BACKGROUND: We mainly investigated how y-box binding protein 1 (YB-1) regulates liver lipid metabolism through the Wnt/β-catenin signaling pathway using multiple models. METHODS: The LO2 cells were treated with palmitic acid (PA) to create an NAFLD model in vitro. Immunohistochemistry and Western blotting assays were used to detect the expression of YB-1, β-catenin, SREBP-1c, LXRa, FXR1 and PPARα protein, and RNAs of them was detected by qRT-PCR. Oil Red O assay was applied to observe lipid droplets in LO2 cells and liver tissues. H&E staining was performed to observe the degree of liver inflammation. Proteomics in LO2 cells were conducted by Tandem mass tag proteomics assay. Co-immunoprecipitation and Western blotting assays were used to verify YB-1 complexed pGSK3β. ELISA and Western blotting assays were used to detect the concentrations of TNFα and IL-6 in LO2 cells and liver tissues, respectively. RESULTS: We found that YB-1 and β-catenin were highly expressed in the LO2 cell NAFLD model, and that the expression of TNFα and IL-6 also increased. Lipid synthases (SREBP-1c and LXRa) expression were decreased, while β-oxidation-related factors (FXR1 and PPARα) expression were increased. The expression of SREBP-1c and LXRa were increased while FXR1 and PPARα were decreased, though such responses were rescued through inhibiting β-catenin expression. Finally, tandem mass tag proteomics, co-immunoprecipitation, and Western blotting demonstrated that YB-1 could form a protein complex with phosphorylated glycogen synthase kinase 3 beta (pGSK3β) to regulate Wnt/β-catenin. In mouse NAFLD livers, immunohistochemistry and Western blotting validated the finding of YB-1 gene downregulation leading to the inhibition of Wnt/β-catenin pathway activation, ultimately inhibiting lipid synthesis and reducing the inflammatory response. Similar to the in vitro investigation, β-catenin overexpression reversed such YB-1 downregulation-induced downstream effects. Upregulation of the YB-1 gene promoted the activation of the Wnt/β-catenin pathway, thus increasing lipid synthesis and the inflammatory response. However, downregulation of β-catenin reversed this phenomenon caused by upregulating YB-1. CONCLUSIONS: In summary, these results demonstrate that YB-1 regulates liver lipid metabolism by regulating the Wnt/β-catenin signaling pathway. 2021 Annals of Translational Medicine. All rights reserved.
BACKGROUND: We mainly investigated how y-box binding protein 1 (YB-1) regulates liver lipid metabolism through the Wnt/β-catenin signaling pathway using multiple models. METHODS: The LO2 cells were treated with palmitic acid (PA) to create an NAFLD model in vitro. Immunohistochemistry and Western blotting assays were used to detect the expression of YB-1, β-catenin, SREBP-1c, LXRa, FXR1 and PPARα protein, and RNAs of them was detected by qRT-PCR. Oil Red O assay was applied to observe lipid droplets in LO2 cells and liver tissues. H&E staining was performed to observe the degree of liver inflammation. Proteomics in LO2 cells were conducted by Tandem mass tag proteomics assay. Co-immunoprecipitation and Western blotting assays were used to verify YB-1 complexed pGSK3β. ELISA and Western blotting assays were used to detect the concentrations of TNFα and IL-6 in LO2 cells and liver tissues, respectively. RESULTS: We found that YB-1 and β-catenin were highly expressed in the LO2 cell NAFLD model, and that the expression of TNFα and IL-6 also increased. Lipid synthases (SREBP-1c and LXRa) expression were decreased, while β-oxidation-related factors (FXR1 and PPARα) expression were increased. The expression of SREBP-1c and LXRa were increased while FXR1 and PPARα were decreased, though such responses were rescued through inhibiting β-catenin expression. Finally, tandem mass tag proteomics, co-immunoprecipitation, and Western blotting demonstrated that YB-1 could form a protein complex with phosphorylated glycogen synthase kinase 3 beta (pGSK3β) to regulate Wnt/β-catenin. In mouse NAFLD livers, immunohistochemistry and Western blotting validated the finding of YB-1 gene downregulation leading to the inhibition of Wnt/β-catenin pathway activation, ultimately inhibiting lipid synthesis and reducing the inflammatory response. Similar to the in vitro investigation, β-catenin overexpression reversed such YB-1 downregulation-induced downstream effects. Upregulation of the YB-1 gene promoted the activation of the Wnt/β-catenin pathway, thus increasing lipid synthesis and the inflammatory response. However, downregulation of β-catenin reversed this phenomenon caused by upregulating YB-1. CONCLUSIONS: In summary, these results demonstrate that YB-1 regulates liver lipid metabolism by regulating the Wnt/β-catenin signaling pathway. 2021 Annals of Translational Medicine. All rights reserved.
Non-alcoholic fatty liver disease (NAFLD) has emerged as the most prevalent condition that contributes to chronic hepatic ailments worldwide, and consists of a heterogeneous spectrum of diseases including simple steatosis, steatohepatitis, advanced fibrosis, and cirrhosis (1,2). Specifically, non-alcoholic steatohepatitis (NASH) can progress to liver cirrhosis and primary liver cancer, becoming the main cause of liver-related morbidity and mortality (3,4). Although the prevalence of NAFLD is closely associated with obesity, type 2 diabetes mellitus (T2DM), and insulin resistance, However, these researches mainly focus on the etiology, epidemiology and progression of lipid metabolism in NAFLD and the pathogenic mechanism of NAFLD is still poorly understood (5-7). The aim of this study is to investigate the molecular mechanism of NAFLD.Y-box binding protein 1 (YB-1), as a member of the family of DNA/RNA-binding proteins, can regulate gene expression in the cytoplasm and the nucleus. Generally, YB-1 is recruited to mRNAs in the cytoplasm or it can bind to Y-box elements (CCAAT-box) in the promoter regions of some genes in the nucleus, thereby regulating their translation and transcription (8,9). Recently, an investigation demonstrated that YB-1 is involved in the progression of fatty acid synthesis (10). However, there is currently minimal research focused on the role of YB-1 in NAFLD pathogenic mechanisms.Recently, some investigations have shown that Wnt/β-catenin signaling plays a pivotal role in liver inflammation and liver fibrosis development, together with chronic liver injury progression (11-13). In addition, some studies demonstrated that the Wnt/β-catenin signaling pathway can regulate lipid metabolism in the liver (14,15). We present the following article in accordance with the ARRIVE reporting checklist (available at https://dx.doi.org/10.21037/atm-21-5767).
