CTTGTCTCCCTCAGGACTG
LOXL1-AS1 reverse
AATCCTGTCTCACCTTCCC
miR-423-5p forward
CGAAGTTCCCTTTGTCATCCT
miR-423-5p reverse
GTGCAGGGTCCGAGGTATTC
ENC1 forward
CTGCATTTGTCAGCACCTG
ENC1 reverse
GATGGAGTGAGCTCATGCT
FAM129B forward
AAACAAAGCGGCCTATGAG
FAM129B reverse
TGAGCTCCAGGTATTGGTC
NDST1 forward
CAAAGTGATGGACATGGTGC
NDST1 reverse
TTTGGATCAAACGCCAAGG
U6 forward
CTCGCTTCGGCAGCACA
U6 reverse
AACGCTTCACGAATTTGCGT
GAPDH forward
TCAAGATCATCAGCAATGCC
GAPDH reverse
CGATACCAAAGTTGTCATGGA
Sequences of primers used for reverse transcription-quantitative PCR
Following the designed transfection, MTT assays were performed as previously described [31]. After cell confluence reached 80%, single cell suspension was obtained following two phosphate buffered saline (PBS; Thermo Fisher Scientific) washes. After washing, the cells were seeded in 96-well plates at 4 × 103 cells /well. Each group has six holes. Afterward, 10 μl MTT (5 mg/ml; Sigma-Aldrich, St-Louis, MO, USA) was supplemented to the plates at 24 h, 48 h and 72 h at 37°C. The cells were cultured for another 4 h and the supernatant was abandoned. Then each hole was added with 100 μl Dimethyl sulfoxide (DMSO; Sigma-Aldrich), and the plates were shaken gently for 10 min allowing for the dissolving of the formazan crystals produced by living cells. A microplate reader (Thermo Fisher Scientific) was used to measure the optical density at 490 nm. The experiment was repeated three times.
Colony formation assay
The experiment procedure was almost the same as a previous study [32]. After 48 h of transfection, the cells were plated in 6-well plates at approximately 1 × 103 cells per well and cultured for 7 days. Subsequently, the cells were washed with PBS, fixed in 10% formaldehyde for 10 min and stained with 0.1% crystal violet for 5 min. The plates were photographed after the colonies were formed. The experiment was repeated three times to ensure the reliability of the results.
Wound healing assay
The wound healing assay was conducted as previously described [33]. The transfected cells were seeded in 6-well plates at 1 × 104 cells/well at 37°C until they reached 95% confluence. Then a sterile 200 µl pipette tip was used to scratch the center of the plates and a wound was made. The floating cells were eliminated after PBS washing. The movement was recorded at 0, and 24 h and analyzed with Image-Pro Plus 6.0 software. The assay was repeated three times. Data were presented as wound width (at 24 h)/wound width (at 0 h) ×100% [34].
Western blotting
After transfection of 48 h, Western blotting was conducted to measure protein levels in CC cells as previously described [35]. The protein lysates from cells and tissues were extracted using RIPA lysis buffer (Sigma-Aldrich). The concentration of proteins was estimated using a BCA protein assay kit (Thermo Fisher Scientific). Proteins (40 μg) were then loaded onto the sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE) for electrophoresis and were transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore, Darmstadt, Germany). Subsequent to blocking in 5% milk, the membranes were washed and incubated at 4°C overnight with primary antibodies against ENC1 (ab124902, 1:1000), p38 (ab170099, 1:2000), p-p38 (ab178867, 1:1000), ERK1/2 (ab17942, 1:1000), p-ERK1/2 (ab278564, 1:1000), MEK1/2 (ab178876, 1:20,000), p-MEK1/2 (ab278723, 0.5 μg/ml), JNK (ab208035, 1:2000), p-JNK (ab124956, 1:1000) and GAPDH (ab8245, 1:2000). The membranes were then incubated with secondary antibody for 2 h. The protein signals were detected using an enhanced chemiluminescent Western blot kit (Beyotime, Shanghai, China). Western blotting bands were quantified by ImageJ software, and GAPDH was used as the loading control. The experiment was repeated three times.
