Literature DB >> 35012438

Long non-coding RNA p53 upregulated regulator of p53 levels (PURPL) promotes the development of gastric cancer.

Zhonghua Cheng1, Jing Hong1, Nan Tang1, Fenghua Liu1, Shuo Gu1, Zhen Feng1.   

Abstract

Gastric cancer (GC), one of the most prevalent malignancies across the world, has an increasing incidence rate. Long non-coding RNA (lncRNA) PURPL (also referred to as LINC01021) has been demonstrated to influence malignant GC behaviors and partake in other cancers. Notwithstanding, reports pertaining to the underlying mechanism of PURPL in GC haven't been rarely seen. Presently, in-vivo and ex-vivo experiments were implemented to examine the PURPL-miR-137-ZBTB7A-PI3K-AKT-NF-κB regulatory axis in GC. Our statistics revealed that PURPL presented a high expression in GC tissues and cell lines. PURPL overexpression remarkably exacerbated colony formation, migration, and invasion and repressed apoptosis in GC cells (AGS and MNK-45). In-vivo experiments also corroborated that cell growth was boosted by PURPL up-regulation. Mechanistic investigations verified that PURPL interacted with miR-137 and lowered its profile in GC cell lines. miR-137 overexpression or ZBTB7A knockdown upended the oncogenic function mediated by PURPL. PURPL initiated the PI3K/AKT/NF-κB pathway. PI3K and NF-κB inhibition impaired the promoting impact on GC cells elicited by PURPL overexpression and contributed to PURPL down-regulation. These findings disclosed that PURPL serves as an oncogene in the context of GC via miR-137-ZBTB7A-PI3K-AKT-NF-κB axis modulation.

Entities:  

Keywords:  Gastric cancer; PURPL; ZBTB7A; miR-137; progression; signaling pathway

Mesh:

Substances:

Year:  2022        PMID: 35012438      PMCID: PMC8805877          DOI: 10.1080/21655979.2021.2017588

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

Gastric cancer (GC) is known as a malignancy stemming from gastric epithelial cells. It is a leading contributor to cancer-related death worldwide [1,2]. High-risk factors for gastric cancer incorporate helicobacter pylori infection, obesity, dietary habits, and family history [3]. The early phase of gastric cancer is characterized by opaque symptoms and low diagnostic rates, while the advanced phase usually features metastasis, poor prognosis, and low five-year survival rates [4,5]. The primary approaches to advanced gastric cancer treatment encompass immunotherapy, targeted molecular therapy, and adjuvant chemoradiotherapy [6]. Hence, a probe into the molecular mechanism of gastric cancer development helps discover novel targets for diagnosis and therapy. Long non-coding RNAs (lncRNAs), non-coding RNA molecules consisting of over 200 nucleotides, are associated with a large number of gene expressions and functional regulation in cells [7-9]. Many lncRNAs have been regarded as underlying molecular markers of tumors, characterized by aberrant expressions in tumors like lung cancer, hepatocellular carcinoma, colon cancer, and gastric cancer, and regulatory impact on tumor cell proliferation, migration, and invasion [10-12]. lncRNA PURPL, another member of the lncRNA family, is also termed LINC01021. It has been discovered to modulate P53 to boost liver cancer cell proliferation and differentiation [13]. Another study showed that lncRNA PURPL and miR-338-3p dysregulation can be adopted as the biomarkers of epithelial ovarian cancer prognosis [14]. Nevertheless, the function of lncRNA PURPL in gastric cancer progression has not been elucidated so far. microRNAs (miRNAs), small endogenous non-coding RNAs comprised of approximately 22 nucleotides, curb messenger RNA (mRNA) translation or initiate mRNA degradation to regulate post-transcriptional gene expressions [15,16]. The aberrant profiles of umpteen miRNAs have been uncovered to partake in GC tumor progression and regulate GC cells’ proliferation, differentiation, migration, apoptosis and other cell cycles [17-19]. For instance, miR-96-5p exhibits a high expression in the plasma of GC patients and GC cells, and miR-96-5p facilitates GC cell proliferation [20]. miR-339-5p displays a low expression in GC tissues plays an anti-tumor role by restraining the proliferation and migration of GC cells [21]. miR-137 fights proliferation and migration in pituitary adenoma and colorectal cancer, suggesting its tumor suppressor role in tumor progression [22,23]. Nonetheless, the function of lncRNA PURPL/miR-137 axis in GC hasn’t come to light yet. GC occurrence and development pertain to the sophisticated regulatory network among lncRNAs, miRNAs, and mRNAs [24,25]. For instance, miR-5003 is targeted by lncRNA RP11-789C1.1. RP11-789C1.1 expression down-regulation can heighten the profile of miR-5003, abate that of E-cadherin, and elicit epithelial mesenchymal transformation (EMT), bolstering GC cell proliferation and migration [26]. Zinc finger and BTB domain containing 7A (ZBTB7A), a member of the POK family, possesses a POZ domain at the N terminal and a Krüppel-like zinc finger domain at the C terminal. It has been demonstrated to function as a proto-oncogene to elicit tumor transformation and progression [27]. Nonetheless, a deeper probe into the upstream regulatory mechanism of ZBTB7A in the cancer is warranted. In this study, attempts were made to explore lncRNA PURPL’s regulation on miR-137 and ZBTB7A molecules as well as its impact on the development of gastric cancer. We confirmed enhanced PURPL and ZATB7A, but reduced miR-137 level in GC tissues and cells. PURPL overexpression promoted GC development, as well as upregulated ZBTB7A and PI3K-AKT- nuclear factor-kappaB (NF-κB) signaling pathway expression. Thus, we guessed there is a lncRNA PURPL-miR-137-ZBTB7A and PI3K-AKT-NF-κB regulatory axis contributing to GC development. Our study reveals that lncRNA PURPL is an underlying target for gastric cancer treatment, also an essential indicator for projecting its prognosis.