Methods
Animals and the NAFLD mouse model
Thirty-five-day-old C57BL/6 mice were procured through Sino-British Sippr/BK Laboratory. Under specific pathogen-free conditions, they were housed at a constant temperature (22±2 °C) and 60% relative humidity, with 12:12-h light-dark cycle in the Animal Experimental Center of Bengbu Medical College (Bengbu, China). All the animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Bengbu Medical College and were approved by the Animal Ethics Committee of Bengbu Medical College (Bengbu, China) under a project license (No. 2021-096). Wild type C57BL/6 mice were divided into a normal diet group and a high-fat diet group (HFD—comprising 60% fat-derived calories) (BioServ™, Frenchtown, NJ, USA). The mice in the HFD group were fed in this manner for an uninterrupted timespan of 12 weeks. Meanwhile, the normal diet group was treated with a healthy balanced dietary intake (Keaoxieli™, Beijing, China).
Cell culture and establishment of the NAFLD model
LO2 hepatocytes were used in this study. The cell cultures were expanded in Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher™, USA), supplemented with 10% fetal bovine serum (Thermo Fisher™, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin. For steatosis induction, the cells were treated with 0.4 mM palmitic acid (PA) to create an NAFLD model in vitro. The culture medium and PA were replaced every 24 h for 72 h.
Construction of YB-1 lentiviruses and β-catenin plasmid
A lentiviral vector LV-3 carrying a green fluorescent protein (GFP) reporter (GenePharma, Shanghai, China) was employed for expressing short hairpin RNA (shRNA) that targeted the YB-1 sequence (5'-GCCTAGAGAGGATGGCAATGA-3'), and an additional lentiviral vector LV-5/GFP reporter delivery system was employed for overexpressing RNA that targeted the YB-1 sequence (ID: 22608, NM_011732.2), with LV3 and LV5 (vector) as the control. pGMLV-SC5 RNAi carrying a GFP reporter (Genomeditech™, Shanghai, China) was employed for expressing shRNA that targeted β-catenin (5'-GCACCATGCAGAATACAAATG-3'), with PGMLV-6395 (vector) serving as the control plasmid. A PGMLV-6395/GFP reporter delivery system was employed for overexpressing RNA that targeted β-catenin (CTCGAGGCCACCGGATCC).In brief, LO2 cells in medium were transfected using shYB-1, shβ-catenin, overexpressed YB-1, overexpressed β-catenin, and its corresponding vector with Lipofectamine 3000® (Invitrogen™, Carlsbad, CA) as per the manufacturer’s protocol. After an incubation period of 72 h, transcriptomic/proteomic quantitative LO2 cell analyses, from all experimental arms, were conducted using qRT-PCR and Western blotting.
Immunohistochemistry (IH)
For the IH process, formalin-fixed paraffin-embedded liver samples were cut into 4 µm sections, then deparaffinized and rehydrated. Antigen retrieval was performed using sodium citrate (20 min). Samples were then incubated in 3% H2O2 (15 min), pretreated by boiling in 10 mM sodium citrate buffer (pH 6.0) (20 min), and then washed 3 times with phosphate-buffered saline (PBS). Blocking was performed in 5% bovine serum albumin (BSA) for 0.5 h at room temperature. The primary antibodies in 1% BSA were incubated overnight at 4 °C in a humid chamber. After horseradish peroxidase-conjugated secondary antibody incubation for 0.5 h at room temperature, the specimens were counter-stained using 4',6-diamidino-2-phenylindole (DAPI). Staining of each liver tissue sample was repeated 3 times. Lastly, the Barnes method was employed as the immune scoring system. Details of the primary/secondary antibodies are listed in .
Table 1
Antibodies for Western blotting (WB), co-immunoprecipitation (Co-IP), and immunohistochemistry (IH)
Hematoxylin and eosin (H&E) and Oil Red O staining
H&E staining was performed to observe the degree of liver inflammation. Formalin-fixed paraffin-embedded liver samples were cut into 3 µm sections and stained with H&E (Beyotime™, China), followed by light microscopy-based visualization. In addition, hepatic cryosections were stained using an Oil Red O kit (Sigma, USA) and counter-stained using hematoxylin in order to observe lipid droplets under light microscopy.
Quantitative Real-time PCR (qRT-PCR)
Total RNA was extracted from liver tissues using TRIzol™ reagent (Thermo Fisher, USA) and then reverse transcribed into cDNA using Hieff™ First Strand cDNA Synthesis Super Mix for qRT-PCR (Yeasen, China). Hieff qPCR SYBR Green Master Mix® (Applied Biosystems™, CA, USA) together with Hieff First Strand cDNA Synthesis Super Mix for qRT-PCR® (Applied Biosystems™) were employed for qPCR. All experiments were repeated 3 separate times. GAPDH served as a normalization/reference gene. Primer sequences are illustrated in .
