Literature DB >> 34979450

Induction of autophagy via the ROS-dependent AMPK-mTOR pathway protects copper-induced spermatogenesis disorder.

Hongrui Guo1, Yujuan Ouyang2, Heng Yin2, Hengmin Cui3, Huidan Deng4, Huan Liu2, Zhijie Jian2, Jing Fang1, Zhicai Zuo1, Xun Wang1, Ling Zhao1, Yanqiu Zhu2, Yi Geng2, Ping Ouyang2.   

Abstract

Copper (Cu) is a necessary micronutrient at lower concentration, while excessive Cu exposure or Cu homeostasis disorders can lead to toxicity. The mechanism of male reproductive toxicity induced by Cu is still unknown. This study aims to investigate whether autophagy plays an important role in copper-induced spermatogenesis disorder in vivo and vitro. The present study showed that copper sulfate (CuSO4) might significantly promote autophagy level in the testis and mouse-derived spermatogonia cell line GC-1 spg cells. Concurrently, CuSO4 could induce autophagy via AMPK-mTOR pathway that downregulated p-mTOR/mTOR and subsequently upregulated p-AMPKα/AMPKα as well as p-ULK1/ULK1. In the meanwhile, CuSO4 treatment could also increase expression levels of the autophagy-related proteins. Then, the role of oxidative stress in CuSO4-induced autophagy was investigated. The findings demonstrated that oxidative stress inhibitor (NAC) attenuated CuSO4-induced autophagy in vivo and vitro, reversing the activation for AMPK-mTOR pathway. Additionally, the study also investigated how autophagy worked under the spermatogenesis disorder induced by CuSO4. Inhibition of autophagy could decrease cell viability, and enhance the ROS accumulation and apoptosis in the GC-1 cells, meanwhile, the spermatogenesis disorder, oxidative stress and histopathological changes were increased in the testis. Furthermore, co-treatment with the apoptosis inhibitor (Z-VAD-FMK) could decrease the spermatogenesis disorder but not influence autophagy. Besides, the crosslink between autophagy and ferroptosis were also measured, the data showed that inhibition of autophagy could suppress CuSO4-induced ferroptosis in in vivo and vitro. Altogether, abovementioned results indicated that CuSO4 induced autophagy via oxidative stress-dependent AMPK-mTOR pathway in the GC-1 cells and testis, and autophagy activation possibly led to the generation of protection mechanism through oxidative damage and apoptosis inhibition, however, autophagy also aggravate CuSO4 toxicology through promoting ferroptosis. Overall, autophagy plays a positive role for attenuating CuSO4-induced testicular damage and spermatogenesis disorder. Our study provides a possible targeted therapy for Cu overload-induced reproduction toxicology.
Copyright © 2021 The Authors. Published by Elsevier B.V. All rights reserved.

Entities:  

Keywords:  Apoptosis; Autophagy; CuSO(4); Oxidative stress; Spermatogenesis disorder

Mesh:

Substances:

Year:  2021        PMID: 34979450      PMCID: PMC8728583          DOI: 10.1016/j.redox.2021.102227

Source DB:  PubMed          Journal:  Redox Biol        ISSN: 2213-2317            Impact factor:   11.799


Introduction

Copper (Cu) refers to an essential trace element of humans and animals as the co-factor of proteins and enzymes required by diverse physiological reactions in the organic biological system [1]. The requirement of Cu in human and animals is extremely low, and thus, Cu accumulation exceeding metabolic requirements or Cu homeostasis disorder may result in toxic effects [2]. Epidemiological research has demonstrated Cu may be released into the surroundings from lots of sources in industrial and agricultural activities. Cu pollution in river has been reported all over the world. Moreover, evidence shows that excessive Cu can give rise to severe detrimental influences on the health of animals and plants, resulting in multiple organ failure [2]. Excessive Cu is likely to trigger severe detrimental influences on health, including immunotoxicity, haematotoxicity, pulmonary toxicity, hepatotoxicity, nephrotoxicity as well as neurotoxicity [[3], [4], [5], [6]]. According to the former research results, Cu induces hepatotoxicity such as oxidative stress, apoptosis as well as inflammation [7,8]. CuSO4 treatment causes pulmonary fibrosis via TGF-β1/Smad pathway- and MAPKs pathway-induced activation of EMT [3], and oxidative stress, apoptosis as well as inflammation [9]. Besides, more than 10 mg/kg CuSO4 will trigger oxidative stress, apoptosis, DNA damage, as well as inflammation in mice spleen [4]. Recently, the research shows that excessive exposure to Cu may trigger reproduction toxicity, however, the exactly mechanism still remains unclear. Wang et al. [10] have reported that environmental exposure to Cu may exert detrimental effects on human reproductive health, including impaired semen quality, spermatozoa apoptosis and damaged sperm DNA. And high levels of Cu could decrease the sperm cells count progressively motile sperm cells after 1 h in fertile male volunteers from the southern region of Poland [11]. Moreover, the results of Li et al. [12] also have demonstrated that seminal plasma Cu values also displayed a negative correlation with normomorph sperm rate in men from Cu pollution area. Roychoudhury et al. [13,14] report the impairment of male fertility during CuSO4 treatment, involving the reduction of spermatozoa concentration, viability, and motility in the rabbit. Zhang et al. [15] prove Cu accumulation within the testis, and discover that serum testosterone (T) and luteinizing hormone (LH) levels of mice show a significant fall following intraperitoneal injection with CuCl2 (2.5–5 mg/kg). According to our former studies, CuSO4 can induce spermatogenesis disorder, which has a connection with DNA damage and germ cell apoptosis mediated by oxidative stress [16]. Autophagy, acknowledged to be a famous conserved self-cannibalization mechanism, is playing an important part during biogenic process to acclimatize intracellular and extracellular environment changes [17]. Whereas, abnormal autophagy is potentially induced by specific abnormal stimuli and stresses, thus causing damage. The autophagy process consists of four crucial pathways: initiation, nucleation, maturation, and degradation [18]. In many stress, autophagy and apoptosis are all induced and control the cell survive or death. In general, autophagy can block apoptosis induction. Whereas, under certain circumstances, autophagy possibly induces apoptosis or necrosis, and it is also proved to cause autophagic cell death through excessively degrading the cytoplasm [17]. Our former research has also shown that excessive Cu may enhance hepatocyte autophagy [19]. Li et al. [20] have demonstrated that autophagy processes is obtained in Cu-induced myocardium injury. At the same time, chronic exposure to Cu may trigger autophagy of kidney in mice [21]. Up to now, it has been verified excessive Cu can cause testicular injury, while the exact mechanism is still unknown yet. And, it is not known whether autophagy is involved in Cu-induced spermatogenesis disorder. Therefore, the current work will generate the CuSO4 intoxication model in the testis of mice and the mouse-derived spermatogonia cell line GC-1 spg cells, and then confirm the induction of autophagy and the potential mechanism of CuSO4-induced autophagy. At the same time, autophagy's role in the spermatogenesis disorders induced by Cu and the association of autophagy, oxidative stress, apoptosis and ferroptosis are studied by this research.