Methods and materials

Collection of tissue specimens

From October 2015 to October 2016, cancer tissues were harvested from 21 patients diagnosed with gastric cancer. They had never received chemotherapy or radiotherapy before they underwent surgery in Xuhui hospital of Zhongshan Hospital Affiliated to Fudan University. The characteristics of tissues were independently confirmed by three pathologists. Once the tissues were resected from the patients, they were frozen at −80°C. All patients participating in the study had signed the informed consent. The protocols concerning the usage of patient samples had been authorized by the Medical Ethics Committee of Xuhui hospital of Zhongshan Hospital Affiliated to Fudan University (Approved number: XHH-2020-0122) and were implemented in keeping with the World Medical Association Declaration of Helsinki.

Cell culture

The normal human gastric epithelial cell line GES-1 and gastric cell lines AGS, GC9811-P, MKN-45, and HSC-39, ordered from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China), were placed in a culture solution supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, MA, USA), 1% penicillin/streptomycin (Invitrogen, CA, USA), and RPMI 1640 (Thermo Fisher Scientific, MA, USA) and cultured at 37°C with 5% CO2. The solution was refreshed every three days, and 0.25% trypsin (Thermo Fisher HyClone, Utah, USA) was taken for digestion and passage. Cells in the logarithmic growth stage were harvested for subsequent procedures.

Cell transfection

Cells from each group in the logarithmic growth phase were inoculated into 6-well plates with a density of 5 × 106 cells/well. The cells were subjected to transfection after they achieved stable growth. As per the instructions of FuGene ®HD Transfection Reagent (Roche, Shanghai, China), lncRNA PURPL overexpression plasmid (lncRNA PURPL) and its negative control (Vector), si-ZBTB7A and its negative control (si-NC) (purchased from GenePharma Co., Ltd., Shanghai, China), and miR-137 mimics (miR-137) and its negative control (miR-NC) (purchased from Guangzhou Ribobio Co., Ltd., Guangzhou, China) were transfected into AGS and MKN-45 cells, respectively. Each group’s cells were put in an incubator with 5% CO2 at 37°C. Following 24-hour transfection, the original medium was substituted by a new one. Subsequent to 24 hours’ further culture, the cells were passed [28]. Real-time quantitative polymerase chain reaction (RT-qPCR) determined the profiles of lncRNA PURPL, ZBTB7A, and miR-137 with the aim to confirm the transfection efficiency.

RT-qPCR

Total RNA was extracted out of GES-1, AGS, GC9811-P, MKN-45, and HSC-39 cells employing TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The total RNA was transcribed into cDNA with the use of the PrimeScript™ Reagent kit (Invitrogen, Shanghai, China). Then real-time PCR was conducted with the assistance of SYBR GreenPCR reagent and ABI7500FAST Real-Time PCR (MedChemExpress, NJ, USA). The 2−ΔΔCT approach was utilized to assess the relative profiles of lncRNA PURPL, miR-137, and ZBTB7A (U6 and GAPDH were taken as internal references) [29]. Primer sequences are detailed below:

Colony formation assay

AGS and MKN-45 cells in each group in the logarithmic growth phase were harvested and seeded onto 6-mm dishes incorporating an RPMI 1640 medium. Each dish accommodated 1000 cells. The cells were conflated and cultured in an incubator. Twenty-four hours later, the medium was displaced by a complete medium. With the medium renewed every three to four days, the whole culture process lasted for 12 days. Following PBS washing, 4% paraformaldehyde was utilized for 10 minutes’ fixation, and 5% crystal violet staining was implemented for 10 minutes. After photos were captured, Image-ProPlus was introduced to calculate the number of cell clones formed in each dish [30]. Each experiment was duplicated three times, and measurement was implemented three times.

Transwell assay

The cell migration experiment: cells of each group in the logarithmic growth stage were administered to the upper Transwell chamber (8 µm pore size; Corting, NY, USA) (density: 2 × 104 cells/well), with 600 μL of a culture solution incorporating 20% FBS given to the lower compartment. The cells were cultured at 37°C. After twelve hours, the upper cells were removed, and 4% paraformaldehyde was exploited to immobilize the lower cells. Staining with 0.1% crystal violet was carried out prior to photographing and counting the lower cells. In the cell invasion experiment: Matrigel (BD, Sanjose, USA) was utilized to coat the upper Transwell compartment prior to the addition of cells, and the other procedures were basically the same as those in the migration test. An inverted microscope (Olympus, Tokyo, Japan) was harnessed to capture photos and monitor cell migration and invasion [31].

Flow cytometry

AGS and MKN-45 cells were dealt with 5 μg/ml cisplatin for 12 hours to induce apoptosis. After being flushed in PBS twice, cells from each group were resuspended in 150 μL Binding Buffer, with 10 μL of Annexin V-FITC and 5 μL of propidium iodide (PI) administered to the buffer. The cells were thoroughly mixed by gently swilling the centrifuge tube and incubated in the dark at 4°C for 15 minutes. FACS Calibur Flow Cytometer (BD Biosciences, SanJose, CA, USA) was operated to track apoptosis in line with the instructions of the AnnexinV-FITC/PI Apoptosis Detection kit (Yasen Biotech Co., Ltd.) [32]

Western blot

AGS and MKN-45 cells (2 × 106) from the above groups were measured out and flushed in pre-cooled PBS 3 times. RIPA lysis buffer (Beyotime Biotcchnology, Shanghai, China) was applied to lyse the cells. As the supernatant was harvested, its protein concentration was ascertained through BCA. Next, 50 μg of total protein underwent 12% polyacrylamide gel electrophoresis and was electrically moved onto polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA). After being sealed with 5% skimmed milk at room temperature for 2 hours and rinsed with 0.05% TBST 3 times, the membranes were incubated overnight at 4°C along with primary antibodies Anti-Bax (ab32503), Anti-Bcl2 (ab218123), Anti-Caspase3 (ab13847), Anti-PI3K (ab32089), Anti-p-PI3K (ab182651), Anti-AKT (ab8805), Anti-p-AKT (ab38449), Anti-NF-κB (ab16502), Anti-p-NF-κB (ab183559), and Anti-β-actin (ab115777). The antibodies were supplied by Abcam (MA, USA). Following TBST rinsing, the membranes were incubated along with the secondary antibody IgG (1:5,000, AB6721; Abcam) at room temperature for 1 hour. After they were flushed another three times, ECL reagent (Millipore, Billerica, MA, USA) was adopted for color development and imaging [31]. Image J was introduced to analyze the gray value of each protein.