Table 2
Primer sequences for RT-PCR analysis
Target
Forward primer
Reverse primer
YB-1
TAGACGCTATCCACGTCGTAG
ATCCCTCGTTCTTTTCCCCAC
SREBP-1c
ACAGTGACTTCCCTGGCCTAT
GCATGGACGGGTACATCTTCAA
LXRa
ACACCTACATGCGTCGCAAG
GACGAGCTTCTCGATCATGCC
FXR1
CTGCGACAGATTGGTTCTAGG
TGTACCATAACCGGAGGTGTAA
PPARα
TTCGCAATCCATCGGCGAG
CCACAGGATAAGTCACCGAGG
β-catenin
AGCTTCCAGACACGCTATCAT
CGGTACAACGAGCTGTTTCTAC
YB-1, y-box binding protein 1; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha.
YB-1, y-box binding protein 1; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha.
Western blotting (WB) assay
Total protein was extracted with RIPA lysis buffer (Thermo Fisher, USA). Equivalent protein sample quantities (70 µg) were separated through 10% SDS-PAGE and then transferred onto PVDF membranes (0.22 µm). Subsequently, membranes were blocked using 5% skimmed milk + 0.1% Tris Buffered Saline Tween (TBST) for 1 h at room temperature, followed by incubation with primary antibodies at 4 °C overnight. Membranes were washed 3 times with TBST and then incubated with the corresponding secondary antibody for 1 h at room temperature. Bands were identified through the enhanced chemiluminescence (ECL) (Thermo Fisher, USA) system, followed by X-ray radiation (LAS MINI 4000®, Japan). The protein expression levels of individual bands were assessed through ImageJ (National Institute of Health, Bethesda, MD, USA). Each assay was performed in triplicate across individual experiments. GAPDH served as a normalization protein for protein expression assessments. Details of primary antibodies are listed in .
Tandem mass tag proteomics
SDT pyrolysis methods were used to extract proteins for proteomics, and the bicinchoninic acid (BCA) kit (Pierce™ BCA, Thermo Fisher, USA) was used to test sample concentrations. The loading buffer (6x) was added to 20 µg protein samples, which were then boiled for 5 min, separated by 12% SDS-PAGE, and stained by Coomassie bright blue. Enzymatic hydrolysis was then performed through FASP, tagged by TMT, and separated through High PH RP. Subsequently, mass spectrometry was performed using the Easy nLC system and mass spectrum identification was performed by Q Exactive. Using Blast2 Gene Ontology (GO) to annotate the target protein, the process consisted of sequence alignment (blast), GO item extraction (mapping), GO annotation (annotation), and supplementary annotation augmentation. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was performed through KOALA (KEGG Orthology And Links Annotation), and enrichment analysis of GO/KEGG annotations was performed by Fisher’s exact test. Protein cluster analysis was performed using matplotlib software.
Co-immunoprecipitation (Co-IP)
Pierce Co-IP kits (Thermo Fisher, USA) were applied to extract total protein from LO2 cells, and the protein levels were evaluated using a BCA protein quantification kit (Thermo Fisher, USA). The experiment was conducted according to the Pierce Co-IP kit guidelines. In brief, pre-cleared lysate was set using control agarose resin. Subsequently, immobilized anti-YB-1 (20 µg/mg lysate) and anti-pGSK3β (40 µg/mg lysate), together with control IgG antibodies (20 µg/mg lysate), were introduced into the amino link/coupling resin solution. A 400 µg sample of pre-cleared lysate was incubated with various immobilization antibodies at 4 °C for 12 h and then the mixture was washed with 60 µL of elution buffer. All immune precipitates were boiled for 10 min and evaluated through a WB assay. Details of the primary antibodies are illustrated in .
Enzyme-linked immunosorbent assay (ELISA)
The supernatants of non-steatosis and steatosis LO2 cells grown in 12-well plates were harvested on day 3 and frozen at −20 °C until assay. A quantitative ELISA kit for TNFα (Murine TNF-α ELISA Kit, PeproTech, USA, BGK06804) was used to detect the concentration of TNFα in supernatants according to the manufacturer’s protocol. A quantitative ELISA kit for IL-6 (IL-6 Mouse ELISA Kit, Thermo Fisher, USA, BMS603-2) was used to detect the concentration of IL-6 in supernatants, as per the manufacturer’s protocol. A histogram of the TNFα and IL-6 concentration was created using GraphPad Prism® (GraphPad Software Inc.™, USA, version 8.0).
Statistical analysis
Data were presented as mean ± SE. All statistical analyses were conducted through SPSS 20.0® software (IBM™ SPSS; Armonk, NY, USA). Two-way ANOVA was applied to interpret the differences between treatment groups. P<0.05 indicated a statistically significant result.
Results
The expression levels of YB-1 and β-catenin were higher in NAFLD liver tissues
After mice were fed with a HFD or normal diet for 12 weeks continuously, the liver samples were collected and used in experiments. Lipid deposits were increased in NAFLD liver tissues compared with normal liver tissues (). The degree of inflammatory response was more serious compared to that of normal liver tissues (). Subsequently, we found that the expression of YB-1 protein was higher in the NAFLD group (). Furthermore, qRT-PCR/WB indicated that YB-1 mRNA and protein expression was upregulated in the NAFLD group (). Interestingly, we found that the protein and gene expression of β-catenin was also higher in the NAFLD group (). At the same time, the expression levels of TNFα and IL-6 were higher in the NAFLD group compared with the normal liver group ().