Materials and methods

Materials and reagents

CuSO4 came from Chengdu Kelong Chemical Co., Ltd. (Chengdu, China). N-acetylcysteine (NAC) (A9165) and 3-MA (M9281) were provided by Sigma Aldrich. Z-VAD-FMK (C1202) and 2′,7′-dichlorofluorescin diacetate (DCFH-DA) (S0033 M) were provided by Beyotime Biotechnology. Compound C (Com C) (S7306) was purchased from Selleck. Antibodies involved in the current research included: rabbit anti-LC3B (2775S CST), rabbit anti-p62 (5114S CST), rabbit anti-AMPKα (5832 CST), rabbit anti-p-AMPKα (2535 CST), rabbit anti-mTOR (2972 CST), rabbit anti-p-mTOR (2971 CST), rabbit anti-ULK1 (8054 CST), rabbit anti-p-ULK1(Ser757) (6888 CST), rabbit anti-Atg16L1 (8089T CST), rabbit anti-Atg7 (8558 CST), rabbit anti-Atg3 (3415 CST), rabbit anti-Beclin1 (12994 CST), anti-rabbit cleaved-caspase-3 (9664 CST), anti-rabbit cleaved-caspase-8 (9496 CST), anti-rabbit cleaved-caspase-9 (9509 CST), anti-rabbit caspase-12 (ab18766 Abcam), and anti-rabbit cleaved-PARP (5625 CST), anti-rabbit GPX4 (ab125066 Abcam), anti-rabbit COX-2 (abs131986 Absin Biotechnology), anti-rabbit FTH1 (bs-5907R Bioss Biotechnology) and anti-rabbit NCOA4 (DF4255 Affinity biosciences).

Animals and treatments

In the present study, 240 healthy male ICR mice (8 weeks old) came from Experimental Animal Corporation of Dossy (Chengdu, China). These mice had 1-week acclimatization and were provided with sufficient water and food. The mice were classified into 4 groups at random (n = 60 each). Intragastric doses of distilled water were given to the control group, and intragastric doses of CuSO4 (10, 20 or 40 mg/kg) were provided for the experimental group. Following the treatment for 21 and 42 days, mice needed to be executed for collecting testis samples required by follow-up analysis. For investigating the effects of oxidative stress on autophagy induced by CuSO4, we co-treated oxidative stress inhibitor NAC with CuSO4. 32 healthy male ICR mice (8 weeks old) were classified into 4 groups at random. In terms of control group, mice received intragastric doses of distilled water and intraperitoneal injection with PBS. For CuSO4 alone group, mice received intragastric doses of CuSO4 (40 mg/kg) and intraperitoneal injection with PBS. For NAC alone group, mice received intragastric doses of distilled water and intraperitoneal injection with NAC (100 mg/kg body weight/day). For NAC + CuSO4 group, mice had intraperitoneal injection with NAC (100 mg/kg body weight/day) 3h after the intragastric doses of CuSO4 (40 mg/kg). Following treatment for 42 days, mice needed to be executed for collecting testis samples required by follow-up analysis. For investigating the effects of autophagy on spermatogenesis disorder induced by CuSO4, the autophagy inhibitor 3-MA was co-treated with CuSO4 according to reference [22] and a pilot experiment. 32 healthy male ICR mice (8 weeks old) were classified into 4 groups at random. For control group, mice received intragastric doses of distilled water and intraperitoneal injection with PBS. For CuSO4 alone group, mice received intragastric doses of CuSO4 (40 mg/kg) and intraperitoneal injection with PBS. For 3-MA alone group, mice received intragastric doses of distilled water and intraperitoneal injection with 3-MA (30 mg/kg body weight/day). For 3-MA + CuSO4 group, mice received intraperitoneal injection with 3-MA (30 mg/kg body weight/day) 30 min after intragastric doses of CuSO4 (140 mg/kg). Following treatment for 3 days, mice needed to be executed 24 h after the final treatment for collecting testis samples required by follow-up analysis. For investigating the role of apoptosis in spermatogenesis disorders induced by CuSO4, the apoptosis inhibitor Z-VAD-FMK was co-treated with CuSO4. 32 healthy male ICR mice (8 weeks old) were randomly classified into 4 groups. For control group, mice received intragastric doses of distilled water and intraperitoneal injection with PBS. For CuSO4 alone group, mice received intragastric doses of CuSO4 (40 mg/kg) and intraperitoneal injection with PBS. For Z-VAD-FMK alone group, mice received intragastric doses of distilled water and intraperitoneal injection with Z-VAD-FMK (10 mg/kg body weight/day). For Z-VAD-FMK + CuSO4 group, mice had intraperitoneal injection with Z-VAD-FMK (10 mg/kg body weight/day) 30 min after intragastric doses of CuSO4 (140 mg/kg). Following treatment for 3 days, mice needed to be executed 24 h after the final treatment for collecting testis samples required by follow-up analysis. Each mouse was utilized in the current experiment. This experimental protocol obtained approval from the Animal Care and Use Committee of Sichuan Agricultural University (Chengdu, China).

Cell culture

Mouse GC-1 spg cells were cultured in DMEM with 10% fetal bovine serum (FBS) supplementing 0.1 mg/ml streptomycin and 100 IU/ml penicillin, and incubated at the conditions of 37 °C, 5% CO2. The cells were subcultured as the cell growth density reached about 80% to ensure cell nutrition and keep cells in the logarithmic growth phase.

MTT assay

Mouse GC-1 spg cells were plated onto a 96-well plate with a number of 1 × 104 cells per well. The cells were treated with 0, 0.4, 0.8 or 1.6 mM CuSO4 for 12 or 24 h or treated with 0 or 1.6 mM for 24 h in the presence or absence of NAC (5 mM) or 3-MA (1 mM) or Z-VAD-FMK (20 μM). Cell viability was measured with the addition of MTT, and the absorbance was determined by using a spectrophotometer at 490 nm.

Sperm quality

Epididymal sperm needed to be suspended in normal saline at 37 °C for suspension preparation. Subsequently, the approach developed in Ommati et al. [23] had been chosen for measuring the number of sperms.

Pathological observations

Mice were executed for collecting testis samples. Afterwards, every sample needed to receive 4% paraformaldehyde fixation, gradient ethanol dehydration and paraffin embedding. Then, these samples were cut into slices (with a thickness of 4 μm) and dyed by hematoxylin and eosin (H&E). With optical microscope, histopathological symptoms could be detected.

Determination of oxidative damage and antioxidant parameters

Testis samples were washed within chilled saline solution, weighed and homogenized with nine volumes of ice-cold 0.9% NaCl solution, followed by centrifugation at 3500 rpm for 10 min at 4 °C. By inserting the supernatant to new eppendorf tubes, the content of T-AOC (Cat. No. A015), SOD (Cat. No. A001-1), CAT (Cat. No. A007-1), GSH-Px (Cat. No. A005), GSH (Cat. No. A061-1), as well as MDA (Cat. No. A003-1) was investigated using the commercially available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) in accordance with the specifications.

Apoptosis analysis by flow cytometry

GC-1 spg cells were treated with CuSO4, and washed by the pre-chilled PBS (pH 7.2–7.4), followed by suspension within PBS to 1 × 106 cells/ml. Briefly, the 5 ml tube was added with 100 μL cell suspension, followed by 15 min Annexin V- FITC (5 μL, Cat: 51-65874X, BD, USA) and PI (5 μL, Cat: 51-66211E, BD, USA) staining under 25 °C in dark. After the addition of 1 × binding buffer (400 μl), the flow cytometry (BD FACS Calibur) was used to assess stained cells in 40 min after they were prepared. In addition, the ModFit LT v3.0 software was employed to analyze the flow cytometric data.

ROS detection by fluorescence staining

The ROS was measured using DCFH-DA. Briefly, GC-1 cells were treated CuSO4 with/without NAC or 3-MA. After washing by PBS twice, cells were subjected to 10 min incubation using the 20 μM DCFH-DA for 20 min. Then, cells were rinsed by PBS twice and fixed with 4% paraformaldehyde. All images were acquired with a fluorescence microscope.

