Flesh quality of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) fed with hydrolyzed porcine mucosa-supplemented low fishmeal diet.

Iso-nitrogenous and iso-lipidic diets containing 0%, 3%, 6%, 9%, and 12% hydrolyzed porcine mucosa (namely, HPM0, HPM3, HPM6, HPM9, and HPM12) were prepared to evaluate their effects on the growth performance, muscle nutrition composition, texture property, and gene expression related to muscle growth of hybrid groupers (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Groupers were fed to apparent satiation at 08:00 and 16:00 every day for a total of 56 days. It was found that the weight gain percentage in the HPM0, HPM3, and HPM6 groups did not differ (P > 0.05). The cooking loss and drip loss of the dorsal muscle in the HPM3 group were lower than those in the HPM6 and HPM9 groups (P < 0.05). The hardness and chewiness of the dorsal muscle in the HPM3 group were higher than those in the HPM0, HPM9, and HPM12 groups (P < 0.05). The gumminess in the HPM3 group was higher than that in the HPM9 and HPM12 groups (P < 0.05). The total essential amino acid content of the dorsal muscle in the HPM12 group was higher than that in the HPM0 group (P < 0.05). The contents of total n-3 polyunsaturated fatty acid and total n-3 highly unsaturated fatty acid, as well as the ratio of n-3/n-6 polyunsaturated fatty acid in the dorsal muscle was higher in the HPM0 group than in all other groups (P < 0.05). The relative expressions of gene myogenic factor 5, myocyte enhancer factor 2c, myocyte enhancer factor 2a, myosin heavy chain, transforming growth factor-beta 1 (TGF-β1), and follistatin (FST) were the highest in the dorsal muscle of the HPM3 group. The results indicated that the growth performance of hybrid grouper fed a diet with 6% HPM and 27% fish meal was as good as that of the HPM0 group. When fish ingested a diet containing 3% HPM, the expression of genes TGF-β1 and FST involved in muscle growth were upregulated, and then the muscle quality related to hardness and chewiness were improved. An appropriate amount of HPM could be better used in grouper feed.

Introduction

China is one of the largest aquaculture producers globally. According to FAO statistics, the aquaculture production of China reached 47.56 million tons in 2018, accounting for 57.93% of global aquaculture production (FAO, 2020). With rapid developments in the field, the marine fish production of China reached 1.61 million tons in 2019, an increase of 7.41% over 2018 (Fisheries and Fishery Administration Bureau of The Ministry of Agriculture and Rural Affairs et al., 2019). The grouper is one of the important mariculture fishes in China, and its production ranks third year-round (Fisheries and Fishery Administration Bureau of The Ministry of Agriculture and Rural Affairs et al., 2018). Among them, the hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) is very popular among farmers and consumers owing to its fast growth, strong disease resistance, and good taste (Kim et al., 2020).

With improvements in people's living standards, consumers have begun to exhibit a greater desire for high-quality fish (Liu et al., 2020). The flesh quality of muscle, which is the main edible part of the fish, is not only affected by the internal factors of the fish, such as strain (Johnston et al., 2006) and size (Shearer, 1994), but also by external factors, such as feed (Sun et al., 2018; Zhao et al., 2019), feeding strategy (Lv et al., 2018; Imsland et al., 2020), temperature (López-Albors et al., 2008), density (Álvarez et al., 2020; Birolo et al., 2020; Silva et al., 2020), salinity (Cheng et al., 2020), dissolved oxygen (Zuanazzi et al., 2019), and other environmental factors. The levels of nutrients, such as mineral elements (Zhang et al., 2016a), fatty acids (Li, 2020a), amino acids (Cai et al., 2018), and proteins (Zhang et al., 2016b) in feed, along with the source of protein (Wang et al., 2017), play an important role in regulating flesh quality.

