Literature DB >> 35012643

Development and characterization of microsatellite markers for the French endemic Angelica heterocarpa (Apiaceae) and congeneric sympatric species.

Emmanuelle Revardel1, Olivier Lepais2.   

Abstract

OBJECTIVE: Angelica heterocarpa (Apiaceae) is a wild endemic French species with special conservation interest in the European Union. It belongs to Angelica complex genus which is widespread throughout the north temperate zone, and is sympatric with other congeneric species. The objective of this work is to develop and characterize microsatellite markers as a new tool for understanding the ecology and evolution of Angelica species complex.
RESULTS: We identified simple sequence repeat (SSR) regions in a microsatellite-enriched library from A. heterocarpa and A. sylvestris. All 16 selected SSR regions were found to amplify in these species and were highly polymorphic. Marker transferability was validated in A. razulii and A. archangelica. These markers will help us to better understand the evolutionary dynamic between rare endemics and widespread sister species, and be useful for conservation of the endemic species. Moreover, they can provide new tools for studying the numerous traditional medicinal herbs of the Angelica genus.
© 2022. The Author(s).

Entities:  

Keywords:  Angelica archangelica; Angelica razulii; Angelica sylvestris; Conservation; Estuary riverbanks; Genetic diversity; Hybridization; Nuclear SSR; Plants; Population genetics

Mesh:

Year:  2022        PMID: 35012643      PMCID: PMC8751362          DOI: 10.1186/s13104-021-05903-2

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Introduction

Angelica L. is a large complex genus comprising approximately 110 species confined in the northern hemisphere, with the majority in Eurasia [1]. In this paper, four French native congeneric Angelica species are considered. Angelica heterocarpa Lloyd is endemic to southwestern French estuary banks. It is protected at national level in France and is listed as priority species in the Habitats Directive of European Union [2]. Angelica sylvestris L. is common in open and forest habitats and is widely distributed among Europe and Asia. Despite different ecological niches, A. heterocarpa and A. sylvestris can live in neighboring riverbank locations. The observation of morphological intermediates questions the taxonomic relationship and potential for hybridization between these two species. Two other species are present in southwestern France: Angelica razulii Gouan, a Pyrenean endemic that shares hydrographic zones with A. heterocarpa and A. sylvestris, and Angelica archangelica L. that occurs naturally in estuaries from northern France and Europe and is cultivated in southwestern France for aromatic and pharmacological interests. For the effective conservation of A. heterocarpa, genetic markers providing resolution at the population level are essential although, until now, not available. Here, we report the characterization of 16 new polymorphic microsatellite markers for A. heterocarpa and A. sylvestris and test their cross‐species transferability in A. razulii and A. archangelica.

Main text

Methods

Plant material was collected across natural populations in France or Germany: two for A. heterocarpa (N = 78), three for A. sylvestris (N = 98) and one for A. razulii (N = 50) and A. archangelica (N = 3) (Table 4 in Appendix 1). One or two leaflets were collected from each plant and preserved dried in silica gel. DNA was extracted with the Invitek extraction kit (Invitek, Berlin, Germany). Microsatellites markers were developed from sequences obtained from A. heterocarpa and A. sylvestris after enrichment by both traditional cloning and high throughput sequencing (GenoScreen, Lille, France) of microsatellite-enriched library [3]. Sequences containing microsatellites were identified using the QDD software [4] and primers were designed using the Primer 3 software [5] using default parameters with 56 °C as annealing temperature. A total of 119 primers pairs for these SSR loci were tested for amplification and genotyping of 4 of each A. heterocarpa and A. sylvestris individuals using primer extended with M13 sequence for fluorescent labeling [6]. All of them were found to amplify in the both species and among them, 16 showing polymorphisms and consistent peak profile were selected in the final genotyping protocol (Table 1).
Table 4

Taxonomic, geographic information (municipality, department number, country) and GPS central coordinates of Angelica sp. populations sampling (n = number of individuals) represented in this study

SpeciesLocation, country n Geographic coordinatesPopulation name
A. heterocarpa Isle-Saint-Georges (33). FR38N44°43′30″-W0°27′28″Isle St George
A. heterocarpa Rézé (44). FR40N47°11′28″-W1°36′6″Rézé
A. sylvestris La Brède (33). FR30N44°40′21″-W0°33′17″La Brède
A. sylvestris Aurice (40). FR38N43°48′38″-W0°35′36″Aurice
A. sylvestris Le Bonhomme (68). FR30N48°8′10″-E7°5′19″Le Bonhomme
A. razulii Bagnères de Bigorre (64). FR50N42°59′48″-E0°7′29″Bagnères
A. archangelica Hambourg. DE3N53°34′18″-E10°00′09″Hambourg

FR, France; DE, Germany

Table 1

Characteristics of 16 primer pairs for microsatellites loci developed in A. heterocarpa and A. sylvestris