Figure 1
The expression levels of YB-1 and β-catenin were elevated in liver samples of mouse NAFLD livers. (A) Oil Red O staining showing lipid deposits (scale bar =100 µm, n=20 per group); (B) H&E staining indicating the degree of inflammation and steatosis in liver tissues (scale bar =100 µm, n=20 per group); (C,D) immunohistochemical staining and histogram presenting quantification of the immune score for YB-1 in the above liver tissue (scale bar =100 µm, n=20 per group; *, P<0.05 compared with the normal liver group, n=3 per experiment); (E-G) the gene and protein expression levels of YB-1 in the above groups (*, P<0.05 compared with the normal liver group, n=3 per experiment); (H) the gene expression levels of β-catenin in the above groups (*, P<0.05 compared with the normal liver group, n=3 per experiment); (I,J) immunohistochemical staining and histogram presenting quantification of the immune score for β-catenin in the above liver tissues (scale bar =50 µm, n=20 per group); (K,L) WB assays demonstrated the expression of TNFα and IL-6 in the above groups (*, P<0.05 compared with the normal liver group, n=3 per experiment). NAFLD, Non-alcoholic fatty liver disease; YB-1, y-box binding protein 1; WB, Western blot.
The expression levels of YB-1 and β-catenin were elevated in liver samples of mouse NAFLD livers. (A) Oil Red O staining showing lipid deposits (scale bar =100 µm, n=20 per group); (B) H&E staining indicating the degree of inflammation and steatosis in liver tissues (scale bar =100 µm, n=20 per group); (C,D) immunohistochemical staining and histogram presenting quantification of the immune score for YB-1 in the above liver tissue (scale bar =100 µm, n=20 per group; *, P<0.05 compared with the normal liver group, n=3 per experiment); (E-G) the gene and protein expression levels of YB-1 in the above groups (*, P<0.05 compared with the normal liver group, n=3 per experiment); (H) the gene expression levels of β-catenin in the above groups (*, P<0.05 compared with the normal liver group, n=3 per experiment); (I,J) immunohistochemical staining and histogram presenting quantification of the immune score for β-catenin in the above liver tissues (scale bar =50 µm, n=20 per group); (K,L) WB assays demonstrated the expression of TNFα and IL-6 in the above groups (*, P<0.05 compared with the normal liver group, n=3 per experiment). NAFLD, Non-alcoholic fatty liver disease; YB-1, y-box binding protein 1; WB, Western blot.
The expression levels of YB-1 and β-catenin were increased in the LO2 cell NAFLD model in vitro
To further explore the correlation between YB-1 and β-catenin in hepatocyte steatosis, we established an LO2 cell NAFLD model in vitro through cultured LO2 cells in DMEM induced by PA (). We found that the expression levels of genes and proteins related to lipid synthesis (SREBP-1c and LXRa) were higher in steatosis LO2 cells, but the expression levels of genes and proteins related to β-oxidation (FXR1 and PPARα) were lower (). Furthermore, we also found that the gene and protein expression levels of YB-1 and β-catenin were elevated in steatosis LO2 cells (). Finally, the inflammation factors TNFα and IL-6 were also increased in steatosis LO2 cells ().
Figure 2
The expression levels of YB-1 and β-catenin were higher in steatosis LO2 cells in vitro. (A) Oil Red O staining showing lipid deposits (scale bar =100 µm, n =3 per group); (B) qRT-PCR detected the expression levels of the genes related to lipid synthesis (SREBP-1c and LXRa) and β-oxidation (FXR1 and PPARα) (*, P<0.05 compared with the control group, n=3 per experiment); (C,D) WB showing the expression levels of SREBP-1c, LXRa, FXR1, and PPARα, and histogram presenting quantification of the immune score for the corresponding proteins in the above groups (*, P<0.05 compared with the control group, n=3 per experiment); (E-G) qRT-PCR and WB assays showing the gene and protein expression levels of YB-1 and β-catenin (*, P<0.05 compared with the control group, n=3 per experiment); (H,I) ELISA assay measured the contents of TNFα and IL-6 in the supernatants of each group (*, P<0.05 compared with the control group, n=3 per experiment). YB-1, y-box binding protein 1; WB, Western blot; qRT-PCR, Quantitative Real-time PCR; ELISA, Enzyme-linked immunosorbent assay; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, IL-6, interleukin 6.
The expression levels of YB-1 and β-catenin were higher in steatosis LO2 cells in vitro. (A) Oil Red O staining showing lipid deposits (scale bar =100 µm, n =3 per group); (B) qRT-PCR detected the expression levels of the genes related to lipid synthesis (SREBP-1c and LXRa) and β-oxidation (FXR1 and PPARα) (*, P<0.05 compared with the control group, n=3 per experiment); (C,D) WB showing the expression levels of SREBP-1c, LXRa, FXR1, and PPARα, and histogram presenting quantification of the immune score for the corresponding proteins in the above groups (*, P<0.05 compared with the control group, n=3 per experiment); (E-G) qRT-PCR and WB assays showing the gene and protein expression levels of YB-1 and β-catenin (*, P<0.05 compared with the control group, n=3 per experiment); (H,I) ELISA assay measured the contents of TNFα and IL-6 in the supernatants of each group (*, P<0.05 compared with the control group, n=3 per experiment). YB-1, y-box binding protein 1; WB, Western blot; qRT-PCR, Quantitative Real-time PCR; ELISA, Enzyme-linked immunosorbent assay; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, IL-6, interleukin 6.