As more and more feed ingredients are being used to replace fish meals completely or partially, they are affecting the flesh quality of fish. The addition of 3% Saccharomyces cerevisiae hydrolysate in the feed significantly increased the crude protein (CP) content and reduced the ether extract (EE) content in grouper (Epinephelus coioides) muscle (Yang et al., 2020). Upon substituting a 9% faba bean meal for the soybean meal, the n-3 polyunsaturated fatty acid (n-3 PUFA) and n-6 PUFA contents of grass carp (Ctenopharyngodon idella) muscle were significantly reduced, and the monounsaturated fatty acid (MUFA) content, hardness, chewiness, and gumminess were significantly increased (Li et al., 2020b). When partly replacing fish meal with fermented soybean meal or housefly (Musca domestica) maggot meal, increased moisture and C18:3n-3 contents in Japanese seabass (Lateolabrax japonicus; Liang et al., 2017) and lower levels of thaw loss and improved hardness for Nile tilapia (Oreochromis niloticus; Wang et al., 2017) were found. After the fish meal in the feed was completely replaced with rice protein concentrate, the cooking loss of blunt snout bream (Megalobrama amblycephala) muscle was significantly increased (Cai et al., 2018). Hydrolyzed porcine mucosa (HPM) is derived from the mucosa of the cleaned small intestine of pigs, and is a by-product of the production of the anticoagulant drug heparin sodium after high-temperature spray drying (Mateos et al., 2014). To increase the yield of heparin sodium, enzymes are added during the extraction process for the reaction (Hai et al., 2013). As a new type of functional nutritive animal protein source, HPM has been widely used in lactating sows (Johnston et al., 2003) and post weaning pigs (Cho et al., 2010; Myers et al., 2014; Figueroa et al., 2016) owing to its high protein content, balanced amino acid composition, richness in small peptides, free amino acids, and high safety profile (Mateos et al., 2014; Wu et al., 2017). There is little research on the use of HPM in aquatic animals, especially its effects on flesh quality. To the best of our knowledge, only one study on carp (Cyprinus carpio) has been reported thus far, which showed that replacing fishmeal with 3% HPM equivalents had no significant effect on the growth performance of carp, however there was a significant reduction in intestinal fold depth and villi height. Therefore, the purpose of this study is to evaluate the effects of low fish meal feed containing HPM on the growth performance, flesh quality, and muscle growth-related gene expressions of hybrid groupers.

Materials and methods

Animal ethics

All hybrid groupers and their caretaking procedures conformed to the NIH guidelines (NIH Pub. No. 85 to 23, revised 1996), and were approved by the Institutional Animal Care and Use Committee of Guangdong Ocean University (Zhanjiang, China).

Experimental design and diets

The by-products obtained from the extraction of sodium heparin from the cleaned small intestines from the mucous of pigs were treated at high temperatures and spray dried to obtain HPM in the form of a brownish powder with good flowability. Five iso-nitrogen and iso-lipidic low fishmeal and soybean meal level diets, with HPM levels of 0% (control group), 3%, 6%, 9%, and 12% were formulated. They are referred to as HPM0, HPM3, HPM6, HPM9, and HPM12, respectively. All powdered ingredients in the experiment were crushed (HNX-350, Beijing Huanya Tianyuan Machinery Technology Co. Ltd., Beijing, China) and passed through a 60-mesh screen. According to the formula shown in Table 1, the powdered ingredients were accurately weighed. The micro constituents were mixed homogeneously using the sequential-expansion method. The HPM and other powdery ingredients were mixed evenly (GHJ-V, Jiangyin Weixiang Pharmachemical Machinery Factory, Jiangsu, China). Then, the weighed soybean lecithin, soybean oil, fish oil, and water (30% of the diet weight) were added and stirred evenly (B30, Guangzhou Panyu Lifeng Food Machinery Factory, Guangzhou, China). Subsequently, pellets with a diameter of 3.00 mm were made using a twin-screw extruder (TSE65, Beijing Modern Yanggong Machinery S&T Development Co. Ltd., Beijing, China). The pellets were dried in an air-conditioned room at 25 °C for 48 h and stored at −20 °C. The peptide molecular weight distribution and proximate composition of the HPM are shown in Fig. 1 and Table 2, respectively.

Table 1

Formulation and proximate composition of the experimental diets (%, dry matter).

Item	HPM0	HPM3	HPM6	HPM9	HPM12
Ingredients
Brown fish meal 1	33.00	30.00	27.00	24.00	21.00
HPM 2		3.00	6.00	9.00	12.00
Soybean meal 1	22.50	21.50	20.50	19.50	18.50
Wheat gluten flour 1	4.28	5.15	6.03	6.90	7.78
Cottonseed protein 1	6.00	6.00	6.00	6.00	6.00
Spray-dried blood 1	4.00	4.00	4.00	4.00	4.00
Wheat meal 1	18.20	18.20	18.20	18.20	18.20
L-Lysine 1	0.78	0.81	0.84	0.87	0.90
DL-Methionine 1	0.40	0.41	0.41	0.42	0.43
Anchovy oil 1	3.35	3.17	3.00	2.82	2.65
Soybean oil 1	3.00	3.00	3.00	3.00	3.00
Soybean lecithin 1	1.50	1.50	1.50	1.50	1.50
Vitamin premix 3	0.20	0.20	0.20	0.20	0.20
Mineral premix 4	0.50	0.50	0.50	0.50	0.50
Vitamin C 1	0.05	0.05	0.05	0.05	0.05
Ca(H2PO4)21	1.50	1.50	1.50	1.50	1.50
Choline chloride 1	0.30	0.30	0.30	0.30	0.30
Ethoxyquin 1	0.03	0.03	0.03	0.03	0.03
Phytases 1	0.30	0.30	0.30	0.30	0.30
Microcrystalline cellulose 1	0.11	0.38	0.64	0.91	1.16
Total	100.00	100.00	100.00	100.00	100.00
Proximate composition 5
Moisture	10.39	10.50	11.34	11.40	11.56
Crude protein	50.23	50.37	50.00	50.06	49.85
Ether extract	10.78	10.46	10.57	10.14	10.23
Crude ash	9.28	9.25	9.15	9.22	9.00

