| Literature DB >> 34993201 |
Sreeja Kumari Dhanya1,2, Gaiti Hasan1.
Abstract
Septins are cytoskeletal proteins that can assemble to form heteromeric filamentous complexes and regulate a range of membrane-associated cellular functions. SEPT7, a member of the septin family, functions as a negative regulator of the plasma membrane-localized store-operated Ca2+ entry (SOCE) channel, Orai in Drosophila neurons, and in human neural progenitor cells. Knockdown of STIM, a Ca2+ sensor in the endoplasmic reticulum (ER) and an integral component of SOCE, leads to flight deficits in Drosophila that can be rescued by partial loss of SEPT7 in neurons. Here, we tested the effect of reducing and removing SEPT7 in mouse Purkinje neurons (PNs) with the loss of STIM1. Mice with the complete knockout of STIM1 in PNs exhibit several age-dependent changes. These include altered gene expression in PNs, which correlates with increased synapses between climbing fiber (CF) axons and Purkinje neuron (PN) dendrites and a reduced ability to learn a motor coordination task. Removal of either one or two copies of the SEPT7 gene in STIM1 KO PNs restored the expression of a subset of genes, including several in the category of neuron projection development. Importantly, the rescue of gene expression in these animals is accompanied by normal CF-PN innervation and an improved ability to learn a motor coordination task in aging mice. Thus, the loss of SEPT7 in PNs further modulates cerebellar circuit function in STIM1 KO animals. Our findings are relevant in the context of identifying SEPT7 as a putative therapeutic target for various neurodegenerative diseases caused by reduced intracellular Ca2+ signaling.Entities:
Keywords: Ca2+ signaling; SOCE; VGLUT2; climbing fibers; gene expression; neurodegenerative disorders; synaptic function
Year: 2021 PMID: 34993201 PMCID: PMC8724567 DOI: 10.3389/fcell.2021.794807
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
Primers used for genotyping transgenic mice and for quantitative real-time PCR.
| Gene | Forward (5′>3′) | Reverse (5′>3′) |
|---|---|---|
|
| CGATGGTCTCACGGTCTCTAGTTTC | GGCTCTGCTGACCTGGAACTATAGTG |
|
| GCCGAAATTGCCAGGATCAG | AGCCACCAGCTTGCATGATC |
|
| CTTTGCACATATGACTAAGC | GGTATAGGGGACTTTGGGG |
|
| CCAGGCCAGAACCCAGAAAG | CCCAGGTCGTTTCTGCATTC |
|
| ACAACTGGACTGTGGATGAGG | TGGTTACTGCTAGCCTTGGC |
|
| TGCTGGAAGGCTATGACAACC | GTCTGGCGGAAGAAAACATCC |
|
| ATGGGGACGGCAAGATTGG | GCGAGAAGGACTGAGATGGG |
|
| CGTTCTTCCTTCCTTCGCTCG | TTCCTTGGTTGTGATGGTGCC |
|
| ACCAAGATGAAGACACGCCC | TTCCGTTCACATATCCTGGGG |
|
| CTGCCATCTAGACCTGACTCC | ACGAGATCCTTGACCTTGCC |
|
| AGCCAGGTTGAAGGTATCCC | TGGCTGCTCTGATAATCCGG |
|
| GGACCGCAGTGTTAAAAAGACC | TCTGCTGCCATTCTTCTCCG |
|
| CTGCCGACATGATTCTGCTGG | AGGAAGGGTGTGATCTCAGGG |
|
| TGAAGGGGAACAGAACGAGC | AGGCCGATTCTTTGTTTCTGC |
|
| CCTGTGGCCTGGTTTTTATC | GTGCCCGGTGTTAGAGAATG |
|
| AGCCCAACGTCATCCCTAAC | AGTCGTCTTCTCCTGTAGTCC |
|
| GATGTCTTCCACCAGTACTCCG | AGCGTCTCCATCACTTTGTCC |
|
| CTTCCTGTGATGTGAGGGCG | CAAAAGTTGGAGTCGAGCGC |
|
| GGCTCCTCCTACAACTATGGG | GGAGGGAGAAAAGGTTAGCGG |
|
| CCCGTCTCGTTGCATTCTCC | GTCATGTTGGGAGGAGGACC |
|
| CAAGAGGAACATTCAGAAGTGC | CCTGAGAGACCGGTGATATCC |
|
| TGGTTTTGCTGAGCCCTATCC | CCCCTACCATCTCCTGTTTGC |
|
| CTTTGGCATTGTGGAAGGGC | TGCAGGGATGATGTTCTGGG |
Sequences of primers used for standard PCR for genotyping transgenic mice and for quantitative real-time PCR for all sets of genes are listed in the table. Standard PCR is carried out on genomic DNA extracted from tail clippings of transgenic mice. The PCR product length of the wild-type STIM1 gene and the floxed STIM1 gene are 348 bp and 399 bp, respectively (Oh-hora et al., 2008). The presence of Cre is identified by a PCR product length of 421 bp (Hartmann et al., 2014). The wild-type SEPT7 gene and the floxed SEPT7 gene were confirmed by PCR product lengths of 151 bp and 197 bp, respectively (Menon et al., 2014). All primers used for qPCR were designed using primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/). Pcp2, Purkinje cell protein 2; Stim1, stromal interaction molecule 1; Gabra6, gamma-aminobutyric acid type A receptor subunit alpha 6). Pvalb, parvalbumin; Calm1,calmodulin 1; Dlg4, discs large homolog 4; Robo2, roundabout guidance receptor 2; Map4, microtubule-associated protein 4; Gigyf2, GRB10-interacting GYF protein 2; Atp1a3, Na+/K+-ATPase transporting subunit alpha 3; Itpr1, inositol 1,4,5-trisphosphate receptor 1, Orai3—Orai3; Casq2, calsequestrin 2, S100b—S100B; Cacng5, calcium voltage-gated channel auxiliary subunit gamma 5; Kctd17, potassium channel tetramerization domain containing 17; Vamp1, vesicle-associated membrane protein 1; Syt11, synaptotagmin 11; Setd6, SET domain containing 6; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.
