Dynamic Expression and Chromatin Incorporation of ACT and CREM Transcription Factors in Testis Tissues of Infertile Men.

OBJECTIVE: Activator of CREM in the testis (ACT) is a tissue specific transcription factor which activates cAMP responsive element modulator (CREM), a key transcription factor in differentiation of round spermatids into mature spermatozoa. They bind to CRE region in the promoters of transition protein genes (TNP1, TNP2) and protamine genes (PRM1 and PRM2), which are essential for sperm chromatin compaction, and regulates their transcription. This study was conducted to consider the expression of ACT and CREM and their regulatory roles on the expression of PRM1, PRM2, TNP1 and TNP2 genes in testis tissues of infertile men.
MATERIALS AND METHODS: In this case-control study, testicular biopsies were collected from 40 infertile men and classified into three groups: obstructive azoospermia (OA, n=10, positive control), round spermatid maturation arrest (SMA, n=20), Sertoli cell-only syndrome (SCOS, n=10, negative control group). Using quantitative real-time polymerase chain reaction (PCR), the expression profile of ACT, CREM, TNP1, TNP2, PRM1 and PRM2 genes were assessed in testicular samples and incorporation of ACT and CREM proteins on the promoters of PRM1, PRM2, TNP1 and TNP2 genes were also evaluated by ChIP-real time PCR.
RESULTS: Our results demonstrated significant decrease in the expression levels of ACT, CREM and in their incorporations on their target genes in SMA group in comparison to control groups (P≤0.05).
CONCLUSION: These data confirm that there is low expression and incorporation of ACT and CREM and of their target genes in infertilities which are associated with post-meiotic arrest. Copyright© by Royan Institute. All rights reserved.

Introduction

About 15% of couples struggle with infertility and are unable to conceive and male factor is the reason for infertility in half of the cases (1, 2). Genetic factors have an important part in causing male infertility by affecting various physiological processes, specifically spermatogenesis (3, 4). Spermatogenesis is the differentiation process in which diploid spermatogonia, successively undergo mitotic, meiotic and post-meiotic stages, eventually differentiating into haploid mature spermatozoa (5).

Chromatin re-organization and condensation associated with the maturation of the paternal genome is a unique process, required for the generation of healthy functional male germ cells (6). During this process, core histones are hyperacetylated and replaced by germ cells specific proteins including transition proteins (TNP1 and TNP2) and protamines (PRM1 and PRM2) (5, 7, 8). The latter remain tightly associated with a highly condensed paternal genome within the mature spermatozoa (9, 10). Inadequate expression of these nucleoproteins can obstruct process of nuclear compaction which can ultimately lead to impaired spermatogenesis (11, 12). It was demonstrated that disruption of both TNP1 and TNP2 in mice led to abnormalities in sperm morphology and spermiogenesis, whereas, either PRM1 knockout or PRM2 knockout can cause male infertility (13, 14). cAMP responsive element modulator (CREM) and its cofactor activator of CREM in the testis (ACT) are transcription factors which bind to the cAMP response element (CRE) regions of PRM1, PRM2, TNP1 and TNP2 and increase the expression of aforementioned genes (15, 16).

CCREM protein is a member of basic domain-leucine zipper family which functions as transcription factor and binds to a palindromic sequence named CRE and initiates the transcription of its downstream genes: TNP1, TNP2, PRM1, PRM2 (16). ACT protein is a member of Lim-only family with two zinc finger domains which binds to CREM and strengthens its function in transcribing their target genes (17). How CREM and ACT activate gene transcription can be different based on the type of the cell, in somatic cells, CREM gets phosphorylated at the Ser-117 residue and only then it binds to a CRE and triggers gene transcription whereas in the haploid cells of the testis, CREM no longer needs to be phosphorylated in order to function after binding to ACT which binds with high affinity to CREM protein (18, 19).

Studies have shown that CREM and its cofactor, ACT, have important impact on male infertility (17, 20). A study demonstrated that mice which lacked CREM gene had lower sperm concentration, abnormal sperm morphology and most importantly they were infertile. Another study showed that mice lacking ACT gene had significantly decreased sperm concentration and also they had folded or bent sperm tail, interestingly, they were still fertile (21, 22). These finding along with the fact that the expression of these two proteins are in line with each other , simply indicates the importance of ACT and CREM to male fertility (20).

The current study is aimed to consider the expression levels of CREM and of its cofactor ACT and of their target genes, encoding TNPs and PRMs, in testis tissues of infertile men in order to gain more insight into the molecular characterization of the defects observed in infertile patients with post-meiotic arrests.