HPM = hydrolyzed porcine mucosa.

Purchased from Zhanjiang Ouxun Feed Co., Zhanjiang, China.

Provided by Yichang Huatai Biological Technology Co., Ltd., Yichang, China.

Provided by Qingdao Master Biotech Co., Ltd, Qingdao, China. Each kilogram of premix included the following: vitamin B1, 17.00 g; vitamin B2, 16.67 g; vitamin B6, 33.33 g; vitamin B12, 0.07 g; vitamin K3, 3.33 g; vitamin E, 66.00 g; retinyl acetate, 6.67 g; vitamin D3, 33.33 g, nicotinic acid, 67.33 g; D-calcium pantothenate, 40.67 g; biotin, 16.67; folic acid, 4.17 g; inositol, 102.04 g; cellulose, 592.72 g.

Provided by Qingdao Master Biotech Co., Ltd, Qingdao, China. Each kilogram of premix included the following: CaCO3, 350 g; NaH2PO4·H2O, 200 g; KH2PO4, 200 g; NaCl, 12 g; MgSO4·7H2O, 10 g; FeSO4·7H2O, 2 g; MnSO4·7H2O, 2 g; AlCl3·6H2O, 1 g; CuCl2·2H2O, 1 g; KF, 1 g; NaMoO4·2H2O, 0.5 g; NaSeO3, 0.4 g; CoCl2·6H2O, 0.1 g; KI, 0.1 g; zeolite powder, 219.9 g.

Proximate compositions were measured values.

Fig. 1

Peptide molecular weight distribution of hydrolyzed porcine mucosa. Da, Dalton.

Table 2

Proximate composition of fish meal, hydrolyzed porcine mucosa, soybean meal and wheat gluten flour (%, dry matter).

Item	Brown fish meal	HPM	Soybean meal	Wheat gluten flour
Moisture	8.20	10.40	12.30	6.30
Crude protein	70.93	66.39	43.77	74.43
Ether extract	8.06	14.62	1.30	0.30
Essential amino acid
Lysine	5.08	4.28	2.57	1.22
Methionine	1.91	1.39	0.46	1.01
Arginine	3.80	4.18	2.96	2.57
Isoleucine	2.73	2.82	1.91	2.63
Leucine	5.02	5.70	3.34	5.23
Threonine	2.95	3.17	1.79	2.07
Valine	3.15	3.38	1.96	2.73
Histidine	2.04	1.63	1.13	1.56
Phenylalanine	2.85	3.22	2.30	3.88
Semi-essential amino acid
Tyrosine	2.33	3.03	1.49	2.66
Cystine	0.70	0.79	0.67	1.65
Non-essential amino acid
Aspartate	6.15	13.16	4.98	2.58
Glutamine	9.06	9.32	8.21	29.17
Glycine	4.41	3.31	1.94	2.68
Alanine	4.29	3.22	1.84	1.83
Serine	2.75	3.02	2.33	3.83
Proline	2.72	2.73	2.16	9.28

HPM = hydrolyzed porcine mucosa.

Fish and feeding trial

All groupers used in the experiment were purchased from the South East Quay Grouper Hatchery, Zhanjiang, China. Prior to commencing the feeding trial, hybrid groupers were acclimatised to the environment for two weeks, during which they were fed commercial feeds purchased from the Guangdong Yuehai Feeds Group (Zhanjiang, China), with a crude protein level of 50.0% twice (08:00 and 16:00) daily to apparent satiation. At the start of the experiment, all fish fasted for 24 h. The 450 hybrid groupers, with an initial average weight of 7.51 ± 0.03 g, were randomly divided into 15 fibreglass buckets (300 L) for indoor hydrostatic farming, with 30 fish in each bucket. They were fed twice (08:00 and 16:00) to apparent satiation every day for a total of 56 days. Each bucket contained approximately 70% of water, which was replaced daily. During the feeding period, the light conditions followed a natural cycle, the water temperature was 29 to 31 °C, the pH value was 6.9 to 7.2, the salinity was 27 to 30 g/L, the ammonia nitrogen level was less than or equal to 0.05 mg/L, and the dissolved oxygen level was at least 5.0 mg/L.