ROS detection by flow cytometry

GC-1 spg cells were treated CuSO4 with/without NAC or 3-MA, and washed by the pre-chilled PBS (pH 7.2–7.4), followed by suspension within PBS to 1 × 106 cells/ml. Briefly, the 5 ml tube was added with 300 μL cell suspension, followed by 20 min DCFH-DA (20 μM) staining. After washing with PBS, cells were centrifuged at 600×g for 5 min. Then, supernatants were discarded, cells were resuspended in 0.5 mL PBS, and BD FACS Calibur flow was adopted for determining cell number.

Western blotting

Testes needed to be lysed in the pre-chilled RIPA buffer. Afterwards, cell lysate was centrifugated for 15 min at 15000 g and 4 °C. 12% SDS-PAGE was made for separating proteins, with subsequent transfer to PVDF membranes. Afterwards, 5% non-fat milk dissolved in TBST was employed for blocking membranes, followed by incubation by using primary antibodies as well as HRP-labeled secondary antibodies successively. The ECL detection kit (GE Healthcare, Piscataway, NJ, USA) was used in visualization. The protein bands could be visualized with Bio-Rad ChemiDoc XRS+ System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). ImageJ2x software had been adopted for determining the significant difference in protein expression.

RNA extraction and quantitative real-time PCR (qRT-PCR)

RNAiso Plus (9109; Takara, China) was chosen in total RNA extraction according to the manufacturer's protocol. cDNA synthesis was made with RNA (1 μg) in combination with the Prim-ScriptTM RT reagent Kit (RR047A, Takara, China) in accordance with corresponding specifications. The gene data came from National Center for Biotechnology Information (NCBI), and Sangon (Shanghai, China) took charge of primer design and synthesis. The mRNA expression was assessed using SYBR® Premix Ex TaqTMII (RR820A, Takara, China) according to corresponding specifications. All the reactions needed to be performed at 95 °C for 10 min, and then at 95 °C for 10 min, at 60 °C for 20 s, and at 72 °C for 20 s. Subsequently, melt curves were investigated to identify PCR specificity. Additionally, the results of qRT-PCR were analyzed using the 2−ΔΔCT method [24]. Table 1 showed qRT-PCR primers.
Table 1

Sequence of primers used in qRT-PCR.

Target geneAccession numberPrimerPrimer sequence (5′–3′)Product sizeTm (°C)
CuZn-SODNM-011434ForwardGGGTTCCACGTCCATCAGTA113bp56.8
ReverseCAGGTCTCCAACATGCCTCT
Mn-SODNM-013671ForwardAACTCAGGTCGCTCTTCAGC113bp59.3
ReverseCTCCAGCAACTCTCCTTTGG
CATNM-009804ForwardCCTATTGCCGTTCGATTCTC119bp58.6
ReverseCCCACAAGATCCCAGTTACC
GSH-PxNM_008160ForwardTACACCGAGATGAACGATCTG102bp60.2
ReverseATTCTTGCCATTCTCCTGGT
Beclin1NM-019584ForwardTGCAGGTGAGCTTCGTGTG124bp58.6
ReverseGCTCCTCTCCTGAGTTAGCCT
Atg12NM-026217ForwardTAAACTGGTGGCCTCGGAAC146bp60.2
ReverseATCCCCATGCCTGGGATTTG
Atg5NM-053069ForwardCAAGGATGCGGTTGAGGC167bp58.8
ReverseTGAGTTTCCGGTTGATGG
Atg16L1NM-001205392ForwardCTGAGAAGGCCCAAGAAGCC221bp58.5
ReverseGACAGAGCGTCTCGTAGCTG
Atg7NM_001253718ForwardTCGAAAACCCCATGCTCCTC175bp59.4
ReverseAGGGCCTGGATCTGTTTTGG
Atg3NM_026402ForwardTGAAGGGAAAGGCTCTGGAAG141bp57.4
ReverseATTGCCATGTTGGACAGTGGT
β-actinNM-007393ForwardGCTGTGCTATGTTGCTCTAG117bp60.9
ReverseCGCTCGTTGCCAATAGTG
Sequence of primers used in qRT-PCR.

Determination of iron content in the liver

Testes tissues were weighed and homogenized with 9-fold volume of normal saline, then followed by centrifugated at 4 °C for 10min at 3500 rpm, the supernatant was collected. Iron content was investigated using the commercially available kits (A039-2-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China) in accordance with the specifications.

Statistical analysis

The results had been illustrated by mean ± SD. One-way ANOVA was chosen for comparing significant differences between control group and experimental group with SPSS17.0. P < 0.05 suggested the value was statistically significant.

Results

CuSO4 induced alterations in testicular structure

According to Fig. 1a, CuSO4 resulted in the histopathological alterations of testis, and the histopathological alterations were time-and dose-dependent (CuSO4 treatment) increased. Spermatogonia and spermatocytes experienced a significant fall. Spermatogenic cells experienced vacuolar degeneration and necrosis.
Fig. 1

CuSO4 induces alterations in testicular structure.

(a) Testicular histopathological figures of mice exposed to CuSO4. Histopathological lesions are found in three Cu-treated groups. Spermatogonia and spermatocytes are significantly decreased, and spermatogenic cells show vacuolar degeneration and necrosis. (b) The quantification of seminiferous tubule area (μm2). (c) The spermatogonia count. (d) The spermatocyte count. (e) The round spermatid count (f) The elongated spermatid count. (g) The ratio of elongated spermatids to round spermatids. Data are presented with the means ± standard deviation. **p < 0.01, compared with the control group.

CuSO4 induces alterations in testicular structure. (a) Testicular histopathological figures of mice exposed to CuSO4. Histopathological lesions are found in three Cu-treated groups. Spermatogonia and spermatocytes are significantly decreased, and spermatogenic cells show vacuolar degeneration and necrosis. (b) The quantification of seminiferous tubule area (μm2). (c) The spermatogonia count. (d) The spermatocyte count. (e) The round spermatid count (f) The elongated spermatid count. (g) The ratio of elongated spermatids to round spermatids. Data are presented with the means ± standard deviation. **p < 0.01, compared with the control group. To determine the CuSO4-targeted germ cells, we counted the number of spermatogonia, spermatocytes, round spermatids and elongated spermatids in per testis. There was no significant change in the number of spermatogonia (Fig. 1b). As indicated by the results, spermatocytes were remarkably reduced (p < 0.01) in three CuSO4 treatment groups on the 21st and 42nd days during this experiment in contrast to the control group (Fig. 1c). The numbers of round spermatids were apparently declined (p < 0.05 or < 0.01) in 40 mg/kg treatment on the 21st day and in three CuSO4 treatments on the 42nd day (Fig. 1d). Compared with the control group, elongated spermatids remarkably reduced (p < 0.01) in 20 and 40 mg/kg treatments on the 21st day and in three CuSO4 treatments on the 42nd day of the experiment (Fig. 1e). And, the ratio of elongated spermatids to round spermatids was also remarkably reduced (p < 0.01) in three CuSO4 treatment groups on the 21st and 42nd days during this experiment compared with the control group (Fig. 1f).

CuSO4 induced autophagy through the AMPK-mTOR signaling

In this study, we explored whether autophagy was playing a role in testicular damages induced by CuSO4. The LC3 conversion and p62 degradation are the crucial biomarkers of autophagy. In Fig. 2 a and b, the LC3-II/LC3-I ratio remarkably grew (p < 0.01) in the 40 mg/kg group on the 21st day and in three CuSO4 treatment groups on the 42nd day. In addition, p62 protein expression levels experienced a significant increase (p < 0.01) in the 20 and 40 mg/kg groups on the 21st day and in three CuSO4 groups on the 42nd day in contrast to the control group. Above results indicated that CuSO4 could induce autophagy in the testis.
Fig. 2

CuSO4 induces autophagy via AMPK/mTOR pathway in the testis.