YB-1 regulated lipid synthesis and the expression of β-catenin in LO2 cells
In order to investigate the effect of YB-1 on LO2 cell lipid synthesis and the expression of β-catenin, a YB-1 lentivirus was constructed to regulate the gene and protein expression levels of YB-1. Subsequently, non-steatosis and steatosis LO2 cells were transfected with the YB-1 lentivirus and its corresponding vector, and the RNA and protein were collected for experiments at the indicated time. First, we confirmed that shYB-1 lentivirus could effectively inhibit and overexpression YB-1 lentivirus could effectively increase the gene and protein expression levels of YB-1 (). Second, in steatosis LO2 cells, we demonstrated that downregulation of YB-1 inhibited lipid synthesis, but upregulation of YB-1 promoted lipid synthesis (). Furthermore, we found that downregulation of YB-1 inhibited the expression of SREBP-1c and LXRa mRNA, but increased the expression of FXR1 and PPARα mRNA. However, upregulation of YB-1 promoted the expression of SREBP-1c and LXRa mRNA, but inhibited the expression of FXR1 and PPARα mRNA (). Third, the WB assay showed that the protein expression levels of SREBP-1c, LXRa, FXR1, and PPARα were consistent with their mRNA expression levels. At the same time, we also found that downregulation of YB-1 inhibited the expression level of β-catenin protein, but upregulation of YB-1 increased the expression level of β-catenin protein (). Finally, the results showed that inhibited lipid synthesis by shYB-1 downregulated the contents of TNFα and IL-6 in the corresponding supernatant, but increased lipid synthesis induced by overexpression of YB-1 upregulated the contents of TNFα and IL-6 ().
Figure 3
YB-1 could regulate lipid synthesis and the expression of β-catenin in LO2 cells in vitro. (A,B) The gene and protein expression levels of YB-1 (*P<0.05 compared with LV3, #P<0.05 compared with LV5, n=3 per experiment); (C) lipid deposits were detected by Oil Red O staining (scale bar =100 µm, n=3 per group); (D-G) the mRNA expression levels of SREBP-1c, LXRa, FXR1, and PPARα in each group (*, P<0.05 compared with LV3; #, P<0.05 compared with LV5, n=3 per experiment); (H,I) the protein expression levels of SREBP-1c, LXRa, FXR1, and PPARα in each group (*, P<0.05 compared with LV3; #, P<0.05 compared with LV5, n=3 per experiment); (J,K) ELISA assay measured the contents of TNFα and IL-6 in the supernatants of each group (*, P<0.05 compared with LV3; #, P<0.05 compared with LV5, n=3 per experiment). YB-1, y-box binding protein 1; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, IL-6, interleukin 6.
YB-1 could regulate lipid synthesis and the expression of β-catenin in LO2 cells in vitro. (A,B) The gene and protein expression levels of YB-1 (*P<0.05 compared with LV3, #P<0.05 compared with LV5, n=3 per experiment); (C) lipid deposits were detected by Oil Red O staining (scale bar =100 µm, n=3 per group); (D-G) the mRNA expression levels of SREBP-1c, LXRa, FXR1, and PPARα in each group (*, P<0.05 compared with LV3; #, P<0.05 compared with LV5, n=3 per experiment); (H,I) the protein expression levels of SREBP-1c, LXRa, FXR1, and PPARα in each group (*, P<0.05 compared with LV3; #, P<0.05 compared with LV5, n=3 per experiment); (J,K) ELISA assay measured the contents of TNFα and IL-6 in the supernatants of each group (*, P<0.05 compared with LV3; #, P<0.05 compared with LV5, n=3 per experiment). YB-1, y-box binding protein 1; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, IL-6, interleukin 6.
YB-1 combined with pGSK3β to regulate the expression of β-catenin in LO2 cells
In order to examine the molecular mechanisms of YB-1 in regulating β-catenin levels in LO2 cells, we conducted a tandem mass tag proteomics assay. LO2 cells were transfected with shYB-1 lentivirus and cultured in DMEM + PA for 72 h, and then total protein was extracted for experiments. The results showed that a total of 300 proteins were upregulated and 376 proteins were downregulated upon downregulation of YB-1 (). GO analysis of the upregulated proteins revealed that YB-1 downregulation promoted proteins associated with oxide synthase activity and glucose homeostasis (). KEGG pathway analysis demonstrated enrichment in the complement and coagulation, ferroptosis, and PI3K-AKT pathways (). WB confirmed that the downregulation of YB-1 upregulated pGSK-3β and downregulated β-catenin, but upregulation of YB-1 led to pGSK-3β downregulation and upregulated β-catenin (). Subsequently, a Co-IP assay showed that YB-1 complexed pGSK3β (). Such findings suggest that the YB-1-regulated Wnt/β-catenin signaling pathway could be orchestrated through pGSK3β degradation. Consequently, the LO2 cell line was exposed to a GSK3β inhibitor (TDZD-8; f.c. 2.5 µM) and activator (recombinant murine GSK3β protein (rGSK3β)) at 90 ng/mL once daily in DMEM + PA for 72 h. WB demonstrated that TDZD-8 effectively led to pGSK3β downregulation, together with inducing β-catenin (and its target protein CyclinD1) upregulation. In contrast, rGSK3β demonstrated contrasting influences on the Wnt/β-catenin signaling pathway, suggesting that β-catenin is a downstream target of pGSK3β (). Therefore, we constructed shβ-catenin and a corresponding scramble, and OE-β-catenin together with empty-vector plasmids. Study outcomes indicated that shβ-catenin and OE-β-catenin regulate β-catenin at the transcriptomic and proteomic levels (). Moreover, we confirmed that downregulation of β-catenin and its target CyclinD1 by shYB-1 could be rescued by OE-β-catenin, and upregulation of β-catenin and its target CyclinD1 by OE-YB-1 could be inhibited by shβ-catenin ().