Luciferase reporter assay
A luciferase reporter assay was performed according to the previous study [36]. The HeLa, SiHa, and HEK293 cells were incubated in 96-well plates at the density of 1 × 104 cells/well for 4 h. Wild type or mutant sequence of LOXL1-AS1 or ENC1 3ʹUTR including the miR-423-5p binding site was inserted into the pmirGLO Vector (YouBio, Hunan, China). Wild type or mutant LOXL1-AS1 or ENC1 3ʹUTR luciferase reporters were simultaneously transfected into HeLa, SiHa, and HEK293 cells with miR-423-5p mimics or miR-NC using Lipofectamine 3000. After 48 h, the cells per hole were washed with PBS for one time and lysed with 25 µl lysates. After 30 min of cell lysis at room temperature, 100 µl luciferase detection reagent (Promega, Madison, WZ, USA) was applied to measure the luminescence as per the manufacturer’s protocols. The renilla luciferase activity detection reagent was added to each hole and the value of each hole was measured by a multifunctional microplate reader. Luciferase activity = firefly luciferase activity/renilla luciferase activity. The experiment was repeated three times.
RNA immunoprecipitation (RIP) assay
RIP assays were carried out as previously described [37]. The Magna RIPTM RNA binding protein immunoprecipitation kit (Millipore) was used to perform RIP assay. SiHa and HeLa cells were transfected with miR-423-5p mimics or miR-NC for 48 h. Then the transfected SiHa and HeLa cells were collected and lysed. The lysate was then rotated in the RIP buffer containing magnetic beads with a negative control IgG or human anti-Ago2 antibody (Millipore). After 24 h, the immunoprecipitated RNA was incubated with proteinase K for 30 min and then extracted. Finally, RT-qPCR was conducted to verify the enrichment of miR-423-5p and LOXL1-AS1 in the immunoprecipitated RNA.
Immunofluorescence
Immunofluorescence was conducted to measure ENC1 level as described previously [38]. The cervical tissues were fixed with 4% paraformaldehyde, and ethanol was used to dehydrate the fixed tissues. Then the tissues were set in paraffin and cut into 4 μm. Subsequently, the tissues were incubated with the primary antibody against ENC1 (ab248050, 1:200; Abcam) overnight at 4°C. Then the tissues were incubated with the fluorescent secondary antibody at room temperature for 2 h. Finally, the DAPI was used to stain nucleus and the laser scanning confocal microscope (Olympus, Japan) was used to observe the green fluorescence. The experiment was performed three times.
Tumor xenograft
Animal experiments were performed as previously described [39]. Athymic BALB/c nude mice (female, 4-week-old) were obtained from Vital River Co. Ltd. (Beijing, China). All animals were kept in polypropylene cages in a room with controlled temperature (22°C±1), 60–70% humidity and a 12 h light/12 h dark cycle. Water and diet were freely available. Animal experiments were approved by the Animal Ethical Committee of The Frist People’s Hospital of Zhangjiagang Affiliated to Suzhou University (Jiangsu, China) and the study protocol was approved by the Institutional Animal Care and Use Committee. The mice were divided randomly into sh-LOXL1-AS group and sh-NC group and were subcutaneously inoculated with 4 × 105 HeLa cells in the right flank (n = 8 per group). Tumor volume was recorded every week with the formula: 0.5 × a × b2 (a, long axes; b, short axes). Tumors were removed and weighed on the 6th week after injection. For the measurement of Ki67, IHC analysis was conducted using primary antibody antti-Ki67 (ab16667, 1:200, Abcam) as previously described [40]. Weight loss > 20% and body temperature < 32°C were implemented as an endpoint for experimental animals. The mice were sacrificed by cervical dislocation, and the death was indicated by cessation of breathing, muscle relaxation and lack of nerve reflex. The experiment was repeated three times.