(a) The Western blot results of LC3 and p62 protein expression. (b) The quantification of LC3-II/LC3-I and p62. (c) The Western blot results of p-AMPK, AMPK, p-mTOR, mTOR, p-ULK1 and ULK1 protein expression. (d) The quantification of p-AMPK/AMPK. (e) The quantification of p-mTOR/mTOR. (f) The quantification of p-ULK1/ULK1. Data are presented with the means ± standard deviation. *p < 0.05 and **p < 0.01, compared with the control group.

CuSO4 induces autophagy via AMPK/mTOR pathway in the testis. (a) The Western blot results of LC3 and p62 protein expression. (b) The quantification of LC3-II/LC3-I and p62. (c) The Western blot results of p-AMPK, AMPK, p-mTOR, mTOR, p-ULK1 and ULK1 protein expression. (d) The quantification of p-AMPK/AMPK. (e) The quantification of p-mTOR/mTOR. (f) The quantification of p-ULK1/ULK1. Data are presented with the means ± standard deviation. *p < 0.05 and **p < 0.01, compared with the control group. Under external stimuli, the AMPK-mTOR signal transduction pathway is playing a crucial role in cell autophagy. To explore how AMPK-mTOR affected CuSO4-induced autophagy in the testis, the current research used western blotting in the measurement of crucial proteins associated with AMPK-mTOR signal transduction pathway. According to Fig. 2c, d and f, p-AMPK, p-mTOR and p-ULK1 protein expression levels remarkably enhanced on the 21st and 42nd days in comparison with the control group. In addition, the experiment also measured proteins related to autophagy flux. In accordance with the findings, Beclin1, Atg5-Atg12, Atg7, Atg3 and Atg16L1 protein expression levels experienced a significant increase in CuSO4-treated groups in this experiment (Fig. 3a–f). Simultaneously, the experiment detected the mRNA expression levels in aforementioned autophagy-linked proteins. The mRNA expression levels in Beclin1 and Atg12 experienced a significant increase (p < 0.05 or p < 0.01) in CuSO4-treated groups (Fig. 3g and i). There were insignificant alternations in mRNA expression levels of Atg5, Atg7 as well as Atg16L1 in the CuSO4-treated groups (Fig. 3h, j and k).
Fig. 3

CuSO4 increases autophagy-related proteins in the testis.

(a) The Western blot results of Beclin1, Atg5-Atg12, Atg16L1, Atg7 and Atg3 protein expression. The quantification of Beclin1 (b), Atg5-Atg12 (c), Atg16L1 (d), Atg7 (e) and Atg3 (f) protein expression. The mRNA expression of Beclin1 (g), Atg5 (h), Atg12 (i), Atg16L1 (j), Atg7 (k) and Atg3 (l). Data are presented with the means ± standard deviation. *p < 0.05 and **p < 0.01, compared with the control group.

CuSO4 increases autophagy-related proteins in the testis. (a) The Western blot results of Beclin1, Atg5-Atg12, Atg16L1, Atg7 and Atg3 protein expression. The quantification of Beclin1 (b), Atg5-Atg12 (c), Atg16L1 (d), Atg7 (e) and Atg3 (f) protein expression. The mRNA expression of Beclin1 (g), Atg5 (h), Atg12 (i), Atg16L1 (j), Atg7 (k) and Atg3 (l). Data are presented with the means ± standard deviation. *p < 0.05 and **p < 0.01, compared with the control group. Furthermore, mouse-derived spermatogonia cell line GC-1 spg cells were treated with CuSO4 for 12 or 24 h. The results showed that CuSO4 treatment induced autophagy which featured by increasing in the LC3-II/LC3-I ratio and decreasing in p62 protein level (Fig. 4a and b). Meanwhile, the AMPK-mTOR signal pathway proteins including p-AMPK, p-mTOR were significantly increased (Fig. 4c and d). To confirm the role of AMPK-mTOR signal pathway in CuSO4-induced autophagy in the GC-1 spg cells. AMPK inhibitor (Compound C) was co-treatment with CuSO4. We found that the inhibition of p-AMPK by compound C could abolish the induction of autophagy by CuSO4 (Fig. 4f), indicating that AMPK-mTOR signal pathway was involved in CuSO4-induced autophagy of mouse GC-1 spg cells.
Fig. 4

CuSO4 induces autophagy via AMPK/mTOR pathway in the GC-1 spg cells.

(a) Cells were treated with CuSO4 (0, 0.4, 0.8 and 1.6 mM) for 12h and 24h. The Western blot results of LC3 and p62 protein expression. (b) The quantification of LC3-II/LC3-I and p62. (c) Cells were treated with CuSO4 (0, 0.4, 0.8 and 1.6 mM) for 12h and 24h. The Western blot results of p-AMPKα, AMPKα, p-mTOR and mTOR protein expression. (d) The quantification of p-AMPKα/AMPKα and p-mTOR/mTOR. (e) Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of Compound C (20 μM, 4h). The Western blot results of p-AMPK, AMPK, p-mTOR, mTOR and LC3 protein expression. Data are presented with the means ± standard deviation. *p < 0.05 and **p < 0.01, compared with the control group.

CuSO4 induces autophagy via AMPK/mTOR pathway in the GC-1 spg cells. (a) Cells were treated with CuSO4 (0, 0.4, 0.8 and 1.6 mM) for 12h and 24h. The Western blot results of LC3 and p62 protein expression. (b) The quantification of LC3-II/LC3-I and p62. (c) Cells were treated with CuSO4 (0, 0.4, 0.8 and 1.6 mM) for 12h and 24h. The Western blot results of p-AMPKα, AMPKα, p-mTOR and mTOR protein expression. (d) The quantification of p-AMPKα/AMPKα and p-mTOR/mTOR. (e) Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of Compound C (20 μM, 4h). The Western blot results of p-AMPK, AMPK, p-mTOR, mTOR and LC3 protein expression. Data are presented with the means ± standard deviation. *p < 0.05 and **p < 0.01, compared with the control group.

CuSO4 induced autophagy through oxidative stress

Our previous study has demonstrated that CuSO4 treatment can induce oxidative stress in mice testis. Oxidative stress has certain effects during CuSO4-induced apoptosis as well as DNA damage [16]. Nevertheless, it remains unclear if oxidative stress plays a role in the autophagy induced by CuSO4. For determining how oxidative stress affects the CuSO4-induced autophagy, NAC was used for inhibiting the oxidative stress in vivo and vitro. In the vitro study, ROS contents were significantly increased in CuSO4 treatment GC-1 spg cells (Fig. 5a and b). NAC can efficiently suppress the ROS accumulation induced by CuSO4 (Fig. 5c). We found that the inhibition of ROS by NAC could rescue the inhibition of cell viability and the promotion of apoptosis by CuSO4 (Fig. 5d and e). The reduction of ROS could inhibit the autophagy (the reduction of LC3-II/LC3-I ratio) that induced by CuSO4 (Fig. 5f). Furthermore, the AMPK-mTOR pathway, including p-AMPK and p-mTOR was dramatically reversed by NAC (Fig. 5f).
Fig. 5

CuSO4 induces autophagy through ROS in the GC-1 spg cells.

