| Literature DB >> 35003217 |
Xiangyu Zhang1,2, Cuixia Zhang1,2, Chao Yang1,2, Liangde Kuang1,2, Jie Zheng1,2, Li Tang1,2, Min Lei1,2, Congyan Li1,2, Yongjun Ren1,2, Zhiqiang Guo1,2, Yang Ji1,2, Xiaodong Deng1, Dengping Huang1,2, Gaofu Wang3, Xiaohong Xie1,2.
Abstract
Due to the dietetic properties and remarkable nutritive value of rabbit meat, its industry is increasing rapidly. However, the association between circular RNAs, microRNAs, and proteins and muscle fiber type, and meat quality of rabbit is still unknown. Here, using deep sequencing and iTRAQ proteomics technologies we first identified 3159 circRNAs, 356 miRNAs, and 755 proteins in the longissimus dorsi tissues from Sichuan white (SCWrabs) and Germany great line ZIKA rabbits (ZIKArabs). Next, we identified 267 circRNAs, 3 miRNAs, and 29 proteins differentially expressed in the muscle tissues of SCWrabs and ZIKArabs. Interaction network analysis revealed some key regulation relationships between noncoding RNAs and proteins that might be associated with the muscle fiber type and meat quality of rabbit. Further, miRNA isoforms and gene variants identified in SCWrabs and ZIKArabs revealed some pathways and biological processes related to the muscle development. This is the first study of noncoding RNA and protein profiles for the two rabbit breeds. It provides a valuable resource for future studies in rabbits and will improve our understanding of the molecular regulation mechanisms in the muscle development of livestock. More importantly, the output of our study will benefit the researchers and producers in the rabbit breeding program.Entities:
Keywords: circular RNA; longissimus dorsi; miRNA; muscle; rabbit
Year: 2021 PMID: 35003217 PMCID: PMC8740122 DOI: 10.3389/fgene.2021.777232
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
FIGURE 1circRNAs identified in the muscle tissue of SCWrabs and ZIKArabs. (A) Distribution of circRNAs identified in the rabbit chromosomes. (B) Length distribution of circRNAs identified in this study. (C) Venn diagram of circRNAs identified in the muscle tissues of SCWrabs and ZIKArabs. (D) Volcano plot showing differentially expressed circRNAs in the muscle tissues of SCWrabs and ZIKArabs. (E) Functional annotation of the host genes for differentially expressed circRNAs.
FIGURE 2Gene expression profiles and miRNAs identified in the muscle tissues of SCWrabs and ZIKArabs. (A) Venn diagram of genes identified in the muscle tissues of SCWrabs and ZIKArabs. (B) Volcano plot of differentially expressed genes in the muscle tissues of SCWrabs and ZIKArabs. (C) Distribution of miRNAs identified in the chromosomes of rabbit. (D) Base bias of the mature miRNAs identified in the muscle tissues of SCWrabs and ZIKArabs. (E) Length distribution of miRNAs identified in this study. (F) Comparison of target genes for the differentially expressed miRNAs.
Significant gene groups differentially expressed in the muscle tissues of SCWrabs and ZIKArabs.
| GeneID | Log2FC |
| FDR | Regulation | Gene Name | Description |
|---|---|---|---|---|---|---|
| ENSOCUG00000005076 | 1.48 | 1.07E-04 | 4.93E-03 | UP | MYLK4 | Myosin light chain kinase family member 4 |