Dual luciferase activity assay

The ENCORI database (http://starbase.sysu.edu.cn/index.php) projected that miR-137 was potentially targeted by lncRNA PURPL [33]. The wild- and mutant-type reporter plasmids of PURPL (PURPL-wt, PURPL-mut) were engineered. AGS cells were transfected together with miR-137 mimics and miR-NC. Forty-eight hours later, the luciferase activity was gauged as instructed. All the procedures were done in triplicate and duplicated three times.

Fluorescence in situ hybridization (FISH)

To verify the subcellular localization of PURPL in the tumor tissues and adjacent normal tissues, we implemented FISH. The paraffin-embedded sections of gastric cancer tissues and normal adjacent tissues were prepared. The slices were dewaxed, subjected to antigen repair, and flushed in 0.01 M PBST 3 times (5 min each). After being sealed with 5% BSA for an hour at room temperature, the sections were hybridized with a hybridization solution supplemented with PURPL probes (5 ng/ul, Sangon, Shanghai, China) for 15 hours at 4°C overnight. The nucleus was then dyed employing DAPI (Beyotime, Shanghai, China) for 5 min at room temperature. A fluorescence microscope (Olympus BX53, Tokyo, Japan) was taken to capture the PURPL fluorescence signal [34].

Immunofluorescence

Immunofluorescence confirmed the profiles of ZBTB7A, PI3K, AKT, and NF-κB in the tumor tissues. Prior to blocking with 5% BSA for an hour at room temperature, the sections were incubated along with primary antibodies Anti-ZBTB7A (ab240185), Anti-p-PI3K(ab182651), Anti-p-AKT (ab38449), and Anti-p-NF-κB (ab183559) for 15 hours at 4°C overnight. For TUNEL-labeled apoptotic cell detection, the blocked sections were incubated along with TUNEL testing solution (Beyotime, Shanghai, China) for 60 min at 37°C. The nucleus was then dyed employing DAPI (Beyotime, Shanghai, China) for 5 min at room temperature. A fluorescence microscope (Olympus BX53, Tokyo, Japan) was deployed to capture the fluorescence signals [35].

The mouse xenograft tumor model

Twenty male mice on a BALB/c background, 6–8 weeks of age and 18–22 g in weight, were ordered from the Animal Research Center of Shanghai Jiaotong University and reared under specific pathogen-free (SPF) housing, provided with sufficient food and water. Then the mice were kept as the hosts for gastric cancer transplantation at 25°C with the relative humidity of 60% to 70%. In this experiment, the animal procedures had received the green light from the Committee for Animal Protection of Xuhui hospital and were implemented in line with the Guide for the Care and Use of Laboratory Animals. The experiment had also received the imprimatur from the Medical Ethics Committee of Xuhui hospital of Zhongshan Hospital Affiliated to Fudan University (Approved number: XHH-2020-0122). Twenty nude mice were randomized to two groups, 10 mice for each. AGS cells transfected along with lncRNA PURPL overexpression plasmid and the vector plasmid were made into single-cell suspension of 1 × 107 cells per mL, which was inoculated into the mice on the right and posterior sides of the back so as to engineer a xenograft model of gastric cancer in the animals. The tumor volume was gauged and calculated adopting a vernier caliper on the 7th day, 14th day, 21st day, 28th day, and 35th day. Thirty-five days later, the mice were euthanized with the use of phenobarbital (50 mg/kg via i.p.), with their tumors isolated and weighed [36].

Immunohistochemistry

The tissues of the transplanted xenograft tumors in mice were routinely embedded in paraffin and sliced up (4 μm). The tissues were dewaxed using xylene, hydrated with gradient alcohol, and blocked with 3% H2O2 for 10 minutes to get the endogenous peroxidase inactivated. Microwave reparation (pH = 6.0, 15 minutes) was done with the use of 0.01 mol/L sodium citrate buffer. After being sealed with 5% bovine serum albumin (BSA) for 20 minutes, the sections were incubated along with the primary antibody Ki67 (concentration: 1:100) (ab15580) (purchased from Abcam, MA, USA) overnight at 4°C. The next day, the slices were incubated with the addition of the secondary antibody IgG at room temperature for 20 minutes. They were then colored with DAB (diaminobenzene) for imaging subsequent to PBS washing. Following redyeing with hematoxylin, the samples were dehydrated, made transparent, and sealed in preparation for microscopic examination.

Statistical analysis

The SPSS17.0 statistical software (SPSS Inc., Chicago, IL, USA) was exploited for statistical analysis, with the measurement statistics presented as ‘mean ± standard deviation (x ± s).’ χ2 was utilized to analyze the measurement data or percentages (%). ANOVA was taken for comparison among multiple groups, while an independent sample t-test was adopted to compare two groups. P < 0.05 was regarded statistically meaningful.