Cells were treated with CuSO4 (0, 0.4, 0.8 and 1.6 mM) for 12h and 24h. Relative ROS amounts determined by flow cytometry (a), relative ROS amounts determined by DCFH-DA staining of CuSO4-primed RAW264.7 cells (b). Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of NAC (5 mM, 24h), relative ROS amounts determined by flow cytometry (c), the changes of ROS (d) and apoptosis (e), the Western blot results of p-AMPK, AMPK, p-mTOR, mTOR and LC3 protein expression (f). Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

CuSO4 induces autophagy through ROS in the GC-1 spg cells. Cells were treated with CuSO4 (0, 0.4, 0.8 and 1.6 mM) for 12h and 24h. Relative ROS amounts determined by flow cytometry (a), relative ROS amounts determined by DCFH-DA staining of CuSO4-primed RAW264.7 cells (b). Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of NAC (5 mM, 24h), relative ROS amounts determined by flow cytometry (c), the changes of ROS (d) and apoptosis (e), the Western blot results of p-AMPK, AMPK, p-mTOR, mTOR and LC3 protein expression (f). Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01. Similar to the in vitro study, as shown in Fig. 6a, b, c, d and e, the T-AOC activity, SOD activity, CAT activity, GSH-Px activity as well as GSH content had been significantly suppressed in CuSO4-treated group, and, co-treatment with NAC could abolish CuSO4-induced suppression. In the meanwhile, NAC co-treatment could decrease MDA production induced by CuSO4 (Fig. 4f). Also, co-treatment with NAC could abolish the inhibition of CuZn-SOD, Mn-SOD, CAT and GSH-Px mRNA expression levels by CuSO4 (Fig. 6g). Testicular histopathological changes induced by CuSO4 was abolished after a co-treatment with NAC (Fig. 6h). Meanwhile, Fig. 6i illustrated that testicular autophagy was inhibited by co-treatment with CuSO4 and NAC, containing the reduction of LC3-II/LC3-I ratio and the growth of p62 protein expression levels, and p-AMPK, p-mTOR and p-ULK1 was dramatically reversed by NAC (Fig. 6j). The above obtained results indicate that CuSO4-induced testicular autophagy may arise from oxidative stress-mediated AMPK-mTOR signal pathway.
Fig. 6

Oxidative stress is the inductor of CuSO4-induced autophagy in the testis.

The changes of T-AOC activity (a), SOD activity (b), CAT activity (c), GSH-Px activity (d), GSH content (e), MDA content (f), and the changes of CuZn-SOD, Mn-SOD, CAT and GSH-Px mRNA expression (g) after co-treatment with NAC and CuSO4. (h) The histopathological lesions after co-treatment with NAC and CuSO4. (i) The Western blot results of LC3 and p62 in the testis after co-treatment with NAC and CuSO4. (j) The Western blot results of p-AMPK, AMPK, p-mTOR, mTOR, p-ULK1 and ULK1 after co-treatment with NAC and CuSO4. Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

Oxidative stress is the inductor of CuSO4-induced autophagy in the testis. The changes of T-AOC activity (a), SOD activity (b), CAT activity (c), GSH-Px activity (d), GSH content (e), MDA content (f), and the changes of CuZn-SOD, Mn-SOD, CAT and GSH-Px mRNA expression (g) after co-treatment with NAC and CuSO4. (h) The histopathological lesions after co-treatment with NAC and CuSO4. (i) The Western blot results of LC3 and p62 in the testis after co-treatment with NAC and CuSO4. (j) The Western blot results of p-AMPK, AMPK, p-mTOR, mTOR, p-ULK1 and ULK1 after co-treatment with NAC and CuSO4. Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

Autophagy plays the protective role in CuSO4-induced ROS production and apoptosis in GC-1 spg cells

It has reported that the double-edged sword (cytoprotection and cytotoxicity) of autophagy in disease. For investigating the relationship of CuSO4-induced autophagy with cell viability, apoptosis and ROS of GC-1 spg cells, a rescue experiment was carried out with the specific autophagy inhibitor 3-MA and Atg5 knock down. The results showed that CuSO4 treatment combined with autophagy inhibition (3-MA or Atg5 knock down) significantly suppressed the expression of LC3-II/LC3-I (Fig. 7a and e). And, down-regulation of cell viability (Fig. 7b and f) and up-regulation of apoptosis (Fig. 7d and h) and ROS production (Fig. 7c and g) were observed in the combination of CuSO4 and autophagy inhibition (3-MA or Atg5 knock down) group when compared with those in CuSO4-treated group. Furthermore, apoptosis inhibition (Z-VAD-FMK) could rescue the inhibition of cell viability by CuSO4 (Fig. 7i and j), but not affect the autophagy (Fig. 7k).
Fig. 7

Autophagy plays the protective role in CuSO4-induced ROS production and apoptosis in GC-1 spg cells.

Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of 3-MA (1 mM, 1h), the changes of autophagy (a), cell viability (b), the ROS amounts (c), and the percentage of apoptosis in GC-1 spg cells (d). Cells transfected with control shRNA and ATG5 shRNA exposed with CuSO4 (1.6 mM) for 24 h, changes of autophagy (e), cell viability (f), the ROS amounts (g), and the percentage of apoptosis in GC-1 spg cells (h). Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of Z-VAD-FMK (20 μM, 1h), the changes of the percentage of apoptosis (i), and autophagy (j). Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

Autophagy plays the protective role in CuSO4-induced ROS production and apoptosis in GC-1 spg cells. Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of 3-MA (1 mM, 1h), the changes of autophagy (a), cell viability (b), the ROS amounts (c), and the percentage of apoptosis in GC-1 spg cells (d). Cells transfected with control shRNA and ATG5 shRNA exposed with CuSO4 (1.6 mM) for 24 h, changes of autophagy (e), cell viability (f), the ROS amounts (g), and the percentage of apoptosis in GC-1 spg cells (h). Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of Z-VAD-FMK (20 μM, 1h), the changes of the percentage of apoptosis (i), and autophagy (j). Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

Autophagy triggered CuSO4-induced ferroptosis in GC-1 spg cells

Ferroptosis is a newly defined programmed cell death process with the hallmark of the accumulation of iron-dependent lipid peroxides [25]. It has reported that autophagy also involved in the regulation of ferroptosis [25]. Next, the relationship of CuSO4-induced autophagy with ferroptosis was explored. As shown in Fig. 8a and b, the glutathione eroxidase 4 (GPX4) protein expression levels experienced a significant (p < 0.05 or < 0.01) increase and cyclooxygenase 2 (COX-2) protein expression levels were significantly (p < 0.05 or < 0.01) decreased in the CuSO4-treated cells. GPX4 and COX-2 are the marker of ferroptosis. Above results indicated that CuSO4 could induce ferroptosis in the GC-1 spg cells. And, co-treatment with autophagy inhibition (3-MA or Atg5 knock down) could rescue the induction of ferroptosis by CuSO4 (Fig. 8c and d), indicating that autophagy triggered ferroptosis. Meanwhile, in comparison with CuSO4 treatment group, protein expression levels in nuclear receptor coactivator 4 (NCOA4) and ferritin heavy chain 1 (FTH1) were increased in the CuSO4 group co-treatment with autophagy inhibition (3-MA or Atg5 knock down) group (Fig. 8c and d), indicating that autophagy triggered ferroptosis through degradation of ferritin.
Fig. 8

Autophagy triggered ferroptosis in CuSO4-treated GC-1 spg cells.