Sample collection and analysis

Before beginning the feeding experiment, 30 initial hybrid groupers were randomly collected and stored at −20 °C until the contents of CP and EE were measured, so as to calculate the protein deposition rate (PDR) and lipid deposition rate (LDR) of fish after feeding the experimental feed. At the end of the feeding trial, all hybrid groupers were anaesthetised using MS-222 (100 mg/L) prior to sample collection, and all fish in each tank were counted and weighed to calculate the weight gain percentage (WG), survival rate (SR), and feed efficiency (FE). Three groupers were randomly collected from each tank and stored at −20 °C to calculate the PDR and LDR. Three anaesthetized fish were randomly caught from each tank, skinned, and had their dorsal muscle collected using a scalpel and stored in a sealed bag at −20 °C to detect the moisture, CP, EE, amino acid (AA), and fatty acid (FA) contents of the dorsal muscles.

The proximate composition of the feed and dorsal muscle, including its moisture, CP, EE, and crude ash contents were analysed using standard methods of the AOAC (Association of Official Analytical Chemists, 1999). Moisture content was determined gravimetrically at a constant weight in an oven at 105 °C. CP content was determined using the Kjeldahl method (Total-N × 6.25). EE content was determined gravimetrically after extraction with ethyl ether. Crude ash content was determined by calcination at 550 °C in a muffle furnace. The amino acid and fatty acid compositions were determined using a modified amino acid analysis method (L-8800, Hitachi, Ltd., Japan) described by Ezaki et al. (2011) and the gas chromatograph method (GC-2010, Shimadzu Corporation, Japan) described by Faudzi et al. (2018), respectively. The results were expressed as a percentage of protein and fatty acids, respectively. The peptide molecular weight distribution of the HPM was determined by the Analysis and Testing Centre of Jiangnan University (Jiangsu, China) following standard national methods (General Administration of Quality Supervision et al., 2008).

Six fish were randomly selected from each bucket to collect dorsal muscle samples for texture property analysis (TPA) including hardness, cohesiveness, springiness, gumminess, and chewiness by using a food property analyser (TMS-PRO, Food Technology Corporation, Rockville, Maryland, USA). Dorsal muscle samples were collected from an area 2.00 cm posterior to the gill cover and 0.50 cm below the dorsal fin, whose size was 3.00 cm (length) × 3.00 cm (width) × 1.00 cm (height). Three fish were randomly selected from each tank, and approximately 3.00 g of dorsal muscle was collected, weighed, and suspended in a refrigerator at 4 °C for 24 h. Subsequently, it was weighed again and the difference was used to calculate the drip loss (Bidner et al., 2004); approximately 3.00 g of dorsal muscle was collected, sealed in cling film, steamed at 100 °C for 5 min, cooled to room temperature, and weighed the difference was used to calculate the cooking loss (Bertram et al., 2003). Three fish were randomly selected from each bucket, and their dorsal muscle collected, quickly placed in the RNA-later (Ambion, Life Technologies, Carlsbad CA, USA) and immersed at 4 °C for 12 h and then stored at −80 °C until the relative gene mRNA expression was analysed.