FIGURE 1Generation of STIM1–SEPT7 double knockout mice. (A) (Top) Schematic diagram with exon 2 of STIM1 gene flanked by loxP recombination sites (red triangles). Cre-mediated recombination will result in the deletion of exon 2. (Middle) Schematic diagram with exon 4 of SEPT7 gene flanked by loxP recombination sites (red triangles). (Bottom) Schematic diagram showing insertion of Cre-recombinase cDNA into the exon 4 of PCP2 gene. Primers used for genotyping are indicated by arrows (FP, forward primer and RP, reverse primer). (B) Triple transgenic mouse strain STIM1 ; SEPT7 ; PCP (STIM1 ; SEPT7 ) was generated by cross-breeding homozygous double transgenic STIM1 ; SEPT7 mice with STIM1 ; PCP2-Cre mice to generate STIM1 and SEPT7 double knockout mice. (C) Agarose gel showing the genotyping of STIM1–SEPT7 double knockout mice. PCRs of genomic DNA from STIM1 ; SEPT7 ; PCP (STIM1 ; SEPT7 ) mice are shown on Lanes 1–3. PCRs were performed separately for each gene, and PCR products were loaded separately in different lanes. A single band at 399 bp indicates homozygous STIM1 flox (Lane 1), a band at 197 bp indicates homozygous SEPT7 flox (Lane 2), and the 421-bp band is from the PCP2-Cre allele (Lane 3). PCRs with genomic DNA from STIM1 ; SEPT7 ; PCP (STIM1 ; SEPT7 ) mice are shown in Lanes 4–6. Lanes 13–15 indicate genotyping of control mice STIM1 ; SEPT7 . DNA band sizes are as described before. “L” denotes DNA ladder.
FIGURE 2Characterization of SEPT7 and STIM1 expression levels. (A) Bar graphs indicating relative expression of Purkinje neuron marker, PCP2 (Purkinje cell protein 2) normalized to GAPDH (glyceraldehyde 3-phosphate dehydrogenase) in samples of the Purkinje neuronal layer (PNL) and the granule layer (GL). PCP2 expression levels of GL are relative to PNL for each genotype, and statistical significance is indicated above the bar graph. (B) Bar graphs with relative expression of granule layer marker, GABRA6 (gamma-aminobutyric acid type A receptor subunit alpha 6) normalized to GAPDH levels in samples of the Purkinje neuronal layer and the granule layer. GABRA6 expression levels of GL are compared relative to those of PNL for each genotype, and statistical significance is indicated above the bar graph. (C) Bar graphs indicating fold changes in expression of SEPT7 and STIM1 normalized to GAPDH from microdissected Purkinje neuronal layer of each genotype. Fold changes are relative to that of its respective controls, and statistical significance is indicated above the bar graph. Data are presented as mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001; one-way ANOVA with post hoc Tukey’s test (n = 3 mice for all groups and n = 4 for STIM1 ; SEPT7 , age—1-year-old mice).
Table with downregulated genes identified under enriched GO biological and cellular process.
| GO Term | Pathway | LogP | Genes |
|---|---|---|---|
| GO:0010975 | Regulation of neuron projection development | −4.69 |
|
| GO:0098984 | Neuron to neuron synapse | -4.60 |
|
| GO:0006898 | Receptor-mediated endocytosis | −4.19 |
|
| GO:0090316 | Positive regulation of intracellular protein transport | −4.10 |
|
| GO:0032469 | Endoplasmic reticulum calcium ion homeostasis | −3.02 |
|
| GO:0061024 | Membrane organization | −2.48 |
|
| GO:0098793 | Presynapse | −2.35 |
|
GO classification of biological and cellular processes of selected genes downregulated upon STIM1 knockout in PNs. Enriched categories with associated GO term, log p value, and lists of genes associated with each process and tested here are shown. Metascape was used for gene enrichment using parameters specific for Mus musculus, with a p value cutoff as 0.01 (data from Dhanya and Hasan, 2021).