Materials and Methods

Subjects

In this case-control study, 40 testicular biopsy specimens were collected from infertile male patients who were referred to Royan Institute. The samples were categorized as follows: obstructive azoospermia (OA, positive control), round spermatid maturation arrest (SMA), and Sertoli cell-only syndrome (SCOS, negative control group). The clinical features of the groups including patients’ karyotype, age, luteinizing hormone (LH), follicle-stimulating hormone (FSH), and testosterone hormone are monitored in the study. In order to obtain sperm for intracytoplasmic sperm injection (ICSI), SMA samples were obtained from TESE operation and OA samples and SMA samples were retrieved from testes with microTESE. The current research was approved by the Reproductive Biomedicine Research Center and Ethics Committee of Royan Institute (EC/91/1046) and written informed consent was obtained from all patients which allowed us to use their tissue samples.

DNA synthesis and Real-time quantitative polymerase chain reaction

RNA extraction from tissue samples was carried out with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). Samples were treated with DNase-I so that DNA contamination was removed, complementary DNA strand was synthesized using the RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s protocol. All samples were normalized with the expression of GAPDH gene.

The cDNA samples were quantified with quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Green PCR master mix (Applied Biosystems) on a Step One Plus Real-Time PCR System (Applied Biosystem) and with designed primers which are shown in Table 1 in three groups: OA (n=10), SMA (n=20), SCOS (n=10).

The qPCR reaction for ACT and CREM genes were carried out with the following profile: 20 µL volume, containing 2 µl of template cDNA (12.5 ng/μL), 1 µl of each 5 pmol/μl primer (Sinaclone, Iran), 10 µl of SYBR Green PCR master mix and 6 µl dH2 O and followed by initial denaturation at 95°C for 4 minutes, followed by 40 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 1 minute.

Two replicates were carried out for each sample and gene and also the relative gene expression level was assessed by using 2-ΔΔCt quantitative method (23), in which the parameter threshold cycle (Ct), demonstrates the fractional cycle number where the fluorescent signal reaches detection threshold. The results were normalized to an endogenous control (GAPDH). For normalizing each target gene sample, the relative abundance value obtained is divided by the value derived from the endogenous control.

Chromatin immunoprecipitation (ChIP)-qPCR

ChIP-qPCR was carried out using anti-CREM (ab54625, Abcam) and anti-ACT (ab97396, Abcam) antibodies and with the low cell number ChIPkit (Diagenode, Belgium) according to its presented instruction. Input control DNA and immunoprecipitated DNA and were measured by qPCR on a Step One Plus Real-Time PCR System (AB Applied Biosystems, USA) using SYBR Green master mix and designed primers (Table 1) in three groups: OA (n=10), SMA (n=10), SCOS (n=10). qPCR profile was as follows: initial denaturation at 95°C for 4 minutes, followed by 40 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 1 minute. The obtained results were normalized to input DNA and presented as percentage of input DNA.

Table 1

Primers designed for this study

Gene		Primer sequence (5´-3´)	Product size (bp)	Annealing temperature (°C)
qPCR primers
	ACT	F: CCATTAGTGGTCTCACAGGT	178	60
		R: GTCTCCTAGATGTCAGTGTCC
	CREM	F: ATGACAAATTCAGGAGCTCCTC	90	60
		R: TGGGACAAAGAACTGCTGTG
	PRM1	F: AATAGCACATCCACCAAACTC	134	60
		R: CAACATTTATTGACAGGCGG
	PRM2	F: GCTGGAAGTTAAGAGAAAGTCAC	80	60
		R: GGCTTGAGCATTTGATGTAGG
	TNP1	F: GACCTGATGTTAGATCAAAGCC	75	60
		R: ATTCCTCATTTCGTCACAACTG
	TNP2	F: GGAAATCCAACTAATGAGACCG	127	60
		R: TAGTGTTGCGTAGAAATCACCA
	GAPDH	F: CTCATTTCCTGGTATGACAACGA	121	60
		R: CTTCCTCTTGTGCTCTTGCT
ChIP-qPCR primers
	PRM1	F: GGAGGAGTCATCTTGTATCG	147	60
		R: TCATTGTGAGGGCAAAGG
	PRM2	F: CTTCCAAATGACAATGTGCG	128	60
		R: TTGCCTTGCCTGTAAAGC
	TNP1	F: GTCTCTTGTACTCATCCAATGCC	187	60
		R: TACTGTGCTGTCACTCACCT
	TNP2	F: TTCTTCTAATGTCCGAATGAGG	76	60
		R: CTGAACAAGTCCCAGTTTCC

Statistical analysis

Statistical comparisons between the three groups were performed using Kruskal-Wallis and Spearman’s rank correlation was used to determine the possibility of correlation. Differences between groups were considered to be statistically significant at P≤0.05. All statistical analyses were performed by GraphPad Prism (version 8.0.2 for Windows, GraphPad Software, La Jolla California, USA).

