DEP domain containing 1B (DEPDC1B) exerts the tumor promoter in hepatocellular carcinoma through activating p53 signaling pathway via kinesin family member 23 (KIF23).

Hepatocellular carcinoma (HCC) is closely associated with chronic liver disease and possesses a high incidence. DEP domain containing 1B (DEPDC1B) expression has been found to be upregulated in HCC according to bioinformatics analysis. This paper sought to study the specific role of DEPDC1B in HCC. The data of DEPDC1B expression and individual overall survival in HCC and normal liver tissues were acquired from UALCAN database. The association between DEPDC1B and the downstream signal, kinesin family member 23 (KIF23), was determined using LinkedOmics and STRING database, and subsequently confirmed by co-immunoprecipitation assay. The expression levels of DEPDC1B and KIF23 in normal hepatic epithelial cells and HCC cell lines were assessed by RT-qPCR and Western blotting, respectively. Following transfection with small interference RNA-DEPDC1B, the influences of DEPDC1B knockdown on cell proliferation, colony formation, cell cycle, cell invasion, migration, and KIF23 expression were evaluated. In addition, the effects of KIF23 overexpression on the above aspects of HCC cells were also determined, as well as the expression level of p53 signaling-related proteins. The results indicated that DEPDC1B was highly expressed in HCC cells. DEPDC1B knockdown inhibited the proliferation, migration, invasion, cycle, and KIF23 expression in HCC cells. Moreover, KIF23 overexpression reversed the inhibitory effect of DEPDC1B knockdown in HCC cells and the activation of the p53 signaling. In conclusion, DEPDC1B knockdown exerts anti-cancer role in HCC by activating the p53 signaling through KIF23.

Introduction

Hepatocellular carcinoma (HCC) is the most common primary liver malignancy in the world, with an increasing incidence [1]. The five-year survival rate of HCC is 18%, only second to pancreatic cancer [2]. However, current treatment options, such as surgery, neoadjuvant chemotherapy, liver transplantation and radiofrequency ablation, can only provide benefit to a minority of patients [3]. To improve the therapeutic approach, numerous investigators have studied HCC in terms of immunotherapy [3], specific virus-related carcinogenesis [4], liquid biopsy [5], and drug therapy [6]. Prognostic molecular biomarkers for HCC, including alpha-fetoprotein (AFP), highly sensitive AFP-L3 (Hs-AFP-L3), des-γ-carboxyprothrombin (DCP) and glypican-3 (GPC3), have also discovered [7]. However, the unsatisfactory survival rate forces us to actively seek more effective biomarkers.

DEP domain containing 1B (DEPDC1B) is a cell cycle regulatory protein that consists of an N-terminal DEP domain and a C-terminal RHO-GAP-like domain [8]. The DEP structural domain acts in mediating membrane localization [9], while the Rho GTPase activating protein (RHO-GAP) structural domain participates in Rho GTPase signaling, which regulates cell motility, growth, differentiation, cytoskeletal reorganization and cell cycle progression [10]. Extensive studies have shown that DEPDC1B is highly expressed in a variety of cancers and has a cancer-promoting effect [8]. For example, Su et al. found that DEPDC1B was overexpressed in the tissues of patients with oral cancer, and considered that DEPDC1B was relevant to the occurrence and progression of oral cancer [11]. In addition, Bai et al found that increased expression of DEPDC1B was significantly associated with advanced clinical stage and lymph node metastasis of prostate cancer. They proposed that DEPDC1B level could be used as an independent predictor of the biochemical relapse-free survival time of patients with prostate cancer [12]. However, the specific mechanism of DEPDC1B in HCC has not been well revealed. Through the analysis of liver hepatocellular carcinoma (LIHC)-related data in the TCGA dataset, the result identified DEPDC1B was a pivotal protein highly associated with histological grade of HCC [13]. Therefore, in this paper, DEPDC1B was selected as the subject to investigate its role in HCC, accompanied by the study on its mechanism of action.

Following the prediction of the downstream target, kinesin family member 23 (KIF23), of DEPDC1B by LinkedOmics database (www.linkedomics.org), the effects of DEPDC1B and KIF23 on HCC cells were studied. The present study aimed to explore the mechanism of DEPDC1B in HCC to verify its potential as a HCC biomarker.