Results

In this study, we first evaluated the expression features of PURPL in GC tissues and cells. Next, the effects of PURPL in GC cell proliferation, migration, invasion, apoptosis, and growth were detected. The underlying mechanism of PURPL-miR-137-ZBTB7A axis was verified. Furthermore, PI3K/Akt /NF-κB pathway was intervened for confirming the role of this pathway regulated by URPL-miR-137-ZBTB7A axis.

lncRNA PURPL presented a high expression in gastric cancer tissues and cells

To grasp the expression features of PURPL in gastric cancer tissues, we gleaned the tumor tissues and normal adjacent tissues of 21 patients suffering from gastric cancer and determined PURPL expression in the tissues employing RT-PCR. PURPL expression was prominently enhanced in gastric cancer tissues as compared with normal tissues (Figure 1(a), p < 0.05). FISH indicated that PURPL was primarily situated at the cytoplasm of gastric cancer cells, while its level was lessened in the adjacent normal tissues (Figure 1(b)). RT-PCR confirmed the profile of PURPL in the normal gastric epithelial cell line GES-1 and gastric cancer cell lines AGS, GC9811-P, MKN-45, and HSC-39. In contrast with GES-1 cells, PURPL expression in AGS, GC9811-P, MKN-45, and HSC-39 cells was considerably uplifted (Figure 1(c), p < 0.05). Given the outcomes, we concluded that lncRNA PURPL presented a high profile in gastric cancer tissues and gastric cancer cells.
Figure 1.

lncRNA PURPL presented a high profile in GC tissues and cells The tumor tissues and normal adjacent tissues of 21 patients suffering from gastric cancer were harvested. A. PURPL expression in the patients’ tumor tissues and normal adjacent tissues was determined by RT-PCR. B. FISH examined PURPL in GC tissues and normal adjacent tissues. C. RT-PCR confirmed PURPL expression in the normal gastric epithelial cell line GES-1 and gastric cell lines AGS, GC9811-P, MKN-45, and HSC-39. ***P < 0.001. N = 3.

lncRNA PURPL presented a high profile in GC tissues and cells The tumor tissues and normal adjacent tissues of 21 patients suffering from gastric cancer were harvested. A. PURPL expression in the patients’ tumor tissues and normal adjacent tissues was determined by RT-PCR. B. FISH examined PURPL in GC tissues and normal adjacent tissues. C. RT-PCR confirmed PURPL expression in the normal gastric epithelial cell line GES-1 and gastric cell lines AGS, GC9811-P, MKN-45, and HSC-39. ***P < 0.001. N = 3.

lncRNA PURPL overexpression facilitated GC cell proliferation, migration, and invasion

To disclose the influence of lncRNA PURPL on GC cell proliferation, migration, and apoptosis, we engineered a lncRNA PURPL overexpression model in AGS and MKN-45 cells. RT-PCR determined the profile of PURPL in the cell model. It was discovered that by contrast to the vec group, the PURPL group witnessed a substantial rise in the profile of PURPL (Figure 2(a), p < 0.05). Colony formation assay monitored cell proliferation, suggesting that compared to the vec group, there was a considerable uplift in cell proliferation in the PURPL group (Figure 2(b), p < 0.05). Transwell investigated cell migration and invasion, signaling a remarkable rise in cell migration and invasion in the PURPL group as opposed to the vec group (Figure 2(c), p < 0.05). Flow cytometry examined cell apoptosis and uncovered that in contrast with the vec group, the PURPL group underwent a vigorous reduction in apoptosis (Figure 2(d), p < 0.05). Western blot assessed apoptosis-concerned proteins, revealing that Bax and Caspase3 expressions were attenuated, while Bcl2’s expression was elevated in the PURPL group vis-a-vis the vec group (Figure 2(e), p < 0.05). These findings demonstrated that overexpression of lncRNA PURPL notably facilitated GC cells’ proliferation, migration, and invasion and hampered their apoptosis.
Figure 2.

lncRNA PURPL overexpression boosted GC development AGS and MKN-45 cells were transfected along with lncRNA PURPL overexpression plasmid. A. RT-PCR ascertained the profile of PURPL in AGS and MKN-45 cells. B. Colony formation assay monitored cell proliferation. C. Transwell checked cell migration and invasion. D. Flow cytometry tracked apoptosis. E. Western blot verified the profiles of apoptosis-concerned proteins Bax, Bcl2, and Caspase3. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. the vec group), N = 3.

lncRNA PURPL overexpression boosted GC development AGS and MKN-45 cells were transfected along with lncRNA PURPL overexpression plasmid. A. RT-PCR ascertained the profile of PURPL in AGS and MKN-45 cells. B. Colony formation assay monitored cell proliferation. C. Transwell checked cell migration and invasion. D. Flow cytometry tracked apoptosis. E. Western blot verified the profiles of apoptosis-concerned proteins Bax, Bcl2, and Caspase3. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. the vec group), N = 3.

Overexpression of lncRNA PURPL boosted GC cell growth in vivo

To dig deeper into the function of lncRNA PURPL overexpression in vivo, we inoculated the suspension of AGS cells with overexpression of lncRNA PURPL into the back of the mice on the right and posterior sides to establish a xenograft tumor model. The tumor volume was gauged and calculated employing a vernier caliper every seven days. It was disclosed that the tumor volume was evidently larger in the PURPL group than the vec group (Figure 3(a), p < 0.05). Figure 3(b) displays the images of the mouse tumors. After weighing the mouse tumors, we unveiled that the tumor mass was remarkably enlarged in the PURPL group as compared with the vec group (Figure 3(c), p < 0.05). The profile of the proliferation indicator Ki67 was confirmed via immunohistochemistry. As a result, the rate of positive Ki67 cells was much higher in the PURPL group compared to the vec group (Figure 3(d)). TUNEL signified a much lower level of apoptosis in the PURPL group as opposed to the vec group (Figure 3(e)). These discoveries unraveled that PURPL bolstered GC cell growth in vivo.
Figure 3.

lncRNA PURPL overexpression facilitated GC cell growth AGS cells were transfected along with lncRNA PURPL overexpression plasmid and Vector and then subcutaneously inoculated into the back of the mice on the right and posterior sides to engineer a xenograft tumor model. A. The tumor volume. B. Tumor images displaying the tumor tissues on the 35th day. C. The tumor weight. D. IHC evaluated Ki67, the proliferation indicator. E. TUNEL tracked apoptosis in the tumor tissues. ***P < 0.001 (vs. the vec group), N = 5.