Quantitative real-time PCR analysis

The mRNA expressions of myogenic factor 5 (Myf5), myogenic differentiation (MyoD), myocyte enhancer factor 2c (MEF-2c), myogenin (MyoG), myocyte enhancer factor 2a (MEF-2a), myosin heavy chain (MyHC), insulin-like growth factor 1 (IGF-1), collagen type I alpha 1 (Col1α-1), collagen type I alpha 2 (Col1α-2), transforming growth factor-beta 1 (TGF-β1), follistatin (FST), myostatin (MSTN), and insulin-like growth factor 2 (IGF-2) in dorsal muscle were determined using quantitative real-time PCR (qRT-PCR). The β-actin gene was used as a housekeeping gene, owing to its highly stable expression (Kortner et al., 2011). The primer sequences of target genes for qRT-PCR are listed in Table 3. After the dorsal muscle samples were thawed, approximately 1.00 g of dorsal muscle was taken, the RNA-later was blotted off their surfaces, and the total RNA was extracted from the dorsal muscle using Trizol Reagent (Beijing Trans Gen Biotech Co., Ltd., China). The integrity was verified using 1% agarose gel electrophoresis. Recombinant DNase I (Takara, Japan) was used to treat the RNA extracts to remove possible DNA contamination, and the quality of RNA extracts was assessed using the spectrophotometer (ND-1000, Nano-Drop Technologies, Wilmington, USA). A high absorbance ratio, between 1.86 and 2.00 at 260/280 nm, was found for the RNA extracts, indicating a high degree of purity. Reverse transcription of cDNA was carried out using the Prime ScriptTM RT reagent kit (Takara, Japan), following the manufacturer's instructions. The qRT-PCR reactions were performed according to instructions of the SYBR® Premix Ex TaqTM II Kit (Takara, Japan). A 10 μL reaction volume, containing 5 μL of SYBR® Green Real-time PCR Master Mix (Bio-Rad Labs), 0.4 μL of each primer, 1 μL of cDNA, and 3.2 μL of sterilized double distilled water was used for the qRT-PCR assay. Each sample in the reaction was performed in triplicate. The qRT-PCR was performed using a quantitative thermal cycler (Bio-Rad CFX96; Bio-Rad Labs, Hercules, CA, USA), and its parameters were as follows: 30 s at 95 °C, followed by 35 cycles of 5 s at 95 °C, 25 s at 60.0 °C, and 30 s at 72 °C. Gene expression levels were computed using the 2−ΔΔCT method, following Mu et al. (2018).

Table 3

Sequence of the primers used for quantitative real-time PCR in this study.

Target gene	Primer sequence (5′-3′)	Annealing Temperature, °C	Length of amplified product, bp	Accession number
β-Actin	F: TGCGTGACATCAAGGAGAAGC	61	151	AY510710.2
	R: TCTGGGCAACGGAACCTCT	60
Myf5	F: CGAGAGCAGGTGGAAAACTACT	58	142	XM_033614452.1
	R: ATCCGCCGCTGTAGTTTGC	61
MyoD	F: GGCTCAGCAAGGTCAACGA	59	113	XM_033635008.1
	R: CTCGATGTAGCTGATGGCGT	59
MEF-2c	F: CGGTTACCCATCTGCCATCTC	62	113	XM_033618691.1
	R: TTGAGCCGAGGTGAAGGGA	61
MyoG	F: GAGGAGCACCTTGATGAACCC	61	191	XM_033625713.1
	R: TGGGCTCACTTGAAGACGACA	61
MEF-2a	F: TGCCTGTATCCAATCCCAATG	60	206	XM_033634186.1
	R: TGGCACTGAAAGGTCTGTGGTAT	61
MyHC	F: AAGGTGTTGGCTGAGTGGAAA	60	221	XM_033644959.1
	R: TGGATGCTCTTGCCAGTCTCA	61
IGF-1	F: GTGCGATGTGCTGTATCTCCTG	61	179	XM_033614181.1
	R: GCCATAGCCTGTTGGTTTACTG	59
Col1α-1	F: TGACAGCGGAACGGTGATG	60	128	XM_033645844.1
	R: CAACCTGAGGCTCCGTGAA	59
Col1α-2	F: TCTGCGACTTCAACACCCG	60	234	XM_033636413.1
	R: AGTGGTAGGTGATGTTCTGGGTAG	59
TGF-β1	F: ACAGGGACAACAACCCGCTAC	61	122	GQ205390.1
	R: CGCTCATCCTCATTTCCTTTG	60
FST	F: GAAAAAGTGTCTGTGGGATGCTC	61	174	XM_033620608.1
	R: TTGACTTCCAGCAGCACCC	59
MSTN	F: TGAGTAAACTGCGGATGAAAGAAG	61	144	XM_033614507.1
	R: CCTCCTCCATAACCACATCCTT	60
IGF-2	F: CCGCAAAGATACGGACACCA	62	146	XM_033635279.1
	R: GCCGACGCTATTTCCACAAC	61

Myf5 = myogenic factor 5; MyoD = myogenic differentiation; MEF-2c = myocyte enhancer factor 2c; MyoG = myogenin; MEF-2a = myocyte enhancer factor 2a; MyHC = myosin heavy chain; IGF-1 = insulin-like growth factor 1; Col1α-1 = collagen type I alpha 1; Col1α-2 = collagen type I alpha 2; TGF-β1 = transforming growth factor-beta 1; FST = follistatin; MSTN = myostatin; IGF-2 = insulin-like growth factor 2.