Materials and methods

Cell culture

Normal human liver epithelial cells HHL-5, HCC cell lines SK-Hep-1, HCCLM3, Huh7 were provided by Biovector NTCC Inc. (Beijing, China). The medium for culturing HHL-5 cells was Roswell Park Memorial Institute (RPMI) 1640 with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, the Dulbecco’s modified Eagle medium (DMEM) with 10% fetal bovine serum was for SK-Hep-1, HCCLM3 and Huh7 [14]. The incubator was adjusted to 5% CO2 environment at 37°C.

Cell transfection

Small interference RNA targeting DEPDC1B (si-DEPDC1B-1, target 5ʹ-GCAAGCAGGGAGUUGUUAUTT-3ʹ; si-DEPDC1B-2 target 5ʹ- GAATCACGTTATTGAAGACAT-3ʹ), non-target siRNA (si-NC; 5ʹ-GGTTAATAGTCAACAGAAGTA-3ʹ), pcDNA 3.1 overexpression plasmid KIF23 (Oe-KIF23) and empty overexpression plasmid (Oe-NC) were constructed by Shanghai GenePharma Co., Ltd. (Shanghai, China). These vectors were transfected into HCCLM3 cells utilizing Lipofectamine 2000 in line with the standard procedures of vendor [15]. 48 h after transfection, the interference or overexpression efficiency of these vectors were verified through quantitative real-time polymerase chain reaction (RT-qPCR) and Western blotting.

Western blot assay

The extraction of total proteins from HCCLM3 cells was carried out by the use of an ice-cold RIPA buffer lysis (Beyotime Biotechnology, Shanghai, China). The concentration of the extracted proteins was measured with BCA protein assay kit (Sigma-Aldrich, St. Louis, MO, USA). 20 µg of protein samples were separated with the application of SDS-PAGE, followed by a transferring performed on PVDF membranes (Millipore, Billerica, MA, USA). The membranes were incubated with primary antibodies against DEPDC1B (Thermo Fisher Scientific, PA5-113,277, 1:500), cyclin-dependent kinase (CDK)1 (Abcam, ab201008, 1:1,000), CyclinD1 (Abcam, ab16663, 1:200), KIF23 (Thermo Fisher Scientific, A300-010A, 1:2,000), p53 (Abcam, ab32389, 1:10,000), p21 (Abcam, ab109520, 1:10,000) and GAPDH (Abcam, ab181602, 1:10,000) as the reference. Then the blots were incubated with horseradish peroxidase (HRP)-labeled goat anti-rabbit secondary antibody (Thermo Fisher Scientific, G-21234, 1:100,000). An enhanced chemiluminescence (ECL) detection kit (Cytiva, Shanghai, China) was adopted to develop these images of the protein bands. Finally, the quantification of bands was conducted with the help of Image J software (National Institutes of Health, Bethesda, MA, USA) [16].

RT-qPCR assay

The extraction of total RNA employed TRIeasyTM LS Total RNA Extraction Reagent (Yeasen, Shanghai, China) following the steps recommended by the provider. Then, the extracted samples were centrifuged at 12,000 g for 15 min at 4°C. Total RNA (1 μg) was reversely transcribed into cDNA with the aid of Hifair® III 1st Strand cDNA Synthesis SuperMix for qPCR (Yeasen, Shanghai, China). Subsequently, RT-qPCR were conducted applying a SYBR® Premix Ex Taq™ II kit (Takara, Dalian, Japan) on an ABI PRISM 7300 Sequence Detection system (Applied Biosystems, Foster City, CA, USA). The qPCR thermocycling conditions were as follows: 95°C for 30 sec, 40 cycles of 95°C for 5 sec, 60°C for 30 sec, and 72°C for 10 sec. The relative mRNA expression levels of DEPDC1B and KIF23 were normalized to GAPDH and determined by the use of 2−ΔΔCq method [17]. The used primers were as follows (5ʹ-3ʹ): DEPDC1B, forward, CGAAGAGTCCAGTTTCAGAAATCC and reverse, CAGCTGTGGTTTCGGTTTGG; KIF23 forward, CCATAAAACCCAAACCTCCACA and reverse, CTATGGGAACGGCTGGACTC; GAPDH forward, GACTCATGACCACAGTCCATGC and reverse, AGAGGCAGGGATGATGTTCTG. All reactions were run in triplicate.