LocusPrimer sequences (5′ → 3′)MotifRange (bp)LabelMultiplexGenBank
An23F:GAAACAAAATCAAATAGTAATCGCAAC75–95PET1MZ065562
R:AAATGTAATCTGCACGCGGT
An35F:GGTTGCAACTCAGATGCTGGGT175–189FAM1MZ065564
R:ACCCTGTGCGTATTGCCTAC
An69F:AGCAAGTGAGGCAAGACCATAG144–176FAM2MZ065568
R:CAAACTCTCCTTCACCCCAA
An71F:GAGCATCCTCGAAGAGATCAAAG216–262FAM1,2MZ065569
R:GGGACCACTCAGAATTGGAA
An72F:TTGGATTCAGGAGAGGACCAGAT66–114FAM2MZ065570
R:CTTCTCCCAACCAGGATCAG
An74F:GCATTGTAGCCTACTGGAGGGGT80–134VIC2MZ065571
R:GGCAACAGAGTAGACCTTAACCTG
An89F:GCAACCGCAGCTCATTTTATGT88–106PET2MZ065572
R:AAACAAAGGACCAGCCGAC
An91F:CTCGCGTTGACAGGGTTTAGT129–143PET2MZ065573
R:TCGAGTTCTAGTTGGACAGGG
An93F:GGCAGCTAAGTGAAGCAAAAAC170–190VIC2MZ065574
R:TGCGCATGTTACTAAGGCTG
S216F:TCTCTGAGTATATATTTTTGGGTGTGCT167–179PET1MZ065559
R:TCGCAAAATACCCTCATCTC
An11F:GGGACATTCAACACAACATCAAG96–128VIC1MZ065561
R:CTCTTTCTTGCACCCTTCCA
An39F:TTGGCTGCACTTACATTTGCCT212–284VIC1MZ065565
R:ATGATAAACCCGGTTGCTTG
An68F:TCCAAAATGCACAGATCCAGAG129–171NED2MZ065567
R:CTCGTCGAGTTCTACGCTCC
An32F:TGGGTTCATCAAGATTCAAGGAG118–174NED1MZ065563
R:GTGTGGTCACTGCAAGCATC
An41F:GGGAAACTGAATTAACCGAGCAG263–324PET1MZ065566
R:CCACTTGTGGTCTCTAACATGG
S37F:CAAAAGTGGATACTAGTTGTGTGCT192–224NED1MZ065560
R:GCTCTACCATTAGCAAAACC

Label: fluorophore dye labeling at 5′ end of forward primers

F, forward primer sequence; R, reverse primer sequences; bp, base pair

Characteristics of 16 primer pairs for microsatellites loci developed in A. heterocarpa and A. sylvestris Label: fluorophore dye labeling at 5′ end of forward primers F, forward primer sequence; R, reverse primer sequences; bp, base pair Multiplexed PCR were achieved using Qiagen Microsatellite Type-It master mix (Qiagen, Hilden, Germany) and cycling conditions were: 15 min at 95 °C; 30 cycles of 30 s at 94 °C, 60 s at 56 °C, 45 s at 72 °C; and 60 °C for 30 min. The fluorescent‐labeled PCR products were run on an ABI 3730 DNA Analyzer (Applied Biosystems, Waltham, MA, USA) at the Genome Transcriptome Facility of Bordeaux. Genotype calling was carried out manually using GeneMapper Software (Applied Biosystems, Waltham, MA, USA).

Results and discussion

Overall, the developed microsatellite loci were highly polymorphic with a number of alleles per locus ranged from 2 to 21 with a mean of 8 alleles per locus in the five studied A. heterocarpa and A. sylvestris populations (Table 2). At the population level, the observed heterozygosity ranged from 0.54 to 0.60, and the expected heterozygosity ranged from 0.66 to 0.74. Four out of the 16 loci showed significant deviations from Hardy–Weinberg equilibrium (HWE) in more than one population after correcting for multiple testing (P < 0.001; Table 2).
Table 2

Genetic diversity characteristics of 16 microsatellites loci for A. heterocarpa and A. sylvestris populations

A. heterocarpa—Rézé (N = 40)A. heterocarpa—Ile-St-Georges (N = 38)A. sylvestris—Aurice (N = 38)A. sylvestris—La Brède (N = 30)A. sylvestris—Le Bonhomme (N = 30)
LociNAHEHOFISNAHEHOFISNAHEHOFISNAHEHOFISNAHEHOFIS
An2360.750.560.25100.820.680.1750.750.76− 0.0270.700.500.2940.580.130.79a
An3550.670.580.1440.530.55− 0.0550.540.320.4260.650.70− 0.0840.560.57− 0.01
An6930.330.300.0990.830.790.05150.880.760.1350.460.330.2960.470.400.15
An7190.760.320.58a180.910.580.36a140.880.310.65a130.890.720.19150.880.590.34a
An7280.800.690.1380.770.760.01110.790.85− 0.0780.850.830.02130.860.87− 0.01
An7420.430.100.7740.450.230.49a40.550.180.67a40.230.180.2420.040.040.00
An8960.740.710.0550.530.270.49a80.820.330.60a60.710.440.3960.650.530.18
An9160.590.530.1260.510.450.1260.610.580.0560.620.73− 0.1860.740.690.07
An9350.540.290.4770.690.320.54a70.770.210.74a70.790.480.40a100.890.520.42a
S21640.580.580.0140.550.500.1040.640.610.0550.700.430.3930.500.53− 0.07
An1180.770.750.0390.870.810.07120.840.750.11110.810.670.1880.790.720.09
An39120.820.88− 0.07210.920.920.00110.760.690.08120.900.760.1670.780.710.09
An6880.770.720.07110.830.790.05150.830.86− 0.0380.770.83− 0.0980.740.660.11
An3290.680.74− 0.0940.290.190.3480.760.500.34a60.650.69− 0.0680.820.600.27
An41120.890.860.04190.910.660.28a100.860.88− 0.03
S3780.840.570.3380.770.240.69a60.740.480.36
Mean6.90.690.570.189.20.700.550.238.90.740.550.277.50.710.600.157.10.660.540.17