lncRNA PURPL overexpression facilitated GC cell growth AGS cells were transfected along with lncRNA PURPL overexpression plasmid and Vector and then subcutaneously inoculated into the back of the mice on the right and posterior sides to engineer a xenograft tumor model. A. The tumor volume. B. Tumor images displaying the tumor tissues on the 35th day. C. The tumor weight. D. IHC evaluated Ki67, the proliferation indicator. E. TUNEL tracked apoptosis in the tumor tissues. ***P < 0.001 (vs. the vec group), N = 5.

lncRNA PURPL targeted miR-137 and enhanced ZBTB7A expression

To unravel the correlation between lncRNA PURPL and miR-137, we consulted the bioinformatics database ENCORI (http://starbase.sysu.edu.cn/index.php) to figure out the targeted correlation between PURPL and miR-137. It was displayed that miR-137 was a valuable target of PURPL (Figure 4(a)). Dual luciferase activity assay pointed out that miR-137 mimics conspicuously abated the luciferase activity of AGS cells transfected along with PURPL-WT but exerted little influence on that of AGS cells transfected along with PURPL-MT (Figure 4(b), p < 0.05). RT-PCR ascertained miR-137 and ZBTB7A mRNA expressions in the AGS and MKN-45 cell models with PURPL overexpression and the xenograft tumor model. It came to light that in contrast with the vec group, the PURPL group experienced a notable reduction in miR-137 profile and a remarkable rise in ZBTB7A’s expression (Figure 4(c-g), P < 0.05). These data confirmed that PURPL bolstered ZBTB7A’s expression via miR-137 inhibition.
Figure 4

lncRNA PURPL targeted miR-137 and augmented ZBTB7A’s expression The bioinformatics database ENCORI (http://starbase.sysu.edu.cn/index.php) predicted the targeted correlation between PURPL and miR-137. B. Dual luciferase activity assay corroborated that miR-137 was targeted by PURPL. C-D. RT-PCR ascertained miR-137 and ZBTB7A expressions in AGS and MKN-45 cells with PURPL overexpression. E-F. RT-PCR determined miR-137 and ZBTB7A expressions in the tumor tissues. G. Immunofluorescence measured ZBTB7A in the tumor tissues. NSP>0.05, **P < 0.01, ***P < 0.001 (vs. the vec group), N = 3.

lncRNA PURPL targeted miR-137 and augmented ZBTB7A’s expression The bioinformatics database ENCORI (http://starbase.sysu.edu.cn/index.php) predicted the targeted correlation between PURPL and miR-137. B. Dual luciferase activity assay corroborated that miR-137 was targeted by PURPL. C-D. RT-PCR ascertained miR-137 and ZBTB7A expressions in AGS and MKN-45 cells with PURPL overexpression. E-F. RT-PCR determined miR-137 and ZBTB7A expressions in the tumor tissues. G. Immunofluorescence measured ZBTB7A in the tumor tissues. NSP>0.05, **P < 0.01, ***P < 0.001 (vs. the vec group), N = 3.

lncRNA PURPL influenced GC development via miR-137/ZBTB7A axis regulation

To delve into the function of lncRNA PURPL in the miR-137/ZBTB7A axis in the field of gastric cancer, we transfected miR-137 mimics (miR-137) or si-ZBTB7A into the AGS cell model with overexpression of PURPL. RT-PCR confirmed the profiles of PURPL, miR-137, and ZBTB7A in the cells from each group. There was a decline in ZBTB7A and PURPL expressions in the PURPL+miR-137 and PURPLE+si-ZBTB7A groups as opposed to the PURPL1 group (Figure 5(a-c), P < 0.05). Colony formation assay monitored cell proliferation in each group, indicating a distinct reduction in proliferation in the PURPL+miR-137 and PURPL+si-ZBTB7A groups vis-a-vis the PURPL1 group (Figure 5(d), p < 0.05). Transwell tracked cell migration and invasion, unveiling that these activities were considerably augmented in the PURPL group against the VEC group. In contrast with the PURPL1 group, the PURPL+miR-137 and PURPL+si-ZBTB7A groups underwent a remarkable decline in migration and invasion (Figure 5(e), p < 0.05). Flow cytometry reflected a notable decline in the apoptosis rate in the PURPL group as compared with the vec group. In contrast with the PURPL1 group, apoptosis was prominently stepped up in the PURPL+miR-137 group and PURPL+si-ZBTB7A groups (Figure 5(f), p < 0.05). Western blot analyzed apoptosis-concerned proteins, suggesting that by contrast to the PURPL group, the PURPL+miR-137 and PURPL+si-ZBTB7A groups experienced a rise in Bax and Caspase3 expressions and a reduction in Bcl2’s expression (Figure 5(g), p < 0.05). These findings demonstrated that PURPL overexpression suppressed miR-137 expression and enhanced ZBTB7A expression to exert a promoting function in gastric cancer cells.
Figure 5.

lncRNA PURPL influenced GC progression via miR-137/ZBTB7A axis regulation miR-137 mimics (miR-137) or si-ZBTB7A was transfected into AGS cells with PURPL overexpression. A-C. RT-PCR confirmed the profiles of PURPL, miR-137, and ZBTB7A in AGS cells. D. Colony formation assay examined proliferation. E. Transwell monitored cell migration and invasion. F. Flow cytometry determined the apoptosis rate of AGS cells. G. The profiles of apoptosis-concerned proteins Bax, Bcl2, and Caspase3 were figured out through Western blot. ** P < 0.01, ***P < 0.001 (vs. the vec group), ##P < 0.01, ###P < 0.001 (vs. the PURPL group). N = 3.

lncRNA PURPL influenced GC progression via miR-137/ZBTB7A axis regulation miR-137 mimics (miR-137) or si-ZBTB7A was transfected into AGS cells with PURPL overexpression. A-C. RT-PCR confirmed the profiles of PURPL, miR-137, and ZBTB7A in AGS cells. D. Colony formation assay examined proliferation. E. Transwell monitored cell migration and invasion. F. Flow cytometry determined the apoptosis rate of AGS cells. G. The profiles of apoptosis-concerned proteins Bax, Bcl2, and Caspase3 were figured out through Western blot. ** P < 0.01, ***P < 0.001 (vs. the vec group), ##P < 0.01, ###P < 0.001 (vs. the PURPL group). N = 3.