Cell proliferation assay

Cell proliferation in HCCLM3 cells was determined by the use of cell counting (CCK)-8 method [18] following the guidelines of the manufacturer. Briefly, HCCLM3 cells treated in different groups were plated in 96-well plates and cultured at 37°C for 24, 48 and 72 h. After addition of 10 μl of CCK-8 solution (Dojindo, Tokyo, Japan) and incubation for 2 h, the optical density was measured with the aid of a microplate reader at 450 nm.

Colony formation assay

Briefly, HCCLM3 cells transfected with si-DEPDC1B or Oe-KIF23 were seeded into six-well plates and made into cell suspensions. Then the cell suspension was cultured in an incubator with 5% CO2 at 37°C for 2 weeks. When visible colonies appeared in the medium, the culture was terminated and the solution was discarded. After carefully washing twice with PBS, the cells were fixed with methanol for 15 min and then stained with Giemsa for 10 min [19]. Finally, the number of colony (more than 50 cells) was analyzed using Image J software (National Institutes of Health, Bethesda, MA, USA).

Flow cytometry detection

For cell cycle analysis, the cells were collected and added with 0.7 ml of anhydrous ethanol and fixed at −20°C for 24 h. Then, the cells were centrifuged at 3000 rpm for 30 s. The supernatant was discarded and the cells were washed with phosphate buffer saline (PBS) once more. The precipitated cells were cultured with 100 μl of 1 mg/ml RNase A and placed at 37°C for 30 min. 400 μl of 50 μg/ml propidium iodide (PI) was added and incubated with the cells in the dark for 10 min. Finally, data were analyzed using FlowJo (v7.6.1; FlowJo, LLC) following flow cytometry on a FACSCalibur flow cytometer (BD Biosciences) [20].

Wound healing assay

Cells were cultured overnight in 6-well plates to reach 90% fusion. The cell layer was scratched with a 200 μl pipette tip. Non-adherent cells were washed away with sterile PBS and the plates were incubated in serum-free medium at 37°C in a 5% CO2 incubator [21]. The width of cell scratches at 0 and 24 h was observed and photographed with a light microscope (Olympus Corporation; magnification, x100).

Transwell assay

100 µl of Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) was first pre-coated in the upper chamber of the transwell. The transfected HCCLM3 cells were inoculated into the upper chamber of the 6-well transwell. 600 μl of medium containing 10% FBS was added to the lower chamber. 24 h later, uninvaded cells were removed with a cotton swab. Then, cells were first fixed with methanol and then stained with 0.1% crystal violet for 15 min [22]. Finally, five randomly selected areas on the filter membrane were photographed and counted under a light microscope (Olympus Corporation; magnification, x100).

Co-immunoprecipitation (Co-IP) assay

The protein interaction between DEPDC1B and KIF23 was explored in HCCLM3 cells by Co-IP [23]. Cells were lysed on ice in RIPA buffer containing protease inhibitors for 30 minutes. The supernatant was collected and a small amount of it was taken as Input.2 µg of KIF23 or lgG antibody was added into the remaining supernatant for incubation overnight at 4°C. Afterward, 10 µl of protein A agarose beads was then added for another 2 h of incubation at 4°C. After the immunoprecipitation reaction, the agarose beads was centrifuged at 3,000 rpm for 3 min at 4°C. Next, the supernatant was discarded and the agarose beads were washed with 1 ml of lysis buffer for three times. Finally, the protein complexes were washed and boiled for 5 min. The precipitated protein was then analyzed using Western blot assay as described above. DEPDC1B mouse antibody (Abnova, H00055789-M01, 1:1,000) and HRP conjugated goat anti-mouse secondary antibody (Thermo Fisher Scientific, 31,430, 1:10,000) was used to avoid the interference of antibody in IP.

Bioinformatics analysis

UALCAN database [24] is a web resource based on The Cancer Genome Atlas (TCGA) for analyzing cancer data. LinkedOmics database [25] includes data from TCGA and 10 Clinical Proteomics Tumor Analysis Consortium (CPTAC) cancer cohorts. STRING database [26] provides online search for known protein interaction relationships.