Statistical analysis
Data were analyzed with GraphPad Prism 6.0 software, which are exhibited as the mean ± standard deviation (SD). Differences between two groups were analyzed using Student’s t test. One-way analysis of variance was conducted to compare differences among multiple groups. p < 0.05 was statistically significant.
Results
CC is a common female malignancy. It is of great significance to explore the underlying mechanisms of CC tumorigenesis and progression and initiate effective CC treatment. In the present study, we conducted a series of in vitro and in vivo assays to investigate the biological functions and underlying mechanisms of LOXL1-AS1 in CC. In conclusion, above results indicate that LOXL1-AS1 is upregulated in CC tissues and cells and LOXL1-AS1 binds to miR-423-5p to reduce its regulation on ENC1, thereby promoting CC progression by activating the ERK/MEK pathway.
LOXL1-AS1 level is upregulated in CC tissues
To investigate the biological roles of LOXL1-AS1 in CC progression, we conducted RT-qPCR to measure its expression in CC tissues and CC cells, and the results showed that LOXL1-AS1 was upregulated in CC tissues compared with that in normal adjacent tissues (Figure 1(a)). In parallel, LOXL1-AS1 level was higher in CC cells than that in H8 cells. Compared with that in SiHa and HeLa cells, LOXL1-AS1 level in Caski and Me-180 cells was lower (Figure 1(b)). Thus, we chose SiHa and HeLa cells for our subsequent experiments. Kaplan-Meier analysis manifested that CC patients with high level of LOXL1-AS1 exhibited obviously poorer prognosis than those with low level of LOXL1-AS1 (Figure 1(c)). The results of immunofluorescence revealed that ENC1 was highly expressed in CC tissues compared with nontumor tissues (Figure 1(d)). These results demonstrate that LOXL1-AS1 and ENC1 levels are upregulated in CC tissues and cells.
Figure 1.
LOXL1-AS1 is overexpressed in CC. (a) RT-qPCR of LOXL1-AS1 expression in CC tissues and normal tissues. (b) RT-qPCR of LOXL1-AS1 expression in CC cells and H8 cells. (c) The overall survival of CC patients with high LOXL1-AS1 level and low LOXL1-AS1 level was analyzed by Kaplan-Meier analysis. (d) Immunofluorescence of ENC1 expression in CC tissues and nontumor tissues. ***P < 0.001.
LOXL1-AS1 is overexpressed in CC. (a) RT-qPCR of LOXL1-AS1 expression in CC tissues and normal tissues. (b) RT-qPCR of LOXL1-AS1 expression in CC cells and H8 cells. (c) The overall survival of CC patients with high LOXL1-AS1 level and low LOXL1-AS1 level was analyzed by Kaplan-Meier analysis. (d) Immunofluorescence of ENC1 expression in CC tissues and nontumor tissues. ***P < 0.001.