N, number of samples; NA, number of alleles (NA); HO, observed heterozygosity; HE, expected heterozygosity; FIS, inbreeding coefficient; –, unavailable data

aSignificant deficit in heterozygotes (P < 0.01)

Genetic diversity characteristics of 16 microsatellites loci for A. heterocarpa and A. sylvestris populations N, number of samples; NA, number of alleles (NA); HO, observed heterozygosity; HE, expected heterozygosity; FIS, inbreeding coefficient; –, unavailable data aSignificant deficit in heterozygotes (P < 0.01) The cross‐species transferability and polymorphism of the developed SSR markers were further tested in the two other congeneric species (Table 3). In A. razulii, only 7 out of the 16 loci amplified consistently and were polymorphic. On the 12 markers tested in A. archangelica, 7 amplified successfully and were polymorphic. Note that additional markers amplified inconsistently, suggesting presences of null alleles or limited transferability (3 markers for A. razulii and 4 for A. archangelica, Table 3).
Table 3

Number of alleles and allele range of microsatellite loci in A. razulii and A. archangelica

LociA. razulii (N = 50)A. archangelica (N = 3)
NARange (bp)NARange (bp)
An2300179
An353177–1853169–179
An697140–1522142–150
An715212–2202216–230 (2)
An72863–96269–72
An7400182 (1)
An89592–102 (20)192 (1)
An919125–1432133–135 (1)
An93002170–178
S216002169–179
An11002132–138
An392220–2243188–232
An6800
An3212124–156
An412267–271 (12)
S373151–171 (3)

Values in () indicates the number of individuals with at least one PCR amplified signal

N, number of samples; NA, number of alleles; bp, base pairs; –, unavailable data

Number of alleles and allele range of microsatellite loci in A. razulii and A. archangelica Values in () indicates the number of individuals with at least one PCR amplified signal N, number of samples; NA, number of alleles; bp, base pairs; –, unavailable data These new polymorphic markers will allow investigating population genetic structure, reproductive system, and potential hybridization within the Angelica species complex. Moreover, as numerous Angelica species are traditional medicine herbs all over the Eurasia continent, including A. sylvestris and A. archangelica [7], these microsatellite markers complement the molecular markers previously developed for other congeneric species of particular pharmacological interest [8-10].

Limitations

Deviation from HWE: Loci showing marked deficits in heterozygotes in most populations are likely affected by null alleles. However, this should be further investigate with larger sample size because the restricted sampled size of the present study hampered additional statistical test. In addition, more biological insight to support the fact that the species is expect to follow HWE is needed because population substructure or hybridization are likely affecting Angelica population and would resulted in departure from HWE. Sample size limitation for A. archangelica: only 3 individuals have been included to test for transferability and polymorphism for this species. Amplification success and polymorphism should be assessed in a larger sample size to confirm monomorphic loci.
  6 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

3.  Natural medicine: the genus Angelica.

Authors:  S D Sarker; L Nahar
Journal:  Curr Med Chem       Date:  2004-06       Impact factor: 4.530

4.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

5.  High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries.

Authors:  Thibaut Malausa; André Gilles; Emese Meglécz; Hélène Blanquart; Stéphanie Duthoy; Caroline Costedoat; Vincent Dubut; Nicolas Pech; Philippe Castagnone-Sereno; Christophe Délye; Nicolas Feau; Pascal Frey; Philippe Gauthier; Thomas Guillemaud; Laurent Hazard; Valérie Le Corre; Brigitte Lung-Escarmant; Pierre-Jean G Malé; Stéphanie Ferreira; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2011-02-21       Impact factor: 7.090

6.  Development of Genome-Wide SSR Markers from Angelica gigas Nakai Using Next Generation Sequencing.

Authors:  Jinsu Gil; Yurry Um; Serim Kim; Ok Tae Kim; Sung Cheol Koo; Chinreddy Subramanyam Reddy; Seong-Cheol Kim; Chang Pyo Hong; Sin-Gi Park; Ho Bang Kim; Dong Hoon Lee; Byung-Hoon Jeong; Jong-Wook Chung; Yi Lee
Journal:  Genes (Basel)       Date:  2017-09-21       Impact factor: 4.096

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.