Statistical analysis

All experiment results were analyzed using GraphPad Prism 8.0 software (GraphPad Software, Inc.). Data were presented as the mean ± standard deviation (SD). Differences between two groups were analyzed using Student’s t test or multiple groups by one-way analysis of variance [27]. P < 0.05 indicates that the available data are statistically significant.

Results

The results of the present study indicated that DEPDC1B was highly expressed in HCC cells. DEPDC1B knockdown was found to inhibit cell proliferation, migration, invasion, KIF23 expression, as well as cell cycle. Nevertheless, KIF23 overexpression reversed the inhibitory effect of DEPDC1B knockdown on HCC cells. In addition, DEPDC1B knockdown could activate the p53 signaling through KIF23. To sum up, DEPDC1B knockdown exerts anti-cancer roles in HCC by activating the p53 signaling through KIF23.

DEPDC1B is highly expressed in HCC cells

To verify the expression level of DEPDC1B in HCC cells and normal liver tissues, we first queried its expression and overall survival rate in HCC cells and normal liver tissues on the UALCAN database. Based on Figure 1(a-b), DEPDC1B expression was higher in HCC cells and the overall survival rate was relatively higher in individuals with low expression of DEPDC1B. In addition, RT-qPCR and Western blot analysis suggested that the mRNA and protein expression of DEPDC1B was higher in HCC cell lines SK-Hep-1, HCCLM3 and Huh7 than that in normal hepatic epithelial cells HHL-5 (Figure 1c-d). Particularly, the expression of DEPDC1B was relatively high in HCCLM3 cells, so the HCCLM3 cell line was chosen for the follow-up study.

Figure 1.

DEPDC1B is highly expressed in HCC cells. (a-b) DEPDC1B expression level and overall survival rate in HCC cells and normal liver tissues were showed on UALCAN database. (c-d) DEPDC1B expression in the HHL-5, SK-Hep-1, HCCLM3 and Huh7 was examined by RT-qPCR and Western blot assays. **P < 0.01, ***P < 0.001.

DEPDC1B knockdown inhibits the proliferation, colony formation and G2 phase cell cycle distribution of HCC cells

HCCLM3 cells were transfected with si-DEPDC1B-1/2. Then, the mRNA and protein expression of DEPDC1B were measured by means of RT-qPCR and Western blot to determine its transfection efficiency. As shown in Figure 2(a-b), DEPDC1B expressed a marked decreased level in the si-DEPDC1B-1/2 groups compared with si-NC group and was slightly lower in the si-DEPDC1B-1 group than that in the si-DEPDC1B-2 group, indicated that si-DEPDC1B-1 had a higher interference efficiency. Accordingly, si-DEPDC1B-1 was chosen for the next experiment. Subsequently, the viability of HCCLM3 cells transfected with si-DEPDC1B-1 at 24, 48, 72 h was assessed by CCK-8. It is easily seen in Figure 2(c) that the viability of HCCLM3 cells decreased sharply at 24, 48 and 72 h in the si-DEPDC1B group compared with the si-NC group. Likewise, by transfection of si-DEPDC1B-1 into HCCLM3 cells, the number of colonies with more than 50 cells was significantly reduced in the si-DEPDC1B group compared with the si-NC group (Figure 2(d)). Additionally, the cell cycle distribution was detected by flow cytometry. Compared with the si-NC group, the proportion of HCCLM3 cells transfected with si-DEPDC1B was slightly increased in the G1 phase, and was significantly decreased in the S phase but elevated rapidly again in the G2 phase, indicating that si-DEPDC1B can induce cell cycle distribution at G2/M phase (Figure 2(e-f)). Moreover, the expressions of cell cycle-related proteins CDK1, CyclinD1 was also reduced in HCCLM3 cells transfected with si-DEPDC1B, compared with the si-NC group (Figure 2(g)). These results suggest that DEPDC1B knockdown could inhibit the proliferation and cause G2 phase cell cycle distribution of HCC cells.

Figure 2.