Figure 4
YB-1 combined with pGSK3β regulated the expression of β-catenin. (A) Protein quantitative results showing the number of upregulated and downregulated proteins (the expression difference was greater than 1.2 times (up and down) and P value (t-test) was less than 0.05); (B) GO enrichment analysis showing the biological functions of the affected proteins; (C) KEGG pathway enrichment analysis showing significantly affected metabolic and signaling transduction pathways. (D,E) Relative protein expression levels of pGSK3β and β-catenin were analyzed by WB (*, P<0.05 compared with LV3; #, P<0.05 compared with LV5, n=3 per experiment). (F) LO2 cell lysates were co-precipitated with anti-pGSK3β and anti-YB-1 antibodies and normal IgG as a negative control antibody, and then detected by YB-1 and pGSK3β antibodies, with 20% of total cell lysates used as input. (G,H) WB detected the effect of TDZD-8 (GSK3β-specific inhibitor) and rGSK3β (recombinant mouse GSK3β protein) on the expression levels of β-catenin and its target protein CyclinD1 in LO2 cells cultured in DMEM + PA for 72 h. Histogram showing WB quantification (*, P<0.05 compared with blank, n=3 per experiment). (I,J) RT-PCR and WB demonstrated the effect of shYB-1 on the expression of YB-1 (*, P<0.05 compared with the scramble group, n=3 per experiment). (K,L) RT-PCR and WB demonstrated the effect of OE-YB-1 on the expression of YB-1 (*, P<0.05 compared with the scramble group, n=3 per experiment). (M,N) WB showing the expression level of β-catenin and its target protein CyclinD1 (*, P<0.05 compared with groups without any treatment; #, P<0.05 compared with groups without any treatment, n=3 per experiment). YB-1, y-box binding protein 1; WB, Western blot; qRT-PCR, Quantitative Real-time PCR; GSK3β, glycogen synthase kinase 3 beta; pGSK3β, phosphorylation glycogen synthase kinase 3 beta; rGSK3β; recombinant murine GSK3β protein.
YB-1 combined with pGSK3β regulated the expression of β-catenin. (A) Protein quantitative results showing the number of upregulated and downregulated proteins (the expression difference was greater than 1.2 times (up and down) and P value (t-test) was less than 0.05); (B) GO enrichment analysis showing the biological functions of the affected proteins; (C) KEGG pathway enrichment analysis showing significantly affected metabolic and signaling transduction pathways. (D,E) Relative protein expression levels of pGSK3β and β-catenin were analyzed by WB (*, P<0.05 compared with LV3; #, P<0.05 compared with LV5, n=3 per experiment). (F) LO2 cell lysates were co-precipitated with anti-pGSK3β and anti-YB-1 antibodies and normal IgG as a negative control antibody, and then detected by YB-1 and pGSK3β antibodies, with 20% of total cell lysates used as input. (G,H) WB detected the effect of TDZD-8 (GSK3β-specific inhibitor) and rGSK3β (recombinant mouse GSK3β protein) on the expression levels of β-catenin and its target protein CyclinD1 in LO2 cells cultured in DMEM + PA for 72 h. Histogram showing WB quantification (*, P<0.05 compared with blank, n=3 per experiment). (I,J) RT-PCR and WB demonstrated the effect of shYB-1 on the expression of YB-1 (*, P<0.05 compared with the scramble group, n=3 per experiment). (K,L) RT-PCR and WB demonstrated the effect of OE-YB-1 on the expression of YB-1 (*, P<0.05 compared with the scramble group, n=3 per experiment). (M,N) WB showing the expression level of β-catenin and its target protein CyclinD1 (*, P<0.05 compared with groups without any treatment; #, P<0.05 compared with groups without any treatment, n=3 per experiment). YB-1, y-box binding protein 1; WB, Western blot; qRT-PCR, Quantitative Real-time PCR; GSK3β, glycogen synthase kinase 3 beta; pGSK3β, phosphorylation glycogen synthase kinase 3 beta; rGSK3β; recombinant murine GSK3β protein.
Reverse regulation of β-catenin reversed the effect of YB-1 on lipid synthesis in LO2 cells
To further investigate whether the effect of YB-1 on LO2 cell lipid synthesis was realized by regulating β-catenin, Oil Red O staining was applied to observe lipid synthesis in LO2 cells cultured in DMEM + PA for 72 h. The results showed that downregulation of YB-1 impeded lipid synthesis, although this effect was reversed through β-catenin overexpression. In addition, upregulation of YB-1 increased lipid synthesis, but this phenomenon could be abolished by downregulation of β-catenin (). Then, WB assays demonstrated that downregulation of YB-1 inhibited the expression levels of SREBP-1c and LXRa, and increased the expression levels of FXR1 and PPARα. However, this phenomenon could be reversed by overexpression of β-catenin. Furthermore, the results also indicated that upregulation of YB-1 increased the expression levels of SREBP-1c and LXRa, and decreased the expression levels of FXR1 and PPARα, but this phenomenon could also be reversed by downregulation of β-catenin (). RT-PCR showed that the relative gene expression levels of SREBP-1c, LXRa, FXR1, and PPARα were consistent with the protein expression levels (). Finally, ELISA assays confirmed that the concentrations of TNFα and IL-6 in the supernatants were consistent with the degree of steatosis in the above groups ().
Figure 5
Reverse regulation of β-catenin reversed the effect of YB-1 on lipid synthesis in LO2 cells. (A) Oil Red O staining showing lipid deposits in each group (scale bar =100 µm, n =3 per group); (B,C) the expression levels of SREBP-1c, LXRa, FXR1, and PPARα (*, P<0.05 compared with groups without any treatment, n=3 per experiment); (D) RT-PCR indicating the gene expression of SREBP-1c, LXRa, FXR1, and PPARα (*, P<0.05 compared with groups without any treatment, n=3 per experiment); (E,F) ELISA assay detected the contents of TNFα and IL-6 in the supernatants of the above groups (*, P<0.05 compared with groups without any treatment, n=3 per experiment). YB-1, y-box binding protein 1; qRT-PCR, Quantitative Real-time PCR; ELISA, Enzyme-linked immunosorbent assay; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, IL-6, interleukin 6.