| ENSOCUG00000017368 | 1.29 | 7.30E-04 | 2.29E-02 | UP | MYL6B | Myosin light chain 6B |
| ENSOCUG00000010207 | 1.59 | 3.38E-05 | 1.88E-03 | UP | MYH13 | Myosin heavy chain 13 |
| ENSOCUG00000029652 | 2.13 | 4.62E-08 | 5.15E-06 | UP | MYH4 | Myosin heavy chain 4 |
| ENSOCUG00000023743 | −2.94 | 2.85E-13 | 8.37E-11 | DOWN | Heat shock 70 kda protein 1B | |
| ENSOCUG00000025112 | −3.24 | 1.94E-15 | 7.53E-13 | DOWN | Heat shock 70 kda protein 1B | |
| ENSOCUG00000001280 | −1.82 | 2.32E-06 | 1.76E-04 | DOWN | HSP90AA1 | Heat shock protein 90 alpha family class A member 1 |
| ENSOCUG00000015533 | −1.25 | 1.01E-03 | 3.00E-02 | DOWN | HSPA8 | Heat shock protein family A (Hsp70) member 8 |
| ENSOCUG00000004833 | −1.98 | 3.45E-07 | 3.23E-05 | DOWN | DNAJA1 | DNAJ heat shock protein family (Hsp40) member A1 |
| ENSOCUG00000014773 | −2.06 | 1.19E-07 | 1.24E-05 | DOWN | HSPH1 | Heat shock protein family H (Hsp110) member 1 |
| ENSOCUG00000012690 | −1.68 | 1.26E-05 | 7.93E-04 | DOWN | Heat shock protein family B (small) member 1 | |
| ENSOCUG00000027940 | −1.91 | 1.01E-06 | 8.53E-05 | DOWN | HSPA4L | Heat shock protein family A (Hsp70) member 4 like |
| ENSOCUG00000021817 | −4.70 | 4.68E-27 | 8.05E-24 | DOWN | Heat shock 70 kda protein 1B-like | |
| ENSOCUG00000014459 | −1.45 | 2.72E-04 | 1.06E-02 | DOWN | Histone H3.1 | |
| ENSOCUG00000024086 | −2.21 | 3.07E-07 | 2.90E-05 | DOWN | Histone H2A type 1 | |
| ENSOCUG00000023129 | −1.21 | 1.79E-03 | 4.67E-02 | DOWN | Histone H2A type 1-E | |
| ENSOCUG00000026810 | −2.03 | 2.45E-05 | 1.41E-03 | DOWN | Histone H2B type 1 | |
| ENSOCUG00000027315 | −1.54 | 1.09E-04 | 5.00E-03 | DOWN | Histone H3 | |
| ENSOCUG00000027038 | −2.70 | 5.66E-09 | 7.58E-07 | DOWN | Histone H2A type 1 | |
| ENSOCUG00000025069 | −1.70 | 2.01E-05 | 1.19E-03 | DOWN | Histone H2A type 1-E | |
| ENSOCUG00000026226 | −1.42 | 9.86E-04 | 2.94E-02 | DOWN | Histone H2A type 1-E | |
| ENSOCUG00000026771 | −1.48 | 3.24E-04 | 1.21E-02 | DOWN | HIST1H2AM | Histone H2A type 1 |
| ENSOCUG00000025038 | −1.96 | 3.53E-05 | 1.94E-03 | DOWN | Histone H3.1 | |
| ENSOCUG00000014458 | −2.01 | 1.29E-06 | 1.06E-04 | DOWN | Histone H2A type 1-E | |
| ENSOCUG00000025297 | −5.09 | 2.55E-15 | 9.32E-13 | DOWN | Histone H2A type 1 | |
| ENSOCUG00000027227 | −1.46 | 2.73E-04 | 1.06E-02 | DOWN | HIST1H2BB | Histone H2B type 1-B |
| ENSOCUG00000021035 | −2.85 | 3.03E-11 | 6.41E-09 | DOWN | Histone H2B type 1 |
Differentially expressed miRNAs in the muscle tissues of SCWrabs and ZIKArabs.
| miRNA | edgeR values | Target number | Gene | Log2FC | FDR | Gene_symbol | Description |
|---|---|---|---|---|---|---|---|
| ocu-miR-182-5p | Log2FC = -1.40, | 2124 | ENSOCUG00000010207 | 1.59 | 1.88E-03 | MYH13 | Myosin heavy chain 13 |
| ENSOCUG00000006775 | 2.28 | 1.12E-06 | ANO2 | Anoctamin 2 | |||
| ENSOCUG00000010659 | 1.51 | 5.00E-03 | ADAM23 | ADAM metallopeptidase domain 23 | |||
| ENSOCUG00000007700 | 1.76 | 5.48E-04 | GDAP1 | Ganglioside induced differentiation associated protein 1 | |||
| ENSOCUG00000003254 | 1.33 | 1.74E-02 | CDKL2 | Cyclin dependent kinase like 2 | |||
| ENSOCUG00000009279 | 1.29 | 2.15E-02 | ABCA1 | ATP binding cassette subfamily A member 1 | |||