DEPDC1B knockdown inhibits the proliferation, colony formation and G2 phase cell distribution of HCC cells. (a-b) The mRNA and protein expression of DEPDC1B in the control, si-NC, si-DEPDC1B-1/2 groups were assessed by RT-qPCR and Western blot in HCCLM3 cells. ***P < 0.001 (c) The viability of HCCLM3 cells transfected with si-NC or si-DEPDC1B was detected at 24, 48 and 72 h by CCK-8. *P < 0.05, **P < 0.01, ***P < 0.001 (d) The number of colonies of HCCLM3 cells in the control, si-NC and si-DEPDC1B groups was measured by colony formation experiment. (e-f) Cell cycle distribution of HCCLM3 cells in the control, si-NC and si-DEPDC1B groups was detected by flow cytometry. **P < 0.01 (g) The protein levels of CDK1 and CyclinD1 of HCCLM3 cells in the control, si-NC and si-DEPDC1B groups were measured by Western blot. **P < 0.01.

DEPDC1B knockdown inhibits the migration and invasion in HCC cells

The migration and invasion ability of HCC cells transfected with si-DEPDC1B were detected by wound healing and transwell, respectively. Figure 3(a-b) presented a decreased cell migration rate of HCCLM3 cells at 0 and 24 h in the si-DEPDC1B group compared with the si-NC group. Meanwhile, the relative cell invasive rate of HCCLM3 cells also dropped remarkably in the si-DEPDC1B group as compared to the si-NC group. These results indicate that the migration and invasion ability of HCC cells transfected with si-DEPDC1B is inhibited by DEPDC1B knockdown.

Figure 3.

DEPDC1B knockdown inhibits the migration and invasion in HCC cells. (a-b) Relative cell migration rate of HCCLM3 cells in the control, si-NC and si-DEPDC1B groups was assessed by wound healing assay. **P < 0.01 (c-d) Relative cell invasive rate of HCCLM3 cells in the control, si-NC and si-DEPDC1B groups was determined by transwell assay. **P < 0.01.

DEPDC1B knockdown inhibits KIF23 expression in HCC cells

To confirm the relationship between DEPDC1B and KIF23, genes associated with DEPDC1B were analyzed by LinkedOmics database. The results showed that DEPDC1B was most correlated with KIF23 gene in HCC cells (Figure 4(a-d)). Meanwhile, the STRING database found a possible co-expression relationship between the two genes (Figure 4(e)). Subsequently, RT-qPCR and Western blot detected a higher mRNA and protein expression of KIF23 in HCCLM3 cells than that in normal hepatic epithelial cell HL7002 (figure 4(f-g)). And si-DEPDC1B induced a lower level of KIF23 protein expression in comparison with the si-NC group (Figure 4(h)). To further confirm the relationship between DEPDC1B and KIF23, co-immunoprecipitation experiment was performed. The result also verified the co-expression relationship between DEPDC1B and KIF23 (Figure 4(i)). Taken together, the above results reveal that DEPDC1B knockdown inhibits the expression of KIF23 in HCC cells.

Figure 4.

DEPDC1B knockdown inhibits KIF23 expression in HCC cells. (a-d) Genes related to DEPDC1B were showed on LinkedOmics database. (e) Predicted interactive relationship between DEPDC1B and KIF23 was showed on STRING database. (f-g) The mRNA and protein expression of KIF23 in HL-7002 and HCCLM3 cells were detected by means of RT-qPCR and Western blot. **P < 0.01, ***P < 0.001 (h) KIF23 protein expression in HCCLM3 cells transfected with si-NC or si-DEPDC1B was examined by Western blot. **P < 0.01 (i) The protein expressions of DEPDC1B in the Input, Anti-IgG and Anti-KIF23 groups were detected by Western blot.

KIF23 reverses the inhibitory effect of si-DEPDC1B on the proliferation, colony formation and the G2 phase cell distribution of HCC cells

HCCLM3 cells were transfected with Oe-KIF23. KIF23 overexpression efficiency was determined by RT-qPCR and Western blot assays. Figure 5(a-b) presented a rapid rise in the mRNA and protein level of KIF23 in the Oe-KIF23 group as compared to the Oe-NC group. As mentioned above, si-DEPDC1B could inhibit the viability of HCCLM cells. However, co-transfection of si-DEPDC1B and Oe-KIF23 increased the viability rate (vs Oe-NC; Figure 5(c)). Moreover, colony formation experiment demonstrated that HCCLM3 cells co-transfected with si-DEPDC1B and Oe-KIF23 showed a greater number of colonies compared to those solely transfected with si-DEPDC1B (Figure 5(d)). Meanwhile, the cell cycle of HCCLM3 co-transfected with si-DEPDC1B and Oe-KIF23 was restored slightly (vs Oe-NC; Figure 5(e-f)). As indicated in Figure 5(g), a marked increase in the expressions of CDK1 and Cyclin D1 related to cell cycle was found in HCCLM3 cells co-transfected with si-DEPDC1B and Oe-KIF23, by contrast with those transfected with Oe-NC. These results suggest that KIF23 overexpression reverses the inhibitory effect of si-DEPDC1B on the proliferation of HCC cells and restores the G2 phase cell cycle.