LOXL1-AS1 interacts with miR-423-5p
To explore the regulatory mechanisms associated with LOXL1-AS1 in CC, starBase v2.0 database was used to predict the possible miRNAs for LOXL1-AS1, and we found two candidate target genes (search category: CLIP Data: high stringency (≥3) + Pan-cancer: 4 cancer types): miR-423-5p and miR-589-5p. With the help of RNA pulldown assay, miR-432-5p was selected for following study because it was markedly enriched in the bio-LOXL1-AS1 group (Figure 2(a)). (Figure 2(b)) presents the predicted binding site of miR-432-5p on LOXL1-AS1. Then, LOXL1-AS1 was knocked down in CC cells by transfection of sh-LOXL1-AS1-1/2 (Figure 2(c)). Also, miR-423-5p was elevated in CC cells in response to LOXL1-AS1 downregulation (Figure 2(d)). The overexpression efficiency of miR-423-5p mimics was determined by RT-qPCR (Figure 2(e)). To verify that LOXL1-AS1 interacted with miR-423-5p through the binding sites, the potential binding sequences between LOXL1-AS1 3ʹUTR and miR-423-5p were mutated. Luciferase reporter assay was performed to verify the biding capacity of LOXL1-AS1 3ʹUTR for miR-423-5p in CC cells and HEK293 cells and the results demonstrated that the luciferase activity of LOXL1-AS1-Wt vector was remarkably declined by miR-432-5p compared to control group, while the LOXL1-AS1-Mut vector presented no change, suggesting the binding relationship between LOXL1-AS1 and miR-423-5p (Figure 2(f)). As RIP assays demonstrated, the amount of LOXL1-AS1 and miR-423-5p enriched by the Ago2 antibody was more than that of the IgG antibody group (Figure 2(g)). The results of RT-qPCR revealed that miR-432-5p was prominently downregulated in CC tissues (Figure 2(h)). Furthermore, LOXL1-AS1 negatively regulated miR-432-5p expression in CC samples (Figure 2(i)). These results demonstrate that LOXL1-AS1 interacts with miR-423-5p and negatively regulates its expression level.
Figure 2.
LOXL1-AS1 interacts with miR-423-5p. (a) RT-qPCR of the miR-423-5p level in the bio-LOXL1-AS1 group in CC cells. (b) The predicted binding site of LOXL1-AS1 on miR-423-5p. (c) The CC cells were transfected with sh-LOXL1-AS1-1/2 and RT-qPCR tested the transfection efficiency. (d) RT-qPCR of the miR-423-5p level in CC cells that were interfered with sh-LOXL1-AS1-1/2. (e) RT-qPCR of the transfection efficiency of miR-423-5p mimics in CC cells. (f) The binding ability between LOXL1-AS1 and miR-423-5p in CC cells and HEK293 cells was validated by luciferase reporter assay. (g) RIP experiment was conducted to determine the binding relationship between LOXL1-AS1 and miR-423-5p in SiHa and HeLa cells. (h) RT-qPCR of miR-423-5p expression in CC tissues. (i) Correlation between LOXL1-AS1 and miR-423-5p expression in CC tissues. ***P < 0.001.
LOXL1-AS1 interacts with miR-423-5p. (a) RT-qPCR of the miR-423-5p level in the bio-LOXL1-AS1 group in CC cells. (b) The predicted binding site of LOXL1-AS1 on miR-423-5p. (c) The CC cells were transfected with sh-LOXL1-AS1-1/2 and RT-qPCR tested the transfection efficiency. (d) RT-qPCR of the miR-423-5p level in CC cells that were interfered with sh-LOXL1-AS1-1/2. (e) RT-qPCR of the transfection efficiency of miR-423-5p mimics in CC cells. (f) The binding ability between LOXL1-AS1 and miR-423-5p in CC cells and HEK293 cells was validated by luciferase reporter assay. (g) RIP experiment was conducted to determine the binding relationship between LOXL1-AS1 and miR-423-5p in SiHa and HeLa cells. (h) RT-qPCR of miR-423-5p expression in CC tissues. (i) Correlation between LOXL1-AS1 and miR-423-5p expression in CC tissues. ***P < 0.001.