Calculations and statistical methods

Weight gain percentage (WG, %) = 100 × [final body weight (g) - initial body weight (g)]/initial body weight (g) Survival rate (SR, %) = 100 × number of fish in the final test/number of fish in the initial test Feed efficiency (FE) = [final body weight (g) - initial body weight (g)]/diet weight of each group's fish intake (dry weight, g) Protein deposition rate (PDR, %) = 100 × [final body weight (g) × CP percentage of final test fish body (%) − initial body weight (g) × CP percentage of initial test fish body (%)]/[diet weight of each group's fish intake (dry weight, g) × CP percentage of feed (%)] Lipid deposition rate (LDR, %) = 100 × [final body weight (g) × EE percentage of final test fish body (%) − initial body weight (g) × EE percentage of initial test fish body (%)]/[diet weight of each group's fish intake (dry weight, g) × EE percentage of feed (%)] Drip loss (%) = 100 × [weight of muscles before being suspended (g) − weight of muscles after being suspended (g)]/weight of muscles before being suspended (g) Cooking loss (%) = 100 × [weight of the muscle before being cooked (g) − weight of muscle after being cooked (g)]/weight of muscle before being cooked (g)

All data were statistically validated using one-way analysis of variance (ANOVA) in SPSS 22.0. The homogeneity of variance test was conducted to ensure that the variance was homogeneous. Tukey's test was used to compare the significant differences among mean values of all treatments. All data are shown as the mean value ± standard error of the mean (SEM). P-value < 0.05 was considered to be significant.

Results

Growth performance

As the amount of HPM added increased, no significant changes were detected in SR, FE, PDR, and LDR (P > 0.05). There was no significant difference in WG among the HPM0, HPM3, and HPM6 groups (P > 0.05), whose values were significantly higher than those in other groups (P < 0.05, Table 4).

Table 4

Growth performance of hybrid groupers feed the test diets for 56 days1.

Index	HPM0	HPM3	HPM6	HPM9	HPM12
IBW, g	7.49 ± 0.01	7.49 ± 0.02	7.49 ± 0.00	7.50 ± 0.02	7.48 ± 0.02
WG, %	847.07 ± 4.61a	851.25 ± 13.50a	850.63 ± 8.81a	805.74 ± 5.32b	756.12 ± 9.43c
SR, %	97.78 ± 2.22	97.78 ± 2.22	95.56 ± 1.11	97.78 ± 1.11	97.78 ± 1.11
FE	0.75 ± 0.02	0.77 ± 0.01	0.76 ± 0.01	0.79 ± 0.02	0.81 ± 0.02
PDR, %	26.46 ± 0.53	25.39 ± 0.18	26.39 ± 0.60	24.97 ± 0.60	25.52 ± 0.53
LDR, %	54.16 ± 1.70	54.62 ± 1.54	54.11 ± 4.29	51.39 ± 2.27	50.90 ± 0.99

HPM = hydrolyzed porcine mucosa; IBW = initial body weight; WG = weight gain percentage; SR = survival rate; FE = feed efficiency; PDR = protein deposition rate; LDR = lipid deposition rate.

a, b, c Values with different superscripts in the same row are significantly different (P < 0.05).

Diets HPM0, HPM3, HPM6, HPM9, and HPM 12 contains 0%, 3%, 6%, 9%, and 12% HPM content, respectively. Mean values ± SEM are presented for each group (n = 3).

Muscle composition

There were no significant differences in the muscle compositions in terms of moisture, CP, and ash content (P > 0.05). The muscle EE content of the HPM-containing groups was significantly reduced, and the EE content of the HPM9 group was significantly lower than that in other groups (P < 0.05, Table 5).

Table 5

Muscle compositions of hybrid groupers feed the test diets for 56 days (%, wet matter) 1.

Index	HPM0	HPM3	HPM6	HPM9	HPM12
Moisture	65.00 ± 0.12	65.20 ± 0.32	66.09 ± 0.62	66.41 ± 0.58	65.78 ± 0.47
Crude protein	31.39 ± 0.04	31.50 ± 0.29	30.77 ± 0.59	30.77 ± 0.53	31.08 ± 0.43
Ether extract	2.19 ± 0.02a	1.76 ± 0.03b	1.79 ± 0.10b	1.37 ± 0.08c	1.69 ± 0.06b
Crude ash	1.35 ± 0.03	1.42 ± 0.03	1.36 ± 0.03	1.29 ± 0.03	1.37 ± 0.03

HPM = hydrolyzed porcine mucosa.

a, b, c Values with different superscripts in the same row are significantly different (P < 0.05).