Reverse regulation of β-catenin reversed the effect of YB-1 on lipid synthesis in LO2 cells. (A) Oil Red O staining showing lipid deposits in each group (scale bar =100 µm, n =3 per group); (B,C) the expression levels of SREBP-1c, LXRa, FXR1, and PPARα (*, P<0.05 compared with groups without any treatment, n=3 per experiment); (D) RT-PCR indicating the gene expression of SREBP-1c, LXRa, FXR1, and PPARα (*, P<0.05 compared with groups without any treatment, n=3 per experiment); (E,F) ELISA assay detected the contents of TNFα and IL-6 in the supernatants of the above groups (*, P<0.05 compared with groups without any treatment, n=3 per experiment). YB-1, y-box binding protein 1; qRT-PCR, Quantitative Real-time PCR; ELISA, Enzyme-linked immunosorbent assay; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, IL-6, interleukin 6.
YB-1 regulated lipid synthesis in hepatocytes through orchestrating the Wnt/β-catenin signaling pathway in a mouse model
The results of the in vivo study indicated that YB-1 was highly expressed in NAFLD livers, but YB-1 expression was effectively inhibited by downregulation of YB-1, and YB-1 expression was higher with upregulation of YB-1 (). In addition, this study also identified β-catenin upregulation in NAFLD livers, although the expression of β-catenin was significantly inhibited by downregulation of YB-1, and the expression of β-catenin was significantly increased by upregulating β-catenin (). However, reverse regulation of β-catenin could reverse the effect of YB-1 on the β-catenin expression (). Furthermore, Oil Red O staining demonstrated that downregulation of YB-1 inhibited lipid synthesis in NAFLD mouse livers, but upregulation of YB-1 promoted lipid synthesis (). Interestingly, the effect of YB-1 on lipid synthesis in NAFLD mouse livers could be reversed by reverse regulation of β-catenin (). WB indicated that the inhibited expression of SREBP-1c and LXRa by downregulating YB-1 could be rescued by upregulation of β-catenin, and the increased expression of FXR1 and PPARα by downregulating YB-1 could also be inhibited by upregulation of β-catenin. The increased expression of SREBP-1c and LXRa by upregulating YB-1 could be rescued by downregulation of β-catenin, and the inhibited expression of FXR1 and PPARα by upregulating YB-1 could also be increased by downregulation of β-catenin (). Finally, we also confirmed that the expression levels of TNFα and IL-6 in NAFLD livers were consistent with the degree of steatosis ().
Figure 6
YB-1 regulates lipid synthesis by regulating the Wnt/β-catenin signaling pathway in vivo. (A,B) IH and histogram presenting quantification of the immune score for YB-1 in each group (scale bar =100 µm, n=20 per group; *, P<0.05 compared with the control and blank group, n=3 per experiment); (C,D) IH and histogram presenting quantification of the immune score for β-catenin in each group (scale bar =50 µm, n=20 per group; *, P<0.05 compared with the control and blank group, n=3 per experiment); (E,F) IH showing the relative expression levels of β-catenin (scale bar =50 µm, n=20 per group; *, P<0.05 compared with the control and blank group, n=3 per experiment); (G,H) Oil Red O staining showing lipid deposits in each group (scale bar =50 µm, n =20 per group); (I,J) WB indicating the relative expression levels of SREBP-1c, LXRa, FXR1, and PPARα in each group (*, P<0.05 compared with groups without any treatment, n=3 per experiment). (K,L) WB showing the relative expression levels of TNFα and IL-6 in each group (*, P<0.05 compared with groups without any treatment; #, P<0.05 compared with groups without any treatment n=3 per experiment). YB-1, y-box binding protein 1; IH; Immunohistochemistry; WB, Western blot; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, IL-6, interleukin 6.
YB-1 regulates lipid synthesis by regulating the Wnt/β-catenin signaling pathway in vivo. (A,B) IH and histogram presenting quantification of the immune score for YB-1 in each group (scale bar =100 µm, n=20 per group; *, P<0.05 compared with the control and blank group, n=3 per experiment); (C,D) IH and histogram presenting quantification of the immune score for β-catenin in each group (scale bar =50 µm, n=20 per group; *, P<0.05 compared with the control and blank group, n=3 per experiment); (E,F) IH showing the relative expression levels of β-catenin (scale bar =50 µm, n=20 per group; *, P<0.05 compared with the control and blank group, n=3 per experiment); (G,H) Oil Red O staining showing lipid deposits in each group (scale bar =50 µm, n =20 per group); (I,J) WB indicating the relative expression levels of SREBP-1c, LXRa, FXR1, and PPARα in each group (*, P<0.05 compared with groups without any treatment, n=3 per experiment). (K,L) WB showing the relative expression levels of TNFα and IL-6 in each group (*, P<0.05 compared with groups without any treatment; #, P<0.05 compared with groups without any treatment n=3 per experiment). YB-1, y-box binding protein 1; IH; Immunohistochemistry; WB, Western blot; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, IL-6, interleukin 6.