FIGURE 3Partial or complete deletion of SEPT7 can reverse the expression of a subset of genes that are downregulated by STIM1 knockout in Purkinje neurons. (A) Bar graph with relative fold changes in expression of the indicated genes in the indicated genotypes. Red asterisks above each bar represent statistically significant change between STIM1 (pink bars) and the control genotype STIM1 ; SEPT7 (light blue bars). Black asterisks above each bar represent statistically significant change between STIM1 (pink bars) and the experimental genotype, STIM1 ; SEPT7 (light green bars). (B) Bar graph of relative gene expression changes in the indicated genotypes. Red asterisks over each bar represent statistically significant change between STIM1 (pink bars) and the control genotype STIM1 ; SEPT7 (blue bars). Black asterisks above each bar represent a statistically significant change between STIM1 (pink bars) and STIM1 ; SEPT7 (green bars). Fold changes were normalized to GAPDH. Data are presented as mean ± SEM, *p < 0.05, **p < 0.01; one-way ANOVA with post hoc Tukey’s test. All measurements are taken by qRT-PCR of cDNA prepared from RNA isolated from microdissected Purkinje layers (n = 3 mice for all groups and n = 4 for STIM1 ; SEPT7 , age—1 year). Pvalb—Parvalbumin, Calm1—Calmodulin 1, Dlg4—Discs large homolog 4, Robo2—Roundabout guidance receptor 2, Map4—Microtubule-associated protein 4, Gigyf2—GRB10 interacting GYF Protein 2, Atp1a3—Na+/K+-transporting ATPase subunit alpha 3.
FIGURE 4Excess innervation between climbing fibers and Purkinje neuron dendrites in STIM1 mice can be reversed by reduction and loss of SEPT7. (A) Immunohistochemical images and quantitative analysis of climbing fiber innervations on the proximal dendrites of Purkinje neurons in the indicated mice genotypes. (Left panel) PN soma and proximal dendrites with Td tomato expression (red). VGLUT2 puncta are visible as green dots along the dendrites; (middle panel) VGLUT2 puncta (green) with projection images of dendritic filaments (yellow) obtained computationally using Imaris software and (right panel) projection images from Imaris analysis with dendritic filaments marked in yellow and VGLUT2 puncta as white dots. Scale bars are 10 μm. (B) Bar graph depicting the density of VGLUT2 puncta (count per 103 μm2) presents at the proximal dendritic regions of PNs of the indicated mice genotypes. Quantification of VGLUT2 puncta density was from three mice of each genotype, all aged 1 year, and 27 or more PNs from each genotype. Data are presented as mean ± SEM; one-way ANOVA with post hoc Tukey’s test; *p < 0.00001. Same alphabets above the bar graphs represent statistically indistinguishable groups, and a different alphabet represents a statistically different group with the minimal significance of p < 0.05.
FIGURE 5Reduction and loss of SEPT7 rescue loss of motor learning and coordination arising from loss of STIM1 in Purkinje neurons mean latency times on the rotarod are shown for the indicated genotypes at (A, D) 17 weeks, (B, E) 6 months, and (C, F) 1 year of age. The number of mice tested for each genotypes is STIM1 ; SEPT7 (n = 6), SEPT7 (n = 4), STIM1 (n = 7), STIM1 ; SEPT7 (n = 5), STIM1 ; SEPT7 (n = 6), SEPT7 (n = 8), SEPT7 (n = 6), STIM1 (n = 7), STIM1 ; SEPT7 (n = 8). Same alphabets at the end of line plots represent statistically indistinguishable groups, the color of the alphabets denotes the respective line plots, and different alphabets represent p < 0.05. Two-way ANOVA, a post hoc test, followed by Tukey’s multiple comparisons test were used.
FIGURE 6Cellular and behavioral effects of reducing SEPT7 in mice with loss of STIM1 in Purkinje neurons loss of STIM1 in Purkinje neurons attenuate Ca2+ entry and affect ER-Ca2+ refilling which in turn suppresses mGluR1-stimulated Ca2+ signals and Purkinje neuron excitability (Hartmann et al., 2014; Ryu et al., 2017; Dhanya and Hasan, 2021). These changes affect gene expression and optimal synaptic connectivity of cerebellar Purkinje neurons with age (Dhanya and Hasan, 2021). Reducing or abolishing SEPT7 in STIM1 PNs restored gene expression which is accompanied by normal CF-PN innervation and an improved ability to learn a motor coordination task in aging mice. [Model created using Biorender (BioRender.com).]