LOXL1-AS1 depletion or miR-423-5p overexpression suppresses CC cell growth
We further performed functional assays. The results of MTT and colony formation assays revealed that cell viability and the number of colonies in CC were markedly attenuated by LOXL1-AS1 knockdown (Figure 3(a-c)). Besides, as wound healing assay showed, LOXL1-AS1 downregulation inhibited the migrative ability of CC cells (Figure 3(d)). Then we overexpressed LOXL1-AS1 in CaSki and Me-180 cells, and RT-qPCR was conducted to evaluate the overexpression efficiency of pcDNA3.1/LOXL1-AS1 (Figure 3(e)). As MTT and colony formation assays revealed, the viability and proliferation of CaSki and Me-180 cells were promoted by LOXL1-AS1 upregulation (Figure 3(f-h)). The migrative ability of CaSki and Me-180 cells was enhanced in response to LOXL1-AS1 upregulation, as shown by wound healing assays (Figure 3(i,j)). Moreover, HeLa and SiHa cell viability and proliferation were inhibited by miR-423-5p upregulation (Figure 3(k,l)), and miR-423-5p upregulation strongly reduced the migration of CC cells (Figure 3(m,n)). Above results reveal that LOXL1-AS1 acts as an oncogene in CC and miR-423-5p upregulation attenuates the malignant phenotypes of CC cells.LOXL1-AS1 knockdown or miR-423-5p overexpression suppresses CC cell growth. (a-c) MTT and colony formation assays of CC cell proliferation. (d) Wound healing assay of the migratory ability of CC cells. (e) RT-qPCR was conducted to evaluate the overexpression efficiency of pcDNA3.1/LOXL1-AS1. (f-g) MTT of cell viability in the pcDNA3.1 group or pcDNA3.1/LOXL1-AS1 group. (h) Colony formation assays of cell proliferation in different groups. (i-j) Wound healing assays of cell migration in response to LOXL1-AS1 upregulation. (k-l) MTT and colony formation assays of CC cell proliferation in the miR-NC group or the miR-423-5p group. (m-n) Wound healing assay of the migratory ability of CC cells in different groups. **P < 0.01, ***P < 0.001.Continued.
MiR-423-5p targets ENC1 and ENC1 knockdown prohibits the MEK/ERK signaling pathway in CC
To explore the potential targets of miR-423-5p, we searched for candidate genes in starBase v2.0 software (search category: CLIP Data: strict stringency (≥5) + Pan-cancer: 10 cancer types + Predicted Program: microT + PicTar) and found three targets: ENC1, FAM129B and NDST1 (Figure 4(a)). And RT-qPCR showed that ENC1 exerted the most notable change with miR-423-5p overexpression among the three candidates (Figure 4(b)). The binding site of miR-423-5p on ENC1 is presented in (Figure 4(c)). As shown, miR-423-5p mimics induced a distinct inhibition in the luciferase activity of ENC1-Wt group (Figure 4(d)). Additionally, the ENC1 protein expression was inhibited by miR-423-5p mimics (Figure 4(e)). ENC1 was further found upregulated in CC tissues compared with that in nontumor tissues, as shown by RT-qPCR (Figure 4(f)). And Spearman’s correlation analysis displayed a negative relationship of ENC1 and miR-423-5p in CC tissues (Figure 4(g)). Also, our data suggested that LOXL1-AS1 knockdown reduced the ENC1 protein expression in CC cells (Figure 4(h)). Then we effectively knocked down miR-423-5p level using the miR-423-5p inhibitor (Figure 1). The results of RT-qPCR revealed that miR-423-5p inhibitor rescued the sh-LOXL1-AS1-induced reduction in ENC1 expression level (Figure 4(j)). Since previous research revealed that the MEK/ERK signaling pathway participates in cancer process [41,42]. We explored the role of MEK/ERK signaling in CC in this study. Our data exhibited that ENC1 knockdown decreased the phosphorylation of MEK1/2, ERK1/2, JNK and p38 in CC cells (Figure 4(k)), suggesting that ENC1 knockdown prevents MEK/ERK signaling.
Figure 4.