Results

SCOS group had the highest serum FSH concentration among all groups

The results demonstrate that the differences in age, LH and testosterone levels among the three groups of OA, SMA and SCOS were non-significant. However, the difference regarding FSH concentration among foregoing groups was significant (P=0.001, Table 2). Moreover, SCOS group had the highest concentrations of FSH in comparison to OA and SMA (P≤0.005) and there was no significant difference in the FSH concentration between SMA and OA group.

Table 2

Clinical features of patients group

Patient groups	No. of patients	Genetic analysis	Age (Y)	LH (mIU/ml)	FSH (mIU/ml)	Testosterone (ng/ml)
OA	10	46XY/ normal AZF	35.3 ± 2.4	7.7 ± 1.2	8.9 ± 1.3	3.4 ± 0.5
SMA	20	46XY/ normal AZF	31.1 ± 1.4	7.7 ± 1.1	10.3 ± 1.3	4.9 ± 0.4
SCOS	10	46XY/ normal AZF	34.9 ± 1.9	8.8 ± 1.6	20.4 ± 2.3	3.7 ± 0.2
P value	-	-	NS	NS	0.001***	NS

Values are mean ± SEM. NS; Not statistically significant, Kruskal-wallis test, LH; Luteinizing hormone, FSH; Follicle-stimulating hormone, OA; Obstructive azoospermia, SMA; Round spermatid maturation arrest, SCOS; Sertoli cell-only syndrome, and ***; P≤0.001.

ACT and CREM expressions are downregulated in SMA group

ACT, CREM and its target genes (TNP1, TNP2, PRM1 and PRM2) expressions were evaluated by qPCR analysis in the three groups. Quantification of mRNA relative expression showed significant lower expression of ACT in SMA group in comparison to positive control group (P≤0.05, Fig .1). CREM expression level also significantly lowered compared to OA group (P≤0.002, Fig .1). Significant decrease in expression levels of TNP1, TNP2, PRM1 and PRM2 in testis tissues of round SMA and SCOS groups were observed in comparison to positive control group (Fig .2). The significance was calculated at (P≤0.05).

Fig.1

Relative mRNA expression of the ACT and CREM genes normalized to GAPDH in testicular samples with OA (n=10), SMA (n=20) and SCOS (n=10). OA; Obstructive azoospermia, SMA; Round spermatid maturation arrest, SCOS; Sertoli cell-only syndrome, ***; P≤0.001, **; P≤0.002, and *; P≤0.05.

Fig.2

Relative mRNA expression of the TNP1, TNP2, PRM1 and PRM2 genes normalized to GAPDH in testicular samples with OA (n=10), SMA (n=20) and SCOS (n=10). OA; Obstructive azoospermia, SMA; Round spermatid maturation arrest, SCOS; Sertoli cell-only syndrome, ***; P≤0.001, and **; P≤0.002.

TNP1 expression is positively correlated with PRMs expressions in both SMA group and OA group

The obtained results from Spearman’s correlation coefficient test from SMA group revealed positive correlations between TNP1 and PRM1 and between TNP1 and PRM2 (P≤0.05, two-tailed). Furthermore, PRM1 and PRM2 were positively correlated (P≤0.05, two-tailed). However, no correlation was observed between TNP2 and PRMs genes. In OA group, we only observed positive correlation between TNP1 expression level and PRMs expression levels (P≤0.05, two-tailed). The results are presented in Tables S1 and S2 (See Supplementary Online Information at www.celljournal.org).

ACT and CREM proteins are associated with promoter regions of TNP genes

Total protein levels of ACT and CREM into regulatory regions of PRM1, PRM2, TNP1 and TNP2 genes in the testis tissue sections were assessed by ChIP real-time PCR. The quantitative data revealed a significant decrease in detection of CREM and ACT transcription factors into regulatory regions of PRM1, PRM2, TNP1 and TNP2 in testis tissues of SMA and SCOS groups in comparison to positive control group (Figes.3, 4). The significance was calculated at P≤0.05.

Fig.3

Incorporation of CREM protein on the promoter regions of TNP1, TNP2, PRM1 and PRM2 genes in patients with OA (n=10), SMA (n=10) and SCOS (n=10). OA; Obstructive azoospermia, SMA; Round spermatid maturation arrest, SCOS; Sertoli cell-only syndrome, and *; P≤ 0.05.