lncRNA PURPL initiated the ZBTB7A/PI3K/Akt /NF-κB pathway ex vivo and in vivo

To better understand the regulatory correlation between PURPL and the PI3K/AKT/NF-κB pathway, we implemented Western blot and immunofluorescence to reveal the profile of the PI3K/AKT/NF-κB axis in the nude mouse tumor tissues. It transpired that PI3K, AKT, and NF-κB phosphorylation were remarkably expanded in the PURPL group (compared to the vec group) (Figure 6(a-b), P < 0.05). Western blot determined PI3K/AKT/NF-κB expression in the AGS cell model with PURPL overexpression, which was transfected along with miR-137 mimics (miR-137) or si-ZBTB7A. In contrast with the vec group, PI3K/AKT/NF-κB phosphorylation was dramatically enhanced in the PURPL group (Figure 6(a-b), P < 0.05). PI3K/AKT/NF-κB activation was markedly dampened in the PURPL+miR-137 and PURPL+si-ZBTB7A groups as compared with the PURPL group (Figure 6(c), p < 0.05). All the discoveries signified that PURPL elevated ZBTB7A’s expression and initiated the PI3K/AKT/NF-κB pathway, hence bringing into full play its substantial cancer-promoting function.
Figure 6.

lncRNA PURPL activated the ZBTB7A/PI3K/AKT/NF-κB pathway Western blot determined the profile of the PI3K/AKT/NF-κB pathway in the nude mouse tumor tissues. B. Immunofluorescence assessed PI3K/AKT/NF-κB in the tumor tissues. C. Western blot evaluated the PI3K/AKT/NF-κB pathway in AGS cells transfected along with PURPL overexpression, miR-137 mimics, or si-ZBTB7A. ***P < 0.001 (vs. the vec group), # P < 0.05 (vs. the PURPL group). N = 3.

lncRNA PURPL activated the ZBTB7A/PI3K/AKT/NF-κB pathway Western blot determined the profile of the PI3K/AKT/NF-κB pathway in the nude mouse tumor tissues. B. Immunofluorescence assessed PI3K/AKT/NF-κB in the tumor tissues. C. Western blot evaluated the PI3K/AKT/NF-κB pathway in AGS cells transfected along with PURPL overexpression, miR-137 mimics, or si-ZBTB7A. ***P < 0.001 (vs. the vec group), # P < 0.05 (vs. the PURPL group). N = 3.

Inhibition of PI3K and NF-κB weakened the cancer-promoting function mediated by lncRNA PURPL

To further corroborate the impact of the PI3K/AKT/NF-κB axis on the carcinogenic function of PURPL, the PI3K inhibitor LY294002 (10 μM, Article number: HY-10108) and the NF-κB inhibitor JSH-23 (30 μM, article number: HY-13982) were administered to the AGS cell model with overexpression of PURPL. Colony formation assay examined cell proliferation. As a result, cell proliferation was evidently stepped up in the PURPL group vis-a-vis the vec group. In contrast with the PURPL group, the PURPL+LY294002 and PURPL+JSH-23 groups experienced a vast reduction in proliferation (Figure 7(a), p < 0.05). Migration and invasion were considerably augmented in the PURPL group as opposed to the vec group. In contrast with the PURPL group, GC cell migration and invasion were distinctly attenuated in the PURPL+LY294002 and PURPL+JSH-23 groups (Figure 7(b), p < 0.05). Flow cytometry tracked cell apoptosis, revealing that in contrast with the PURPL group, the PURPL+LY294002 and PURPL+JSH-23 groups witnessed a notable rise in apoptosis (Figure 7(c), p < 0.05). Western blot evaluated apoptosis-concerned proteins and displayed that there was a rise in Bax and Caspase3 expressions and a decline in Bcl2’s expression in the PURPL+LY294002 and PURPL+JSH-23 groups as compared with the PURPL group (Figure 7(d), p < 0.05). Western blot investigated the protein profile of the PI3K/AKT/NF-κB pathway. By contrast to the PURPL group, PI3K, AKT, and NF-κB phosphorylation were markedly abated in the PURPL+LY294002 group and the PURPL+JSH-23 group (Figure 7(e), p < 0.05). RT-PCR unveiled that ZBTB7A knockdown or PI3K or NF-κB inhibition culminated in down-regulated lncRNA PURPL and up-regulated miR-137 (Figure 8(a-f)). Thus, lncRNA PURPL mediated GC cell proliferation, migration, and invasion via the miR-137-ZBTB7A-PI3K/AKT/NF-Κb pathway.
Figure 7.

PI3K and NF-κB inhibition impaired the lncRNA PURPL-mediated cancer-promoting function The PI3K inhibitor LY294002 (Cat.No: HY-10108) (10 μM) and the NF-κB inhibitor JSH-23 (Cat.No: HY-13982) (30 μM) were administered to the AGS model with PURPL overexpression, respectively. A. Colony formation assay examined cell proliferation in each group. B. Transwell analyzed cell migration and invasion. C. Flow cytometry determined the apoptosis rate of AGS cells. D. Western blot confirmed the profiles of apoptosis-concerned cells Bax, Bcl2, and Caspase3. E. Western blot verified the protein profile of the PI3K/AKT/NF-κB pathway. **P < 0.01, ***, P < 0.001 (vs. the vec group), # P < 0.05, ## P < 0.01, ### P < 0.001 (vs. the PURPL group), N = 3.

Figure 8.

Down-regulation of the ZBTB7A/PI3K/AKT/NF-κB pathway mitigated PURPL’s level. si-ZBTB7A was transfected into AGS cells. A-B. RT-PCR examined PURPL and miR-137. C-F. LY294002 (10 μM) and JSH-23 (30 μM) were given to AGS cells for PI3K or NF-κB inhibition. RT-PCR assessed PURPL and miR-137. ***P < 0.001. N = 3.