Diets HPM0, HPM3, HPM6, HPM9, and HPM 12 contains 0%, 3%, 6%, 9%, and 12% HPM content, respectively. Mean values ± SEM are presented for each group (n = 3).

Water holding capacity of muscle and texture property analysis

There were no significant differences between the muscle cooking loss and drip loss of the HPM0 group and the HPM3 group, but cooking loss and drip loss of the HPM3 group was numerically lower than that in the HPM0 group (P > 0.05). The cooking loss and drip loss in the HPM3 group were significantly lower than those in the HPM6 and HPM9 groups (P < 0.05). The hardness and chewiness in the HPM3 group were significantly higher than those in the HPM0, HPM9, and HPM12 groups (P < 0.05). The gumminess in the HPM3 and HPM6 groups was significantly higher than that in HPM9 and HPM12 groups (P < 0.05). The cohesiveness and springiness were not significantly affected by experimental diets (P > 0.05, Table 6).

Table 6

Water holding capacity and texture property in muscle of hybrid groupers feed the test diets for 56 days1.

Index	HPM0	HPM3	HPM6	HPM9	HPM12
Cooking loss, %	21.45 ± 0.45c	19.55 ± 0.42c	27.71 ± 0.64a	27.42 ± 0.68a	24.20 ± 0.33b
Drip loss, %	5.80 ± 0.51ab	4.93 ± 0.28b	6.55 ± 0.20a	6.53 ± 0.07a	5.25 ± 0.25ab
Hardness, N	35.23 ± 2.11b	44.17 ± 0.46a	37.23 ± 3.43ab	32.33 ± 0.55b	32.43 ± 0.48b
Cohesiveness ratio	0.46 ± 0.01	0.44 ± 0.01	0.46 ± 0.02	0.45 ± 0.01	0.44 ± 0.01
Springiness, mm	1.93 ± 0.03	1.95 ± 0.05	1.84 ± 0.01	1.83 ± 0.06	1.80 ± 0.08
Gumminess, N	18.05 ± 0.49ab	19.00 ± 0.17a	19.00 ± 0.23a	16.63 ± 0.49bc	15.50 ± 0.52c
Chewiness, mJ	32.74 ± 1.28b	37.72 ± 0.56a	33.58 ± 0.79ab	32.45 ± 0.80b	30.40 ± 0.96b

HPM = hydrolyzed porcine mucosa.

a, b, c Values with different superscripts in the same row are significantly different (P < 0.05).

Diets HPM0, HPM3, HPM6, HPM9, and HPM 12 contains 0%, 3%, 6%, 9%, and 12% HPM content, respectively. Mean values ± SEM are presented for each group (n = 3).

Amino acid composition of muscle

With increases in HPM content in the feed, the contents of Ile, Lys, Phe, Thr, Val, His, Asp, Glu, and Ala exhibited an upward trend, and their contents in the HPM12 group were significantly higher than those in the HPM0 group (P < 0.05). The remaining amino acid contents were not significantly affected by the feed (P > 0.05). The total amino acid (TAA) and total essential amino acid (TEAA) contents in the HPM12 group were significantly higher than those in the HPM0 group (P < 0.05). The HPM content in the feed had no significant effects on the total delicious amino acid (TDAA) and total aromatic amino acid (TAAA) contents (P > 0.05, Table 7).

Table 7

Amino acid composition in muscle of hybrid groupers feed the test diets for 56 days (%, dry matter) 1.