(a) Cells were treated with CuSO4 (0, 0.4, 0.8 and 1.6 mM) for 12h and 24h. The Western blot results of GPX4 and COX-2 protein expression. (b) The quantification of GPX4 and COX-2. (c) Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of 3-MA (1 mM, 1h), the changes of GPX4, COX-2, NCOA4 and FTH1. (d) Cells transfected with control shRNA and ATG5 shRNA exposed with CuSO4 (1.6 mM) for 24 h, changes of GPX4, COX-2, NCOA4 and FTH1. Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

Autophagy triggered ferroptosis in CuSO4-treated GC-1 spg cells. (a) Cells were treated with CuSO4 (0, 0.4, 0.8 and 1.6 mM) for 12h and 24h. The Western blot results of GPX4 and COX-2 protein expression. (b) The quantification of GPX4 and COX-2. (c) Cells were treated with CuSO4 (1.6 mM, 24h) in the presence/absence of 3-MA (1 mM, 1h), the changes of GPX4, COX-2, NCOA4 and FTH1. (d) Cells transfected with control shRNA and ATG5 shRNA exposed with CuSO4 (1.6 mM) for 24 h, changes of GPX4, COX-2, NCOA4 and FTH1. Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

Autophagy protected the CuSO4-induced spermatogenesis disorder in the testis

The vitro study showed the protection role of autophagy. Next, the role of autophagy was verified in the mice. Fig. 9a demonstrated that autophagy was significantly inhibited by co-treatment with CuSO4 and 3-MA group. Testicular histopathological changes showed greater severity in the 3-MA+CuSO4 group in comparison with the CuSO4-treated group (Fig. 9b). Besides, the sperm motility (Fig. 9c) and sperm concentrations (Fig. 9d) in the 3-MA+CuSO4 group were remarkably inferior (p < 0.01) to those in the CuSO4-treated group. The above findings indicated that autophagy played the protective role in CuSO4-induced testicular damage and spermatogenesis disorder.
Fig. 9

Autophagy plays the protective role in CuSO4-induced spermatogenesis disorder in the testis.

(a) The Western blot results of LC3 and p62 after co-treatment with autophagy inhibitor (3-MA) and CuSO4. (b) The histopathological lesions after co-treatment with autophagy inhibitor (3-MA) and CuSO4. (c) The sperm motility changes after co-treatment with autophagy inhibitor (3-MA) and CuSO4. (d) The sperm concentration changes after co-treatment with autophagy inhibitor (3-MA) and CuSO4. Data are presented with the means ± standard deviation. *p < 0.05, **p < 0.01.

Autophagy plays the protective role in CuSO4-induced spermatogenesis disorder in the testis. (a) The Western blot results of LC3 and p62 after co-treatment with autophagy inhibitor (3-MA) and CuSO4. (b) The histopathological lesions after co-treatment with autophagy inhibitor (3-MA) and CuSO4. (c) The sperm motility changes after co-treatment with autophagy inhibitor (3-MA) and CuSO4. (d) The sperm concentration changes after co-treatment with autophagy inhibitor (3-MA) and CuSO4. Data are presented with the means ± standard deviation. *p < 0.05, **p < 0.01. As shown in Fig. 10a, T-AOC activity, SOD activity, CAT activity, GSH-Px activity as well as GSH content in the 3-MA+CuSO4 group remarkably reduced in comparison with the CuSO4-treated group, and, MDA content was increased. Meanwhile, mRNA expression levels in CuZn-SOD, Mn-SOD, CAT and GSH-Px seemed lower compared with those in the CuSO4-treated group (Fig. 10b). Based on these findings, autophagy exerted the protective role in CuSO4-induced testicular oxidative damage. Former research proves that CuSO4 treatment induces apoptosis in mouse testis [16]. Subsequently, we explored whether autophagy played the protection role through apoptosis in the testis. In comparison with CuSO4 treatment group, protein expression levels in apoptosis-linked proteins such as cleaved-caspase-3, cleaved-caspase-8, cleaved-caspase-9, cleaved-PARP and caspase-12 were increased in the 3-MA+CuSO4 group (Fig. 10c). Besides, similar to the vitro experiment results, Fig. 10d illustrated the co-treatment with CuSO4 and Z-VAD-FMK could suppress apoptosis induced by CuSO4, however, it was not affect the autophagy. Testicular histopathological changes could be eradicated in part in the Z-VAD-FMK+CuSO4 group in comparison with the CuSO4-treated group (Fig. 10e). And, the sperm motility (Fig. 10f) and sperm concentrations (Fig. 10g) in the Z-VAD-FMK +CuSO4 group were remarkably greater (p < 0.05 or p < 0.01) compared with those in the CuSO4-treated group. These results indicated that autophagy played protective role through inhibition of oxidative damage and apoptosis.
Fig. 10

Autophagy inhibits CuSO4-induced oxidative stress and apoptosis in the testis.

(a) The changes of T-AOC activity, SOD activity, CAT activity, GSH-Px activity, GSH content, and MDA content after co-treatment with 3-MA and CuSO4. (b) The changes of CuZn-SOD, Mn-SOD, CAT and GSH-Px mRNA expression after co-treatment with 3-MA and CuSO4. (c) The Western blot results of cleaved-caspase-3, cleaved-caspase-8, cleaved-caspase-9, caspase-12 and cleaved-PARP after co-treatment with autophagy inhibitor (3-MA) and CuSO4. (d) The Western blot results of cleaved-caspase-3, cleaved-caspase-8, cleaved-caspase-9, caspase-12, cleaved-PARP and LC3 after co-treatment with apoptosis inhibitor (Z-VAD-FMK) and CuSO4. (e) The histopathological lesions after co-treatment with apoptosis inhibitor (Z-VAD-FMK) and CuSO4. (f) The sperm motility changes after co-treatment with apoptosis inhibitor (Z-VAD-FMK) and CuSO4. (g) The sperm concentration changes after co-treatment with apoptosis inhibitor (Z-VAD-FMK) and CuSO4. Data are presented with the means ± standard deviation. *p < 0.05, **p < 0.01.

Autophagy inhibits CuSO4-induced oxidative stress and apoptosis in the testis. (a) The changes of T-AOC activity, SOD activity, CAT activity, GSH-Px activity, GSH content, and MDA content after co-treatment with 3-MA and CuSO4. (b) The changes of CuZn-SOD, Mn-SOD, CAT and GSH-Px mRNA expression after co-treatment with 3-MA and CuSO4. (c) The Western blot results of cleaved-caspase-3, cleaved-caspase-8, cleaved-caspase-9, caspase-12 and cleaved-PARP after co-treatment with autophagy inhibitor (3-MA) and CuSO4. (d) The Western blot results of cleaved-caspase-3, cleaved-caspase-8, cleaved-caspase-9, caspase-12, cleaved-PARP and LC3 after co-treatment with apoptosis inhibitor (Z-VAD-FMK) and CuSO4. (e) The histopathological lesions after co-treatment with apoptosis inhibitor (Z-VAD-FMK) and CuSO4. (f) The sperm motility changes after co-treatment with apoptosis inhibitor (Z-VAD-FMK) and CuSO4. (g) The sperm concentration changes after co-treatment with apoptosis inhibitor (Z-VAD-FMK) and CuSO4. Data are presented with the means ± standard deviation. *p < 0.05, **p < 0.01. Otherwise, in the testis, the results also showed that CuSO4 treatment induce ferroptosis, which featured by decrease in GPX4 and increase in COX-2 (Fig. 11a and b). And, the iron concentration in the testis was significantly increased in the CuSO4-treated mice (Fig. 11c). Similar to the vitro experiment results, Fig. 11d illustrated the co-treatment with CuSO4 and 3-MA could suppress ferroptosis induced by CuSO4. This results indicated that autophagy also played adverse role through promotion of ferroptosis.
Fig. 11

Autophagy promoted CuSO4-induced ferroptosis in the testis.