PI3K and NF-κB inhibition impaired the lncRNA PURPL-mediated cancer-promoting function The PI3K inhibitor LY294002 (Cat.No: HY-10108) (10 μM) and the NF-κB inhibitor JSH-23 (Cat.No: HY-13982) (30 μM) were administered to the AGS model with PURPL overexpression, respectively. A. Colony formation assay examined cell proliferation in each group. B. Transwell analyzed cell migration and invasion. C. Flow cytometry determined the apoptosis rate of AGS cells. D. Western blot confirmed the profiles of apoptosis-concerned cells Bax, Bcl2, and Caspase3. E. Western blot verified the protein profile of the PI3K/AKT/NF-κB pathway. **P < 0.01, ***, P < 0.001 (vs. the vec group), # P < 0.05, ## P < 0.01, ### P < 0.001 (vs. the PURPL group), N = 3. Down-regulation of the ZBTB7A/PI3K/AKT/NF-κB pathway mitigated PURPL’s level. si-ZBTB7A was transfected into AGS cells. A-B. RT-PCR examined PURPL and miR-137. C-F. LY294002 (10 μM) and JSH-23 (30 μM) were given to AGS cells for PI3K or NF-κB inhibition. RT-PCR assessed PURPL and miR-137. ***P < 0.001. N = 3.

Discussion

Gastric cancer, a malignant tumor, is accompanied by extremely high clinical occurrence and mortality rates and particularly poor prognosis [37]. With constant exploration of genetic technologies, it has been disclosed that GC occurrence and development are correlated with gene mutations, chromosomal aberrations, and epigenetic alterations [38,39]. Here, we discovered that GC development bore a relation to the aberrant profile of lncRNA PURPL. Highly-expressed PURPL hampered miR-137, bolstered ZBTB7A, initiated the PI3K/AKT/NF-κB pathway, and elicited GC cell proliferation, migration, and apoptosis inhibition (Figure 9).
Figure 9.

Schematic diagram of PURPL-miR-137-ZBTB7A/PI3K/AKT/NF-κB axis in GC development.

Schematic diagram of PURPL-miR-137-ZBTB7A/PI3K/AKT/NF-κB axis in GC development. lncRNA dysregulation has been demonstrated to have something to do with GC occurrence and development by a multitude of studies [40]. The profile of lncRNA maternally expressed 3 (MEG3) is much lower in GC tissues than in normal adjacent tissues, and the P53 signaling pathway initiated by lncRNA MEG3 overexpression curbs GC proliferation and metastasis [41]. Overexpression of lncRNA PVT1 activates the STAT3/VEGFA pathway, sparks the angiogenesis in tumor cells, and vigorously boosts GC progression in vitro and in vivo [42]. Impressively, emerging lncRNAs have been found with clinical application values in tumors. For example, lncRNA scores predict the overall survival of tumor patients and they have the potential in immunotherapy prediction [43]. Another study revealed that lncRNA TINCR rs2288947 A > G con predict increased bladder cancer risk and rs8113645 C > T is associated with decreased susceptibility [44]. However, there seems to be a long way to go for lncRNA to be used in clinical tumor treatment. One of the main reasons is the diversity of lncrna targets and the complexity of functions. Different lncRNAs embody varied effects in gastric cancer due to diverse lncRNA molecules leading to diverse downstream target genes. lncRNA PURPL, a proto-oncogene, exerts an essential cancer-promoting function in colorectal cancer and hepatocellular carcinoma [13,45]. PURPL expression is evidently leveled up in GC tissues as compared with normal adjacent tissues, the profile level of PURPL positively correlates with the tumor size and pathological grade of the cancer, and it functions as an underlying molecular marker for GC diagnosis [46]. PURPL overexpression suffocates p53 activation, elevates the profile of Bcl2, elicits EMT, and facilitates GC development. Curcumin analog DA 0324 can lower the profile of PURPL and impede malignant GC progression [47]. The carcinogenic properties of PURPL in gastric cancer have been verified. The study, aligned to earlier works, also revealed the high profile of lncRNA PURPL in GC tissues and cells. Overexpression of PURPL stepped up GC cells’ proliferation, migration, and invasion, curbed their apoptosis, and prominently triggered GC cell growth and proliferation in vivo and ex vivo. lncRNAs can influence GC cell proliferation, growth, migration, invasion, and apoptosis via miRNA modulation [48]. miR-137, a member of the miRNA family, has been confirmed to function as a tumor suppressor and present an abnormal expression in multiple cancers [49]. The profile of miR-137 is notably lower in GC tumor tissues than normal adjacent tissues. miR-137 overexpression restrains KLF 12 and Myo1c expressions, thus impeding the proliferation, migration, and inheritance of GC cells BGC-823 and SGC-7901 and culminating in apoptosis [50]. miR-137 is targeted by lncRNA NCK1-AS1. Low NCK1-AS1 expression augments the profile of miR-137, reduces that of NUP 43, and represses GC cell proliferation, migration, and invasion [51]. The inhibitory impact of miR-137 on GC has been substantiated by the above findings. Here, we discovered that lncRNA PURPL targeted miR-137 and stymied its profile, therefore initiating the PI3K/AKT/NF-κB pathway and eliciting malignant GC development. The anti-tumor function of miR-137 in gastric cancer is in lockstep with what the previous works have found. As an essential transcriptional inhibitor, ZBTB7A presents an abnormal expression in non-small cell lung cancer, breast cancer, and other cancers [52,53]. For instance, considering that ZBTB7A can exert an oncogenic function in colorectal cancer patients, it can be taken as an underlying biomarker and therapeutic target for colorectal cancer [54]. Moreover, its high profile is linked to a poor prognosis in GC patients. miR-100 targets and suppresses ZBTB7A’s expression, thus cramping tumor cell migration and invasion [55]. Nevertheless, there is a different opinion that overexpression of ZBTB7A contributes to GC cells’ cycle arrest, curbs their migration, and steps up their apoptosis, and it displays a remarkable tumor-suppressing function in the context of GC [56]. ZBTB7A produces distinct effects in the cancer. That’s because it exerts an impact on GC cells via different mechanisms. PI3K/AKT/NF-κB, also a typical signaling pathway in tumors, is modulated by diverse molecules like lncRNAs, miRNAs, and proteins. It exhibits an aberrant expression in a multitude of tumor cells and correlates with cancer cell proliferation, migration, and invasion [57]. lncRNA DANCR can drive up the transcriptional level, initiate the PI3K/AKT/NF-κB pathway, mediate glioma cells’ resistance to cisplatin, and hinder cell apoptosis via combining the profiles of umpteen miRNAs like miR-33a-5p, miR-33b-5p, miR-1-3p, miR-206, and miR-613 in a competitive manner [58]. Celastrol drives down miR-21’s expression, and low miR-21 expression curbs the activation of the pathway, hence restraining GC progression [59]. Here, we uncovered that ZBTB7A modulated tumor development through its influence on various typical signaling pathways. It vigorously initiated PI3K/AKT/NF-κB phosphorylation in GC, exhibiting an outstanding carcinogenic function. As displayed by our experiments, lncRNA PURPL targeted and hampered miR-137, elevated the profile of ZBTB7A, activated the PI3K/AKT/NF-κB pathway, and stepped up GC occurrence and development. Inhibition of PI3K or NF-κB could conspicuously mitigate lncRNA PURPL-mediated cancer-promoting effects and lncRNA PURPL expression. However, several limitations need to be addressed in our future studies: 1) The specific mechanism of NF-κB on lncRNA PURPL expression should be confirmed; 2) The function of lncRNA PURPL-miR-137-ZBTB7A in GC progression should be verified in animal models; 3) More clinical samples need to be collected for evaluating the significance of lncRNA PURPL-miR-137-ZBTB7A on GC diagnosis and prognostic evaluation.