| ENSOCUG00000015667 | 1.98 | 4.83E-05 | SH3RF2 | SH3 domain containing ring finger 2 | |||
| ocu-miR-146b-5p | Log2FC = -1.23, | 2068 | ENSOCUG00000006775 | 2.28 | 1.12E-06 | ANO2 | Anoctamin 2 |
| ENSOCUG00000007999 | 1.65 | 1.03E-03 | DUSP1 | Dual specificity phosphatase 1 | |||
| ENSOCUG00000009279 | 1.29 | 2.15E-02 | ABCA1 | ATP binding cassette subfamily A member 1 | |||
| ENSOCUG00000015003 | 1.22 | 4.34E-02 | MFSD8 | Major facilitator superfamily domain containing 8 | |||
| ENSOCUG00000015667 | 1.98 | 4.83E-05 | SH3RF2 | SH3 domain containing ring finger 2 | |||
| ocu-N-miR-10-5p | Log2FC = -1.01, | 4694 | ENSOCUG00000005076 | 1.48 | 4.93E-03 | MYLK4 | Myosin light chain kinase family member 4 |
| ENSOCUG00000017507 | 1.49 | 5.69E-03 | PAX3 | Paired box 3 | |||
| ENSOCUG00000027746 | 3.68 | 3.34E-15 | |||||
| ENSOCUG00000011746 | 1.43 | 7.59E-03 | NR4A1 | Nuclear receptor subfamily 4 group A member 1 | |||
| ENSOCUG00000007999 | 1.65 | 1.03E-03 | DUSP1 | Dual specificity phosphatase 1 | |||
| ENSOCUG00000015003 | 1.22 | 4.34E-02 | MFSD8 | Major facilitator superfamily domain containing 8 | |||
| ENSOCUG00000015667 | 1.98 | 4.83E-05 | SH3RF2 | SH3 domain containing ring finger 2 | |||
| ENSOCUG00000023102 | 2.17 | 3.36E-06 | LOC100349173 | Uncharacterized protein c15orf52 homolog | |||
| ENSOCUG00000010207 | 1.59 | 1.88E-03 | MYH13 | Myosin heavy chain 13 | |||
| ENSOCUG00000029652 | 2.13 | 5.15E-06 | MYH4 | Myosin heavy chain 4 | |||
| ENSOCUG00000008198 | 1.29 | 2.21E-02 | IFFO1 | Intermediate filament family orphan 1 |
FIGURE 3iTRAQ proteomics identified differentially expressed proteins in the longissimus muscle tissues of SCWrabs and ZIKArabs. (A) Length distribution of peptides detected in the longissimus muscle tissues by iTRAQ. (B) Distribution of protein mass. (C) Top highly expressed proteins in the longissimus muscle tissue of rabbits. (D) Volcano plot of the differentially expressed proteins in the muscle tissues of SCWrabs and ZIKArabs. (E) KEGG pathway enrichment analysis for the differentially expressed proteins.
Differentially expressed proteins in the longissimus muscle tissues of SCWrabs and ZIKArabs.
| ProteinID | Log2FC |
| Regulation | Gene name | Description |
|---|---|---|---|---|---|
| ENSOCUP00000021805.1 | −0.393 | 0.043 | down | AAMDC | Adipogenesis associated Mth938 domain containing |
| ENSOCUP00000020925.2 | −0.667 | 0.048 | down | AKR1B10 | Aldo-keto reductase family 1 member B10 |
| ENSOCUP00000006694.2 | −0.197 | 0.050 | down | CTNNA1 | Catenin alpha 1 |
| ENSOCUP00000014440.2 | −0.383 | 0.011 | down | CYB5R1 | NADH-cytochrome b5 reductase 1 |
| ENSOCUP00000010958.3 | −0.412 | 0.015 | down | HSPD1 | Heat shock protein family D (Hsp60) member 1 |
| ENSOCUP00000012421.1 | −0.180 | 0.019 | down | LOC100348835 | Histone H1.4 |
| ENSOCUP00000007190.2 | −0.302 | 0.014 | down | LOC100354435 | Heat shock 70 kDa protein 1B |
| ENSOCUP00000001099.3 | −0.157 | 0.034 | down | NNT | Nicotinamide nucleotide transhydrogenase |
| ENSOCUP00000005290.3 | −0.235 | 0.031 | down | USP36 | Ubiquitin specific peptidase 36 |
| ENSOCUP00000011737.2 | −0.179 | 0.020 | down | ||
| ENSOCUP00000002957.2 | 0.146 | 0.043 | Up | COPS4 | COP9 signalosome subunit 4 |