Figure 5.

KIF23 reverses the inhibitory effect of si-DEPDC1B on the proliferation, colony formation and the G2 phase cell distribution of HCC cells. (a-b) The mRNA and protein level of KIF in HCCLM3 transfected with Oe-NC or Oe-KIF23 were measured by RT-qPCR and Western blot. **P < 0.01, ***P < 0.001. (c) The viability of HCCLM3 cells in the control, si-NC, si-DEPDC1B, si-DEPDC1B+Oe-NC and si-DEPDC1B+Oe-KIF23 groups was assessed at 24, 48, 72 h by CCK-8. *P < 0.05, **P < 0.01. (d) The number of colonies of HCCLM3 cells in the control, si-NC, si-DEPDC1B, si-DEPDC1B+Oe-NC and si-DEPDC1B+Oe-KIF23 groups was measured by colony formation experiment. (e-f) Cell cycle distribution of HCCLM3 cells in the control, si-NC, si-DEPDC1B, si-DEPDC1B+Oe-NC and si-DEPDC1B+Oe-KIF23 groups was detected by flow cytometry. ***P < 0.001, ###P < 0.001. (g) The protein levels of CDK1 and CyclinD1 of HCCLM3 cells in the control, si-NC, si-DEPDC1B, si-DEPDC1B+Oe-NC and si-DEPDC1B+Oe-KIF23 groups were measured by Western blot. ***P < 0.001, #P < 0.05, ###P < 0.001.

KIF23 reverses the inhibitory effect of si-DEPDC1B on migration and invasion of HCC cells

It was previously confirmed that si-DEPDC1B inhibited the migration and invasion ability of HCCLM3 cells. Nevertheless, the assays of wound healing and transwell showed that overexpression of KIF23 reversed the inhibitory effect of si-DEPDC1B on the migration and invasion of HCCLM3 cells (vs Oe-NC; Figure 6(a-d)).

Figure 6.

KIF23 reverses the inhibitory effect of si-DEPDC1B on migration and invasion of HCC cells cancer cells. (a-b) Relative cell migration rate of HCCLM3 cells in the control, si-NC, si-DEPDC1B, si-DEPDC1B+Oe-NC and si-DEPDC1B+Oe-KIF23 groups was assessed by wound healing assay. ***P < 0.001, ##P < 0.01. (c-d) Relative cell invasive rate of HCCLM3 cells in the control, si-NC, si-DEPDC1B, si-DEPDC1B+Oe-NC and si-DEPDC1B+Oe-KIF23 groups was determined by transwell assay. ***P < 0.001, ##P < 0.01.

DEPDC1B activates p53 signaling pathway via KIF23 in HCC cells

p53 is a tumor suppressor gene that regulates the cell cycle and prevents cell carcinogenesis [28]. On the basis of Western blot analysis, the protein levels of p53 and p21 that were related to p53 signaling pathway were elevated in the si-DEPDC1B group compared with the si-NC group but were brought down by KIF23 overexpression (vs Oe-NC; Figure 7). Thus, DEPDC1B could activate p53 signaling pathway via KIF23 in HCC cells.

Figure 7.

DEPDC1B activates p53 signaling pathway via KIF23 in HCC cells. The protein levels of p53 and p21 of HCCLM3 cells in the control, si-NC, si-DEPDC1B, si-DEPDC1B+Oe-NC and si-DEPDC1B+Oe-KIF23 groups were measured by Western blot. ***P < 0.001, ###P < 0.001.