MiR-423-5p targets ENC1 and ENC1 knockdown prohibits the MEK/ERK signaling in CC. (a) Venn diagram displays 3 mRNAs which might be downstream targets of miR-423-5p. (b) RT-qPCR of mRNA expression in miR-423-5p-overexpressed CC cells. (c) The predicted binding site of ENC1 on miR-423-5p. (d) The binding ability between ENC1 and miR-423-5p validated by luciferase reporter assay. (e) Western blot of the protein level of ENC1 in miR-423-5p-overexpressed CC cells. (f) RT-qPCR of ENC1 expression in CC tissues. (g) Correlation between ENC1 and miR-423-5p expression in CC tissues. (h) Western blot of the protein level of ENC1 in LOXL1-AS1-silenced CC cells. (i) RT-qPCR was conducted to estimate the knockdown efficiency of miR-423-5p inhibitor. ((j) RT-qPCR of ENC1 expression in the control group, the sh-LOXL1-AS1+ NC inhibitor group and the sh-LOXL1-AS1+ miR-423-5p inhibitor group. (k) Western blotting of the phosphorylation levels of MEK1/2, ERK1/2, JNK and p38 in CC cells. **P < 0.01, ***P < 0.001.
MiR-423-5p targets ENC1 and ENC1 knockdown prohibits the MEK/ERK signaling in CC. (a) Venn diagram displays 3 mRNAs which might be downstream targets of miR-423-5p. (b) RT-qPCR of mRNA expression in miR-423-5p-overexpressed CC cells. (c) The predicted binding site of ENC1 on miR-423-5p. (d) The binding ability between ENC1 and miR-423-5p validated by luciferase reporter assay. (e) Western blot of the protein level of ENC1 in miR-423-5p-overexpressed CC cells. (f) RT-qPCR of ENC1 expression in CC tissues. (g) Correlation between ENC1 and miR-423-5p expression in CC tissues. (h) Western blot of the protein level of ENC1 in LOXL1-AS1-silenced CC cells. (i) RT-qPCR was conducted to estimate the knockdown efficiency of miR-423-5p inhibitor. ((j) RT-qPCR of ENC1 expression in the control group, the sh-LOXL1-AS1+ NC inhibitor group and the sh-LOXL1-AS1+ miR-423-5p inhibitor group. (k) Western blotting of the phosphorylation levels of MEK1/2, ERK1/2, JNK and p38 in CC cells. **P < 0.01, ***P < 0.001.
ENC1 overexpression prevents the effect of miR-423-5p in CC
To investigate whether miR-423-5p represses CC cell functions by ENC1, cells were transfected with miR-423-5p mimics and pcDNA3.1/ENC1 plasmids. The results of MTT and colony formation assays revealed that ENC1 upregulation partially reversed the inhibitory effects of miR-423-5p upregulation on CC cell proliferation (Figure 5(a,b)). Also, wound healing assay displayed that ENC1 upregulation eliminated the prohibitive impact of miR-423-5p in CC cell migration (Figure 5(c)). These data implied that miR-423-5p regulates CC progression via targeting ENC1.
Figure 5.
ENC1 overexpression reverses the suppressive effect of miR-423-5p on CC cells. (a-b) MTT and colony formation assays of CC cell proliferation. (c) Wound healing assay of the migratory ability of CC cells. *P < 0.05, **P < 0.01, ***P < 0.001.
ENC1 overexpression reverses the suppressive effect of miR-423-5p on CC cells. (a-b) MTT and colony formation assays of CC cell proliferation. (c) Wound healing assay of the migratory ability of CC cells. *P < 0.05, **P < 0.01, ***P < 0.001.
LOXL1-AS1 knockdown suppresses tumor growth and metastasis in vivo
Finally, to further confirm the biological role of LOXL1-AS1 in CC development, in vivo experiments were conducted. The tumor images were presented, and the results demonstrated that LOXL1-AS1 knockdown inhibited tumor growth (Figure 6(a)). LOXL1-AS1 silence remarkably repressed tumor size and reduced tumor weight in comparison with the control group (Figure 6(b,c)). After that, we effectively knocked LOXL1-AS1 down in the resected tumors, and the knockdown efficiency was identified by RT-qPCR. Also, miR-423-5p level was increased in the context of LOXL1-AS1 downregulation (Figure 6(d,e)). Additionally, ENC1 level was decreased following LOXL1-AS1 downregulation (Figure 6(f)) Moreover, IHC analysis for Ki67 manifested that silence of LOXL1-AS1 impaired CC cell proliferation (Figure 6(g)). Compared with those in the control group, LOXL1-AS1 knockdown significantly inhibited the metastatic liver foci (Figure 6(h,i)). In summary, those results confirmed that LOXL1-AS1 promotes CC progression via the miR-423-5p/ENC1 axis through the ERK/MEK pathway.