Discussion
NAFLD is increasing year by year, posing a great burden to human health and society, and affecting 20–30% of the population worldwide (16). Excessive accumulation of triglycerides in hepatocytes is the hallmark of NAFLD, which is due to the imbalance between lipid deposition and clearance (17). Although investigators have recently reported the molecular mechanisms of NAFLD pathogenesis (18-20), they still require further research. In this study, we first found that the expression levels of YB-1 and β-catenin were elevated in mouse NAFLD livers. Then, in vitro analysis confirmed that the effect of YB-1 on lipid synthesis and β-oxidation in LO2 cells was facilitated by regulating the Wnt/β-catenin signaling pathway. Additional analyses identified that YB-1 develops a complex with pGSK3β to regulate the Wnt/β-catenin signaling pathway and its target CyclinD1 in steatosis LO2 cells. Finally, we also confirmed that the effect of YB-1 on lipid synthesis and β-oxidation in mouse NAFLD livers was facilitated by regulating the Wnt/β-catenin signaling pathway.Recent investigations have confirmed that YB-1, as a member of the cold shock protein family, plays a pivotal role in the progression of liver injury and fibrosis, and the initiation and development of hepatic carcinoma (21-23). In our previous study, we found that YB-1 regulated Collagen I secretion in hepatic progenitor cells via PDGFR-β/ERK/p90RSK Signalling, and influenced the progression of liver fibrogenesis (24). Liu and colleagues found that t YB-1 augments sorafenib resistance through the PI3K/Akt signaling pathway in HepG2, a human hepatocarcinoma cell line (25). Wang and colleagues demonstrated that in acute liver injury model in C57BL/6J mouse induced by Lipopolysaccharide/D-galactosamine, phosphorylation YB-1 inhibition could downregulate the expression of Nlrp3 inflammasome, and protecting acute liver injury (23). Interestingly, McCauley et al. found that YB-1 participated in fatty acid synthesis in clear cell renal carcinoma (10). However, up to now, there have been few studies on the effects of YB-1 on lipid metabolism in hepatocytes. This investigation demonstrated YB-1 upregulation in mouse NAFLD livers and steatosis LO2 cells induced by PA.To investigate the correlation between the expression level of YB-1 and lipid metabolism, we established an LO2 cell NAFLD model in vitro, and confirmed that YB-1 was highly activated in the progression of LO2 cell lipid synthesis. Meanwhile, fat synthetases SREBP-1c and LXRa were also highly activated, while β-oxidation-related enzymes FXR1 and PPARα were inhibited. We also found that the concentrations of inflammatory cytokines TNFα and IL-6 were higher in the supernatants of the steatosis LO2 cell group. Follow-up investigations revealed that inhibiting YB-1 through YB-1 gene silencing decreased lipid synthesis and the expression levels of SREBP-1c and LXRa, but increased the expression levels of FXR1 and PPARα. However, YB-1 upregulation by YB-1 gene overexpression increased lipid synthesis and the expression levels of SREBP-1c and LXRa, but decreased the expression levels of FXR1 and PPARα. Finally, we also found that the concentrations of TNFα and IL-6 were lower in the supernatants of LO2 cells transfected with a lentivirus of YB-1 gene silencing, but the concentrations of TNFα and IL-6 were higher in the supernatants of LO2 cells transfected with a lentivirus of YB-1 overexpression. These data indicated that YB-1 could participate in LO2 cell lipid metabolism.GSK3β is a main protein of the multi-protein destruction complex. In unstimulated cells, the ubiquitin proteases after phosphorylation by GSK3β were shown to degrade β-catenin, which resulted in β-catenin not being able to translocate to the cell nucleus, and the Wnt/β-catenin signaling pathway was inactivated. In unstimulated cells, non-phosphorylated cytoplasmic β-catenin translocated/accumulated within the nucleus to enable downstream gene regulatory activity (26,27). Recently, a series of investigations indicated that the activation of the Wnt/β-catenin signaling pathway contributes to liver injury induced by alcohol consumption (13), and its downregulation increased the levels of proteins involved in glucose aerobic metabolism and β-oxidation in a mouse swimming training model (28). The above data demonstrate that the Wnt/β-catenin signaling pathway plays an important role in inflammation and metabolism, though the involvement of Wnt/β-catenin signaling in lipid metabolism and the inflammatory response of the liver remains uncertain. This investigation confirmed that enhanced triggering of Wnt/β-catenin took place in the process of liver and LO2 cell steatosis in vivo and in vitro, and that inhibiting the expression of YB-1 by downregulating the YB-1 gene suppressed the activation of this pathway and then decreased lipid synthesis and inflammatory responses. These findings were reversed through β-catenin overexpression. Next, we confirmed that promoting the expression of YB-1 by upregulating YB-1 gene expression increased the activation of this pathway and then increased lipid synthesis and inflammatory responses. However, this phenomenon was reversed by inhibition of β-catenin.These results were similar to previous studies which indicated that the accumulation of β-catenin in the nucleus promoted lipogenesis in fish, and pGSK3β, a phosphorylated form of GSK3β, could form a destruction complex with other proteins to regulate Wnt/β-catenin triggering (29,30). In addition, this investigation also revealed that the inhibition of pGSK3β could activate the Wnt/β-catenin signaling pathway, but that increased pGSK3β suppressed the activation of this pathway, similar to the findings of previous studies (31-33). Recently, some investigations found that YB-1 could form protein complexes with other proteins to perform a series of physiological functions (34,35). In this study, we also found that YB-1 could form a complex with pGSK3β to regulate the Wnt/β-catenin signaling pathway. Although this investigation of the molecular mechanisms underlying liver lipid metabolism and inflammatory responses did not bring about extensive evidence, such results can certainly provide further insights into the mechanisms of liver lipid metabolism.The article’s supplementary files as
Authors: Naga Chalasani; Zobair Younossi; Joel E Lavine; Michael Charlton; Kenneth Cusi; Mary Rinella; Stephen A Harrison; Elizabeth M Brunt; Arun J Sanyal Journal: Hepatology Date: 2017-09-29 Impact factor: 17.425
Authors: Clarissa Berardo; Laura Giuseppina Di Pasqua; Marta Cagna; Plinio Richelmi; Mariapia Vairetti; Andrea Ferrigno Journal: Int J Mol Sci Date: 2020-12-17 Impact factor: 5.923
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6