Discussion

Hepatocellular carcinoma (HCC) is one of the most deadly and prevalent cancers in humans [29]. Poor prognosis, frequent recurrence and metastasis cause high mortality rate of HCC. Therefore, inhibiting the malignant behaviors of HCC cells and improving prognosis are effective strategies to treat HCC. DEPDC1B is a DEP domain-containing protein located on human chromosome 5q12 [8], and is overexpressed in a variety of cancers, including oral cancer [11], prostate cancer [12], breast cancer [30] and bladder cancer [31]. Herein, following the analysis of DEPDC1B expression and its association with patients overall survival rate, it was found that DEPDC1B expression was upregulated in HCC tissues and the overall survival rate was relatively higher in individuals with low expression. In addition, our experiments found that DEPDC1B expression levels in the experimental HCC cells were all overexpressed compared with the normal epithelial cells, which was in line with the high expression in other cancers from previous studies. Subsequently, to determine the specific role of DEPDC1B in HCC, we transfected siRNA targeting DEPDC1B into HCC cells. According to our experimental results, HCC cells transfected with si-DEPDC1B showed suppressed viability, colony formation ability, cell migration and invasion ability. Unexpectedly, a latest article published in 2021 also suggested that overexpressed DEPDC1B played a role in promoting cancer in HCC [32]. That article declared that the effect of DEPDC1B on the progression of HCC was mediated by CDK1. These results are consistent with the results of the present article. However, this article further analyzed the genes relevant to DEPDC1B through the LinkedOmics and STRING databases, and found that KIF23 played an important role in the regulation pathway of DEPDC1B. Combining the mentioned research and our research results, it can be concluded that DEPDC1B may regulate CDK1 through KIF23 to regulate the cell cycle. Furthermore, our study also found that KIF23 inhibited the activation of the p53 signaling pathway caused by DEPDC1B knockdown. This finding enriches the understanding of the mechanism of action of DEPDC1B in HCC.

The downstream of DEPDC1B, KIF23, is a member of kinesin motor protein involved in the regulation of cytokinesis and acts as an important regulator in cancer biology [33]. In this paper, similar to DEPDC1B, KIF23 expression was also upregulated in HCC cells. Co-IP experiment demonstrated the interaction between KIF23 and DEPDC1B. To evaluate the effect of KIF23 on HCC cells transfected with si-DEPDC1B, KIF23 overexpression vector was constructed and transfected in HCC cell RT-qPCR. Subsequent experiments indicated that KIF23 overexpression reversed the inhibitory effects of si-DEPDC1B on the proliferation, migration, and invasion of HCC cells. Like DEPDC1B, KIF23 was overexpressed in various cancers, such as pancreatic cancer, breast cancer and primary lung cancer [34-36]. In addition, a study revealed that KIF23 expression was significantly upregulated in HCC cells, and the knockdown of KIF23 inhibited the proliferation of HCC cells by affecting the cell cycle [33].

p53 signaling pathway is a tumor suppressor that is induced through cell injury and ultimately promotes cell cycle distribution or apoptosis [37]. It has been shown that altered expression of p53 is associated with pathological features of the diseases such as histological grade, survival and response to treatment [38]. Accordingly, p53 signaling pathway may act as an essential role in the treatment of HCC. One study showed that DEPDC1B knockdown upregulated the expressions of CDK inhibitors p21, p27, p53 and p57, which suppressed cell cycle progression at different phases [8]. Furthermore, studies have revealed that p21 is associated with cell differentiation, tumor growth and metastatic potential in melanoma [39]. To verify the role of the p53 signaling pathway in HCC, we examined the protein expression levels of p53 and p21. In HCC cells transfected with si-DEPDC1B, p53 and p21 protein expression was both elevated. In addition, overexpression of KIF23 in turn decreased p53 and p21 protein expressions. Based on the above experiment results, DEPDC1B could activate the p53 signaling pathway through KIF23. However, due to the limitations of cellular experiments, in vivo experiments are also worthwhile in the future.

Conclusion

According to the bioinformatics analysis, elevated DEPDC1B expression is associated with the overall survival rate. The experimental results indicated that DEPDC1B knockdown could inhibit the growth and progression of HCC cells through the activation of p53 signaling pathway via KIF23. The findings of the present study suggest that the two biomarkers, DEPDC1B and KIF23, may provide more accurate and valuable information for the diagnosis and prognosis of HCC in the future.

Click here for additional data file.