Figure 6.
LOXL1-AS1 knockdown suppresses tumor growth of CC in vivo. (a) Tumor images in the sh-NC group and sh-LOXL1-AS1 group. (b and c) Tumor size and tumor weight. (d-f) The expression of LOXL1-AS1, miR-423-5p and ENC1 in the resected tumors. (g) The percentage of Ki-67 positive cells was evaluated by IHC analysis. (h-i) The images and number of the metastatic liver foci. N = 8. *P < 0.05, **P < 0.01, ***P < 0.01.
LOXL1-AS1 knockdown suppresses tumor growth of CC in vivo. (a) Tumor images in the sh-NC group and sh-LOXL1-AS1 group. (b and c) Tumor size and tumor weight. (d-f) The expression of LOXL1-AS1, miR-423-5p and ENC1 in the resected tumors. (g) The percentage of Ki-67 positive cells was evaluated by IHC analysis. (h-i) The images and number of the metastatic liver foci. N = 8. *P < 0.05, **P < 0.01, ***P < 0.01.
Discussion
Over the past decades, evidence has indicated that many lncRNAs are dysregulated in CC, and they actively participate in CC progression. For example, specificity protein 1 (SP1)-mediated lncRNA pit-oct-unc class 3 homeobox 3 (POU3F3) facilitates CC development via the miR-127-5p/FOXD1 axis [43]. LncRNA 799 promotes the metastasis of CC by increasing Transducin (β)-like 1 X-linked receptor 1 (TBL1XR1) levels [44]. LncRNA macrophage stimulating 1 pseudogene 2 (MST1P2) promotes CC progression by binding to miR-133b [45]. LOXL1-AS1 is a well-studied tumor promoter. LOXL1-AS1 promotes tumorigenesis in cervical squamous cell carcinoma in vitro [20], contributes to the proliferation and migration of laryngocarcinoma cells [46], facilitates the proliferation, invasion and migration of lung cancer cells [47], and drives breast cancer invasion and metastasis [48]. The results in our study were consistent with previous findings. Here, the highly expressed level of LOXL1-AS1 in CC samples was determined. And upregulated LOXL1-AS1 was verified to be closely related to an unfavorable prognosis. Moreover, LOXL1-AS1 downregulation inhibited CC cell proliferation and migration, and LOXL1-AS1 upregulation played an opposite effect on the malignant phenotypes of CC cells. Ki-67 is a potential biomarker for cervical intraepithelial neoplasia (CIN) and reflects cellular dysfunction [49].The in vivo experiments revealed that LOXL1-AS1 downregulation decreased Ki67 expression and inhibited tumor growth and metastasis. This was first to show the oncogenic function of LOXL1-AS1 in CC in vivo.LncRNAs can serve as ceRNAs to modulate miRNAs in various tumors, including CC. For example, lncRNA ANRIL facilitates CC progression via absorbing miR-186 [50]. Homeobox transcript antisense RNA (HOTAIR) promotes CC by sponging miR-17-5p [51]. LncRNA plasmacytoma variant translocation 1 (PVT1) fosters the development of CC by negatively modulating miR-424 [52]. Relevant experiments identified the cytoplasmic distribution of LOXL1-AS1 in CC cells, suggesting its ability to bind to miRNAs. The results of Bioinformatics analysis, RNA pull down assays and luciferase reporter assays verified the binding relationship between LOXL1-AS1 and miR-423-5p. As previously reported, miR-423-5p suppresses osteosarcoma cell proliferation and invasion by Stathmin 1 (STMN1) [53]. MiR-423-5p prohibits ovarian cancer by suppressing cell proliferation [54]. And miR-423-5p downregulation inhibits prostate cancer development [55]. Here, we discovered that miR-432-5p upregulation could inhibit cell proliferation and migration of CC cells, demonstrating its antioncogenic role in CC.It has been reported that miRNAs can target the 3′-UTR of mRNAs in a direct way, resulting in mRNA translation prohibition [56]. Therefore, we predicted the downstream target of miR-432-5p using bioinformatics analysis and ENC1 caught our attention. Previous research has verified that ENC1 can facilitate the development of many tumors. For example, downregulation of ENC1 can inhibit the development of ovarian cancer [57]. Introduction of exogenous ENC1 promotes colon cancer cell growth [58]. ENC1 increases the tumorigenesis and metastasis of colorectal carcinoma [59]. Here, we observed that ENC1 was upregulated in CC tissues. The MAPK/ERK pathway functions in the regulation of various physiological and pathophysiological processes in cancer progression, including breast cancer [60], lung cancer [61], and cervical cancer [62]. During development from cervical CIN I to CIN III, the MAPK/ERK pathway is significantly activated [63].The inactivation of ERK1/2 induced by MEK inhibition inhibits tumor cell proliferation and promotes cell apoptosis [64]. We herein found that ENC1 knockdown decreased the protein levels of p-p38, p-MEK1/2 and p-ERK1/2, inhibiting the activation of ERK/MEK pathway and reducing cell proliferation. Moreover, ENC1 upregulation could attenuate the inhibitory effects of miR-423-5p overexpression on cellular phenotypes in CC.Honestly, there are some limitations in this study. First, the biopsy sampling error cannot be completely excluded. Second, the effects of LOXL1-AS1 on migrative ability have not been verified in animal models. Despite these limitations, we postulate that after validation in large clinical cohorts, LOXL1-AS1 will be an effective target for guiding individualized clinical therapy of CC.
Conclusion
In the present study, we found that LOXL1-AS1 was upregulated in CC tissues and cells. Functionally, LOXL1-AS1 promoted cell proliferation and migration via the miR-423-5p/ENC1 axis through the ERK/MEK pathway. Moreover, the in vivo experiments indicated that LOXL1-AS1 downregulation inhibited tumor weight and tumor size and the proliferation of CC cells. However, there may be more potential genes implicated in the cellular process of CC progression and more attention needs to be shed on the molecular mechanism of LOXL1-AS1 in cervical cancer. We speculate that our findings could provide theoretical support in the search for novel therapeutic targets for cervical cancer.
Authors: Mona Saraiya; Elizabeth R Unger; Trevor D Thompson; Charles F Lynch; Brenda Y Hernandez; Christopher W Lyu; Martin Steinau; Meg Watson; Edward J Wilkinson; Claudia Hopenhayn; Glenn Copeland; Wendy Cozen; Edward S Peters; Youjie Huang; Maria Sibug Saber; Sean Altekruse; Marc T Goodman Journal: J Natl Cancer Inst Date: 2015-04-29 Impact factor: 13.506
Authors: Patricia J Eifel; Kathryn Winter; Mitchell Morris; Charles Levenback; Perry W Grigsby; Jay Cooper; Marvin Rotman; David Gershenson; David G Mutch Journal: J Clin Oncol Date: 2004-03-01 Impact factor: 44.544
Authors: Marc Arbyn; Elisabete Weiderpass; Laia Bruni; Silvia de Sanjosé; Mona Saraiya; Jacques Ferlay; Freddie Bray Journal: Lancet Glob Health Date: 2019-12-04 Impact factor: 26.763