(a) The Western blot results of GPX4 and COX-2 protein expression. (b) The quantification of GPX4 and COX-2. (c) The content of iron concentration in the testis. (d) The Western blot results of GPX4, COX-2, NCOA4 and FTH1 after co-treatment with autophagy inhibitor (3-MA) and CuSO4. Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

Autophagy promoted CuSO4-induced ferroptosis in the testis. (a) The Western blot results of GPX4 and COX-2 protein expression. (b) The quantification of GPX4 and COX-2. (c) The content of iron concentration in the testis. (d) The Western blot results of GPX4, COX-2, NCOA4 and FTH1 after co-treatment with autophagy inhibitor (3-MA) and CuSO4. Data are presented with the means ± standard deviation. *p < 0.05 **p < 0.01.

Discussion

Cu is an important trace element for human and animals at low concentration, whereas, over-exposure to Cu has detrimental influences. At present, the environmental pollution is the important resource of overexposure to copper. Otherwise, dis-regulated copper levels can be also discovered from many metabolic and neurodegenerative illnesses [26]. Recent studies have demonstrated that the male fertility is also the target of Cu toxicology, however, the precise mechanism is still unclear. Our previous study have proved that Cu can accumulated into the testis [27], which consistent with other studies [28]. Cu is absorbed from the intestines of animals, and then transported into the blood, and then accumulated in tissues and organs as blood circulates. During this process, copper transporter (Ctr) family, p-type ATPase and copper chaperones also play key roles in copper absorption, transport and homeostasis [[29], [30], [31]]. However, the specific mechanism of copper accumulation in testis has not been studied. It has been also reported that over-exposure Cu can induce testicular damage and decrease serum testosterone production [32,33]. Our previous study has demonstrated excessive exposure to Cu induces reproductive toxicity, such as the decrease of sperm concentration and sperm motility, and growth of sperm malformation rate [16]. In the present study, germ cell counting and histopathological analysis showed a decrease in the number of spermatocytes, round spermatids and elongated spermatids. Despite that there are many studies concerning Cu-related testicular toxicology, few of them concentrate on the mechanism of testicular toxicology about Cu. Autophagy, a form of cell decomposition, has certain associations with the transfer of material from cytoplasm to lysosomes [17]. Autophagy is reported to be involved in various diseases and heavy metals toxicology. Recent studies have shown that uncontrolled or overstimulated autophagy may intermediate cell death. Reports prove that Cu can serve as one new autophagy stimulator [34,35]. Whereas, it is still unknown if autophagy is related to Cu reproduction toxicity. In the current study, CuSO4 treatment increased LC3-II/LC3–I ratio and reduced p62 protein expression, indicating the role of CuSO4 in inducing testicular autophagy in mice. Meanwhile, CuSO4 could increase autophagy levels in mouse-derived spermatogonia cell line GC-1 spg cells. In consistence with previous findings, Shao et al. [36] have reported that CuSO4 exposure can induce autophagy in the chicken testis. Additionally, the obtained results from Kang et al. [37] also prove Cu compounds lead to an increase of autophagy in male germ cells. Next, the potential mechanism of autophagy induced by CuSO4 was explored. AMPK-mTOR pathway is an important signaling pathway in autophagy. Autophagy, driven by AMPK, can serve as one crucial sensor to regulate cellular metabolism, and maintain energy homeostasis. AMPK activation possibly results in autophagy by mTOR negative regulation. Additionally, AMPK straightforwardly phosphorylates ULK1 to trigger autophagy. The increase in p-AMPK and p-ULK1 and decrease in p-mTOR reveal that CuSO4 activates AMPK-mTOR pathway in the testis and GC-1 spg cells. Meanwhile the AMPK inhibiter experiment was confirmed that CuSO4 induced autophagy through the AMPK-mTOR pathway. Similar to our results, the results of Liao et al. [38] prove the facilitating role of Cu in autophagy through AMPK-mTOR pathway in chicken kidney. In the meantime, proteins related to autophagy flux had been also observed by the current research. Beclin1, a major gene promoting initiate autophagy, gets engaged in the initiation stage of autophagy. The Atg12-Atg5-Atg16L1 complex seems indispensable to autophagosome formation and makes for phagophore expansion. LC3-I is activated by Atg 7 and conjugated to phosphatidylethanolamine by Atg 3 to form LC3-II, which is referred to as LC3 lipidation. Furthermore, the Atg 12- Atg 3 complex plays a crucial part in basic autophagy flux, endosome function as well as endolysosomal transport during the late nuclear period. According to the results in the present study, Beclin1, Atg5-Atg12, Atg7 Atg3 as well as Atg16L1 all increased in the testis after CuSO4 treatment. Consistent with our results, CuSO4 treatment increases Beclin-1, Atg 7, Atg 5, Atg 3 expressions in the renal tubular epithelial cells of ducks [39]. In addition, Li et al. [20] has indicated that 250 mg/kg Cu treatment can increase mRNA and protein expression levels in Beclin1 and Atg 5 in the myocardium of pigs. Research shows that oxidative damage is important to the testicular damage induced by CuSO4 [40,41]. Our previous study has demonstrated that CuSO4 treatment can induce ROS in mice testis, and ROS exerts significant effects in the apoptosis and DNA damage induced by CuSO4 [16]. It is not known whether ROS is important to CuSO4-induced autophagy. For demonstrating the effects of oxidative stress on autophagy, oxidative stress inhibitor NAC had co-treatment with CuSO4 to check autophagy changes. As indicated by above findings, treatment with NAC could greatly inhibit the growth of CuSO4-induced autophagy in mouse testis and GC-1 spg cells. Moreover, NAC-co-treatment removed the impacts of CuSO4 treatment on the AMPK-mTOR signaling pathway. Autophagy can serve as a double-edged sword to regulate cellular death and survival. Autophagy level seems relatively lower in physiological conditions, which is conducive to the survival of cells. Subject to specific chemicals, autophagy may be remarkably activated, leading to the death of cells. For investigating the role of autophagy in testicular damage and spermatogenesis disorder induced by CuSO4, autophagy inhibitor (3-MA) and Atg5 knock down were used. The results illustrated that autophagy inhibition aggravated the testicular damage and spermatogenesis disorder induced by CuSO4, indicating that autophagy played protective role in CuSO4-induced spermatogenesis disorder. Also, Yang et al. [42] has reported that autophagy may attenuate Cu-induced mitochondrial dysfunction. It has been confirmed that autophagy can inhibit cell death through against apoptosis. To further identify the protective mechanism of autophagy in CuSO4-induced spermatogenesis disorder, as a double-edged sword, a rescue experiment needed to be performed with the given autophagy inhibitor (3-MA) or Atg5 knock down to inhibit the autophagy induced by CuSO4. Indeed, the oxidative damage (or ROS production) and apoptosis were increased when being co-treated with 3-MA or Atg5 knock down and CuSO4 in this work. Consistent with the results in our former research, Wu et al. [43] have illustrated the role of inhibited autophagy in enhancing apoptosis induced by CuSO4 in non-small cell lung cancers. Furthermore, co-treatment apoptosis inhibitor (Z-VAD-FMK) with CuSO4 could dramatically partly abolish CuSO4-induced testicular damage and spermatogenesis disorder, which suggested that autophagy played protective role through inhibition of apoptosis. Recently studies have demonstrated that autophagy also involve in the regulation of ferroptosis, which is a non-apoptotic form of cell death [44]. Next, we explored whether ferroptosis was involved in CuSO4-induced testicular damage and spermatogenesis disorder, and its relationship with autophagy. Indeed, the results showed that CuSO4 treatment could induce ferroptosis in vitro and vivo, which was associated with the up-regulation of COX-2 and down-regulation of GPX-4. Moreover, autophagy inhibition could suppress the ferroptosis induced by CuSO4, indicating that autophagy promote ferroptosis in this study. Several studies have reported that activation of the autophagy pathway promotes ferroptosis by degradation of ferritin [45]. FTH1 is an important ferritin and is a regulatory factor in iron metabolism [44]. NCOA4 is a selective cargo receptor for the autophagic turnover of ferritin [25]. Our results showed that CuSO4 can decrease FTH1 and NCOA4 protein expression, however, co-treatment autophagy inhibition could rescue the reduction of FTH1 and NCOA4, indicating that autophagy triggered ferroptosis through degradation of ferritin. Altogether, abovementioned results indicated that CuSO4 induced autophagy via oxidative stress-dependent AMPK-mTOR pathway in the GC-1 cells and testis, and autophagy play activation possibly led to the generation of protection mechanism through oxidative damage and apoptosis inhibition, however, autophagy also aggravate CuSO4 toxicology through promoting ferroptosis. Overall, autophagy plays a positive role for attenuating CuSO4-induced testicular damage and spermatogenesis disorder. Our study provides a possible targeted therapy for Cu overload-induced reproduction toxicology.