Conclusion

Taken together, our work has verified that the lncRNA PURPL-miR-137-ZBTB7A-PI3K-AKT-NF-κB feedback loop can vigorously boost the malignant progression of gastric cancer (Figure 9). lncRNA PURPL targets miR-137, drives up ZBTB7A expression, and initiates PI3K-AKT-NF-κB pathway phosphorylation. PI3K or NF-κB inhibition considerably weakens the cancer-promoting function mediated by lncRNA PURPL. Our efforts have discovered a novel feedback loop, which hints that lncRNA PURPL may be an efficacious target for GC treatment.
TargetForward (5ʹ-3ʹ)Reverse (5ʹ-3ʹ)
PURPLAGACAAGCCCTGGGAAGTTTCAAACACGGGGCTTGAGAAA
miR-137GCTCAGCGAGCAGCAAGAGTGGCAATAAGAGCGAAACACCA
ZBTB7AGTTGCAGCCGTCTTTCTTGAACAAGCTGAAGGTGCACATG
U6GCTTCGGCAGCACATATACTAAAATCGCTTCACGAATTTGCGTGTCAT
GAPDHAGGCCGGTGCTGAGTATGTCTGCCTGCTTCACCACCTTCT
  59 in total

1.  lncRNA TINCR SNPs and Expression Levels Are Associated with Bladder Cancer Susceptibility.

Authors:  Chuanbing Xu; Min Liu; Dongsheng Jia; Tingting Tao; Dongfang Hao
Journal:  Genet Test Mol Biomarkers       Date:  2020-12-28

Review 2.  Gastric cancer: descriptive epidemiology, risk factors, screening, and prevention.

Authors:  Parisa Karimi; Farhad Islami; Sharmila Anandasabapathy; Neal D Freedman; Farin Kamangar
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2014-03-11       Impact factor: 4.254

Review 3.  Emerging role of ZBTB7A as an oncogenic driver and transcriptional repressor.

Authors:  Sanjay Gupta; Atul Kumar Singh; Kumari Sunita Prajapati; Prem Prakash Kushwaha; Mohd Shuaib; Shashank Kumar
Journal:  Cancer Lett       Date:  2020-04-26       Impact factor: 8.679

4.  Overexpression of PURPL and downregulation of NONHSAT062994 as potential biomarkers in gastric cancer.

Authors:  Heresh Moridi; Jamshid Karimi; Heidar Tavilani; Iraj Khodadadi; Amir Nader Emami Razavi
Journal:  Life Sci       Date:  2019-10-10       Impact factor: 5.037

5.  Celastrol induces apoptosis of gastric cancer cells by miR-21 inhibiting PI3K/Akt-NF-κB signaling pathway.

Authors:  Min Sha; Jun Ye; Li-xin Zhang; Zheng-yun Luan; Ya-bao Chen; Jun-xing Huang
Journal:  Pharmacology       Date:  2014-01-15       Impact factor: 2.547

6.  MiR-137-3p Inhibits Colorectal Cancer Cell Migration by Regulating a KDM1A-Dependent Epithelial-Mesenchymal Transition.

Authors:  Xiaoling Ding; Jie Zhang; Ziqin Feng; Qianru Tang; Xiaorong Zhou
Journal:  Dig Dis Sci       Date:  2020-08-04       Impact factor: 3.199

Review 7.  Progress in the treatment of advanced gastric cancer.

Authors:  Zheyu Song; Yuanyu Wu; Jiebing Yang; Dingquan Yang; Xuedong Fang
Journal:  Tumour Biol       Date:  2017-07

8.  Trends in the development of miRNA bioinformatics tools.

Authors:  Liang Chen; Liisa Heikkinen; Changliang Wang; Yang Yang; Huiyan Sun; Garry Wong
Journal:  Brief Bioinform       Date:  2019-09-27       Impact factor: 11.622

9.  LINC00528 regulates myocardial infarction by targeting the miR-143-3p/COX-2 axis.

Authors:  Ketong Liu; Di Zhao; Di Wang
Journal:  Bioengineered       Date:  2020-12       Impact factor: 3.269

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.