| ENSOCUP00000009625.2 | 0.302 | 0.001 | Up | COPS7A | COP9 signalosome subunit 7A |
| ENSOCUP00000021470.1 | 0.251 | 0.037 | Up | DHRS7B | Dehydrogenase/reductase 7B |
| ENSOCUP00000005141.2 | 0.223 | 0.012 | Up | GPX1 | Glutathione peroxidase 1 |
| ENSOCUP00000007030.2 | 0.243 | 0.045 | Up | H2AFV | H2A histone family, member V |
| ENSOCUP00000010917.2 | 0.311 | 0.005 | Up | HSPB1 | Heat shock protein family B (small) member 1 |
| ENSOCUP00000021175.1 | 0.382 | 0.038 | Up | LOC108175352 | 60S ribosomal protein L17 |
| ENSOCUP00000013763.2 | 0.201 | 0.009 | Up | LRRC20 | Leucine rich repeat containing 20 |
| ENSOCUP00000023874.2 | 0.812 | 0.004 | Up | MYH13 | Myosin heavy chain 13 |
| ENSOCUP00000001968.2 | 0.341 | 0.021 | Up | MYH7B | Myosin heavy chain 7B |
| ENSOCUP00000008830.2 | 0.321 | 0.007 | Up | MYH8 | Myosin-8 |
| ENSOCUP00000021074.2 | 0.171 | 0.004 | Up | PPP2R2A | Protein phosphatase 2 regulatory subunit Balpha |
| ENSOCUP00000006889.2 | 0.215 | 0.001 | Up | PSMB1 | Proteasome subunit beta 1 |
| ENSOCUP00000003741.2 | 0.152 | 0.013 | Up | PSMC5 | Proteasome 26S subunit, Atpase 5 |
| ENSOCUP00000017814.1 | 0.165 | 0.045 | Up | SHMT1 | Serine hydroxymethyltransferase 1 |
| ENSOCUP00000010672.2 | 0.466 | 0.011 | Up | TMEM38A | Transmembrane protein 38A |
| ENSOCUP00000022564.1 | 0.267 | 0.017 | Up | YWHAG | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma |
| ENSOCUP00000021670.1 | 0.297 | 0.003 | Up | ||
| ENSOCUP00000025416.1 | 0.299 | 0.033 | Up |
FIGURE 4Interaction network of differentially expressed circRNAs, miRNAs, their target genes, and binding proteins.
miRNA isoforms identified in the muscle tissues of SCWrabs and ZIKArabs.
| miRNA | SCWrabs | Count | ZIKArabs | Count |
|---|---|---|---|---|
| ocu-miR-29a-3p | CTAGCACCATTTGAAATCAGTG | 96,129,85 | CTAGCACCATTTGAAATCAGT | 73,85,90 |
| ocu-miR-29d-3p | CTAGCACCATTTGAAATCAGTG | 96,129,85 | CTAGCACCATTTGAAATCAGT | 73,85,90 |
| ocu-miR-340b-3p | TCCGTCTCAGTTACTTTATAGCC | 1,6,9 | TCCGTCTCAGTTACTTTATAGC | 6,8,5 |
| ocu-miR-411-5p | ATAGTAGACCGTATAGCGTACG | 117,244,252 | TAGTAGACCGTATAGCGTACG | 119,318,365 |
| ocu-miR-487-3p | AATCGTACAGGGTCATCCACTT | 13,48,48 | AATCGTACAGGGTCATCCACT | 26,35,49 |
| ocu-miR-532-3p | CCTCCCACACCCAAGGCTTGCA | 54,81,78 | CCTCCCACACCCAAGGCTTGC | 42,80,98 |
| ocu-N-miR-26-5p | - | 0,0,0 | TTGACCTATGAAATGACAGATG | 6,7,8 |
| ocu-N-miR-48-5p | TTGCTCTCTCTCTAACTCTGT | 41,66,43 | TTGCTCTCTCTCTAACTCTGTC | 32,92,59 |
| ocu-N-miR-79-3p | TCAGCCCCTGGGGTAGTTCTGA | 14,22,30 | TCAGCCCCTGGGGTAGTTCTG | 17,24,60 |
| ocu-N-miR-80-3p | TCAGCCCCTGGGGTAGTTCTGA | 14,22,30 | TCAGCCCCTGGGGTAGTTCTG | 17,24,60 |
Raw read counts of the miRNA sequence in the three biological replicates.
FIGURE 5Gene variants identified in the muscle tissues of SCWrabs and ZIKArabs. (A) Number of total variants and exonic variants identified in the muscle tissues of SCWrabs and ZIKArabs. (B) Number of mutation events in the top 20 genes. (C) Functional annotation for the mutated genes specifically identified in the muscle tissues of SCWrabs and ZIKArabs. Values in the blocks represent the numbers of genes involved in the pathways and processes.