Credit authors contribution statement

Hongrui Guo: Conceptualization, Experiment design, Writing - review & editing, Funding acquisition. Yujuan Ouyang: Experimental section, Data analysis, Writing - original draft. Heng Yin: Experimental section, Data analysis, Writing - original draft. Hengmin Cui: Conceptualization, Experiment design, Writing - review & editing, Funding acquisition. Huidan Deng: Conceptualization, Experiment design, Writing - review & editing, Funding acquisition. Huan Liu: Experimental section, Data analysis. Zhijie Jian: Experimental section, Data analysis. Jing Fang: Writing - review & editing. Zhicai Zuo: Writing - review & editing. Xun Wang: Writing - review & editing. Ling Zhao: Writing - review & editing. Yanqiu Zhu: Writing - review & editing. Yi Geng: Writing - review & editing. Ping Ouyang: Writing - review & editing.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
  44 in total

1.  Copper Transport and Disease: What Can We Learn from Organoids?

Authors:  Hannah Pierson; Haojun Yang; Svetlana Lutsenko
Journal:  Annu Rev Nutr       Date:  2019-05-31       Impact factor: 11.848

2.  Copper-Mediated Mitochondrial Fission/Fusion Is Associated with Intrinsic Apoptosis and Autophagy in the Testis Tissues of Chicken.

Authors:  Yizhi Shao; Hongjing Zhao; Yu Wang; Juanjuan Liu; Hui Zong; Mingwei Xing
Journal:  Biol Trace Elem Res       Date:  2018-07-04       Impact factor: 3.738

3.  Copper induces hepatocyte autophagy via the mammalian targets of the rapamycin signaling pathway in mice.

Authors:  Huan Liu; Huidan Deng; Hengmin Cui; Zhijie Jian; Hongrui Guo; Jing Fang; Zhicai Zuo; Junliang Deng; Yinglun Li; Xun Wang; Ling Zhao
Journal:  Ecotoxicol Environ Saf       Date:  2020-11-19       Impact factor: 6.291

4.  Suppressing autophagy enhances disulfiram/copper-induced apoptosis in non-small cell lung cancer.

Authors:  Xi Wu; Xue Xue; Lihui Wang; Wenjing Wang; Jian Han; Xiaoxue Sun; Haotian Zhang; Yueyang Liu; Xiaohang Che; Jingyu Yang; Chunfu Wu
Journal:  Eur J Pharmacol       Date:  2018-03-13       Impact factor: 4.432

5.  Metabolomics analysis reveals the effect of copper on autophagy in myocardia of pigs.

Authors:  Quanwei Li; Jianzhao Liao; Chaiqin Lei; Jian Shi; Hui Zhang; Qingyue Han; Jianying Guo; Lianmei Hu; Ying Li; Jiaqiang Pan; Zhaoxin Tang
Journal:  Ecotoxicol Environ Saf       Date:  2021-02-18       Impact factor: 6.291

6.  Autophagy attenuates copper-induced mitochondrial dysfunction by regulating oxidative stress in chicken hepatocytes.

Authors:  Fan Yang; Jianzhao Liao; Ruonan Pei; Wenlan Yu; Qingyue Han; Ying Li; Jianying Guo; Lianmei Hu; Jiaqiang Pan; Zhaoxin Tang
Journal:  Chemosphere       Date:  2018-03-29       Impact factor: 7.086

7.  Environmental exposure to zinc and copper influences sperm quality in fertile males.

Authors:  Aleksandra Kasperczyk; Michał Dobrakowski; Zenon P Czuba; Lucyna Kapka-Skrzypczak; Sławomir Kasperczyk
Journal:  Ann Agric Environ Med       Date:  2016       Impact factor: 1.447

8.  Copper Induces Spleen Damage Through Modulation of Oxidative Stress, Apoptosis, DNA Damage, and Inflammation.

Authors:  Hongrui Guo; Yuqin Wang; Hengmin Cui; Yujuan Ouyang; Tingyou Yang; Caiyun Liu; Xiaoyu Liu; Yanqiu Zhu; Huidan Deng
Journal:  Biol Trace Elem Res       Date:  2021-03-19       Impact factor: 3.738

9.  Copper - a novel stimulator of autophagy.

Authors:  Hans Zischka; Guido Kroemer
Journal:  Cell Stress       Date:  2020-04-24
View more
  6 in total

1.  Long-Term Copper Exposure Induced Excessive Autophagy of the Porcine Spleen.

Authors:  Kai Zhang; Zhuoying Hu; Qingyu Ding; Jianzhao Liao; Quanwei Li; Lianmei Hu; Ying Li; Hui Zhang; Jiaqiang Pan; Zhaoxin Tang
Journal:  Biol Trace Elem Res       Date:  2022-07-06       Impact factor: 3.738

Review 2.  Ferroptosis as a mechanism of non-ferrous metal toxicity.

Authors:  Michael Aschner; Alexey A Tinkov; Anatoly V Skalny; Airton C Martins; Anton I Sinitskii; Marcelo Farina; Rongzhu Lu; Fernando Barbosa; Yordanka G Gluhcheva; Abel Santamaria
Journal:  Arch Toxicol       Date:  2022-06-21       Impact factor: 6.168

Review 3.  Research Progress of Ferroptosis in Adiposity-Based Chronic Disease (ABCD).

Authors:  Huijun Du; Xiaoying Ren; Juncai Bai; Wei Yang; Yunan Gao; Shuang Yan
Journal:  Oxid Med Cell Longev       Date:  2022-04-23       Impact factor: 7.310

4.  Pan-cancer analyses confirmed the cuproptosis-related gene FDX1 as an immunotherapy predictor and prognostic biomarker.

Authors:  Chi Zhang; Yuanxiao Zeng; Xiuchen Guo; Hangjing Shen; Jianhao Zhang; Kaikai Wang; Mengmeng Ji; Shengwei Huang
Journal:  Front Genet       Date:  2022-08-05       Impact factor: 4.772

5.  Prototheca bovis induces autophagy in bovine mammary epithelial cells via the HIF-1α and AMPKα/ULK1 pathway.

Authors:  Wenpeng Zhao; Maolin Xu; Herman W Barkema; Xiaochen Xie; Yushan Lin; Sohrab Khan; John P Kastelic; Dong Wang; Zhaoju Deng; Bo Han
Journal:  Front Immunol       Date:  2022-09-02       Impact factor: 8.786

6.  Pan-cancer analysis of cuproptosis regulation patterns and identification of mTOR-target responder in clear cell renal cell carcinoma.

Authors:  Shichao Long; Ya Wang; Yuqiao Chen; Tianshu Fang; Yuanbing Yao; Kai Fu
Journal:  Biol Direct       Date:  2022-10-08       Impact factor: 7.173

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.