Fig.4

Incorporation of ACT protein on the promoter regions of TNP1, TNP2, PRM1 and PRM2 genes in patients with OA (n=10), SMA (n=10) and SCOS (n=10). OA; Obstructive azoospermia, SMA; Round spermatid maturation arrest, SCOS; Sertoli cell-only syndrome, ***; P≤0.001, and **; P≤0.002.

The correlations between incorporations of ACT/ CREM and the expressions of PRMs/TNPs genes

CREM and ACT incorporations on PRM1 were found to be negatively correlated with PRM1 expression in SMA group (P≤0.05, two-tailed). Moreover, ACT incorporation on TNP2 was found to be positively correlated with TNP2 expression (P≤0.05, two-tailed). Other correlations between ACT/CREM incorporations and their target genes’ expressions were non-significant. For OA group, we only observed negative correlation between ACT incorporation on TNP2 and TNP2 expression (P≤0.05, two-tailed). All results are presented in Tables S3 and S4 (See Supplementary Online Information at www. celljournal.org).

Discussion

Both environmental factors and genetic factors can attribute to male infertility which this fact simply indicates that this condition is perplexing and multifactorial, and thousands of genes are known to be involved in male infertility (24). Therefore, delving into molecular characterization of male infertility can help better understand this medical condition and can also contribute to its treatment.

In the present research, we investigated the expression and chromatin incorporation of ACT and CREM together with the expression of their target genes in the testis of infertile men with SMA. SMA group was compared with both patients classified in OA group and SCOS group. OA group was considered as a positive control group because OA patients undergo normal spermatogenesis, but their reproductive tracks are blocked and SCOS group were assigned as negative control group due to lack of germ cells in this group (5, 25). Our data demonstrate that there is low expression of ACT and CREM in infertilities associated with post-meiotic arrest.

Our findings are consistent with previous studies which have demonstrated that male mice which lack the functional form of CREM gene in its genome, are infertile with arrested spermatogenesis at the round spermatid stage (26, 27). ACT regulates CREM expression level in male germ cells and it is also required for spermatid maturation (22, 28). A study showed that male mice which lack ACT expression are still fertile but show significantly decreased numbers of mature sperms and severe abnormalities of the remaining cells (22).

CREM and its cofactor ACT cooperate to initiate the expression of several important post-meiotic genes including the expression of TNP1, TNP2, PRM1, PRM2 which are necessary for chromatin compaction through spermatogenesis (15-17). It has been demonstrated that transgenic mice carrying null mutations for TNP1 and TNP2 are infertile associated with decreased chromatin compaction, motility, viability and a high proportion of morphology abnormalities of sperm cells (11). Another study demonstrated that null mutation for PRM1 and PRM2 genes in mice, interrupts nuclear formation and the normal function of the sperm ultimately leading to infertility (29).

We observed low incorporations of ACT and CREM on their target genes and low expressions of TNPs and PRMs. Since post-meiotic cells are absent or less abundant in the samples with SMA samples and these cells normally express these genes, therefore, it is expected that we observe a decrease in incorporation of ACT and CREM and decreased levels of expression of their target genes compared to samples which have all spermatogenesis cell stages including post-meiotic cells.

TNP1 is located on chromosome 2 and it has a vital role in decreasing the melting temperature of DNA and relaxing its nucleosome core particles which are essential for histones eviction. On the other hand, TNP2 and the PRMs are in a cluster on chromosome 16 and they are mainly responsible for DNA compaction (30). We carried out correlation analyses between TNPs and PRMs gene expressions in SMA group and we observed that TNP1 expression is positively correlated with both PRMs genes. This finding is somewhat surprising since these genes are not neighboring genes, but it suggests that are co-regulated. We also found that PRM1 was positively correlated with PRM2. Same correlation patterns were observed for OA group except that PRM1 was not correlated with PRM2.

We also ran correlation analyses between the incorporation of ACT/CREM and the expression of the PRMs/TNPs genes in both OA group and SMA group. In OA group we only observed negative correlation between the incorporation of ACT on TNP1 and TNP1 expression. Moreover, we found out that incorporations of ACT and CREM on PRM1 regulatory region are negatively correlated with PRM1 expression in SMA group which might suggest that ACT and CREM incorporations are increased in order to compensate for the reduced expression of PRM1 in SMA group.

Conclusion

This work confirms that ACT and CREM have key roles in spermatid maturation and decrease in their expression levels might be associated with spermatogenesis failure at the stage of post-meiotic cells (SMA group). However, further investigation on larger sample size is required to justify these findings.