Index	HPM0	HPM3	HPM6	HPM9	HPM12
Ile 2	3.66 ± 0.07b	3.95 ± 0.13ab	3.98 ± 0.05ab	3.90 ± 0.03ab	4.10 ± 0.08a
Leu 2	6.55 ± 0.14	6.80 ± 0.16	6.80 ± 0.06	6.71 ± 0.02	7.05 ± 0.16
Lys 2	7.76 ± 0.10b	8.17 ± 0.21ab	8.20 ± 0.09ab	8.09 ± 0.05ab	8.55 ± 0.21a
Met 2	2.50 ± 0.05	2.61 ± 0.08	2.61 ± 0.03	2.59 ± 0.01	2.75 ± 0.07
Thr 2	3.75 ± 0.07b	3.86 ± 0.06ab	3.84 ± 0.04ab	3.82 ± 0.03b	4.07 ± 0.05a
Val 2	3.82 ± 0.06b	4.13 ± 0.13ab	4.11 ± 0.06ab	4.05 ± 0.03ab	4.25 ± 0.07a
His 2	1.82 ± 0.04b	1.90 ± 0.03ab	1.91 ± 0.01ab	1.87 ± 0.01ab	1.98 ± 0.04a
Phe 2,3	3.47 ± 0.05b	3.64 ± 0.08ab	3.56 ± 0.08ab	3.59 ± 0.02ab	3.78 ± 0.07a
Tyr 3	2.84 ± 0.04	2.87 ± 0.06	2.85 ± 0.02	2.80 ± 0.01	2.96 ± 0.08
Arg 2,4	5.03 ± 0.09	5.26 ± 0.13	5.26 ± 0.08	5.23 ± 0.04	5.45 ± 0.11
Asp 4	8.68 ± 0.16b	9.02 ± 0.20ab	9.04 ± 0.10ab	8.94 ± 0.04ab	9.43 ± 0.18a
Glu 4	12.71 ± 0.24b	13.36 ± 0.38ab	13.39 ± 0.13ab	13.28 ± 0.06ab	13.90 ± 0.28a
Gly 4	4.82 ± 0.14	5.10 ± 0.16	5.29 ± 0.09	5.18 ± 0.13	4.93 ± 0.07
Ala 4	5.07 ± 0.06b	5.33 ± 0.12ab	5.35 ± 0.08ab	5.28 ± 0.07ab	5.50 ± 0.11a
Ser 4	3.29 ± 0.08	3.32 ± 0.05	3.25 ± 0.02	3.27 ± 0.01	3.41 ± 0.07
Pro 4	3.57 ± 0.03	3.51 ± 0.05	3.59 ± 0.07	3.54 ± 0.07	3.74 ± 0.12
TAA	79.33 ± 1.37b	82.83 ± 1.96ab	83.05 ± 0.95ab	82.14 ± 0.50ab	85.88 ± 1.46a
TEAA	38.36 ± 0.67b	40.32 ± 1.01ab	40.28 ± 0.46ab	39.86 ± 0.20ab	41.99 ± 0.85a
TDAA	31.28 ± 0.58	32.81 ± 0.81	33.07 ± 0.39	32.68 ± 0.30	33.77 ± 0.55
TAAA	6.31 ± 0.09	6.51 ± 0.14	6.41 ± 0.10	6.39 ± 0.02	6.75 ± 0.15

HPM = hydrolyzed porcine mucosa; Ile = isoleucine; Leu = leucine; Lys = lysine; Met = methionine; Thr = threonine; Val = valine; His = histidine; Phe = phenylalanine; Tyr = tyrosine; Arg = arginine; Asp = aspartic acid; Glu = glutamate; Gly = glycine; Ala = alanine; Ser = serine; Pro = proline; TAA = total amino acids; TEAA = total essential amino acids; TDAA = total delicious amino acids; TAAA = total aromatic amino acids.

a, b Values with different superscripts in the same row are significantly different (P < 0.05).

Diets HPM0, HPM3, HPM6, HPM9, and HPM 12 contains 0%, 3%, 6%, 9%, and 12% HPM content, respectively. Mean values ± SEM are presented for each group (n = 3).

Essential amino acid.

Aromatic amino acid.

Delicious amino acid.

Fatty acid composition of muscle

As the content of HPM in the feed increased, the contents of C15:0, C17:0, C18:3n-3, C20:5n-3, C22:6n-3, ∑ n-3 PUFA, and ∑ n-3 HUFA (n-3 highly unsaturated fatty acid) in muscle gradually decreased (P < 0.05). In comparison to the HPM0 group, adding 12% HPM to the feed significantly reduced the C15:0 and C18:3n-3 contents (P < 0.05). The C17:0, C20:5n-3, and C22:6n-3 contents in the HPM6, HPM9, and HPM12 groups were significantly lower than those in the HPM0 group (P < 0.05). The contents of ∑ n-3 PUFA and ∑ n-3 HUFA, along with the value of n-3/n-6, in the HPM0 group were the highest (P < 0.05). As the proportion of HPM in the feed increased, the contents of C18:1n-9 and ∑ MUFA exhibited an upward trend, and reached a maximum in the HPM12 group (P < 0.05, Table 8).

Table 8

Fatty acid composition in muscle of hybrid groupers feed the test diets for 56 days (%, dry matter) 1.

Index	HPM0	HPM3	HPM6	HPM9	HPM12
C14:0	4.44 ± 0.10	4.41 ± 0.09	4.22 ± 0.17	4.86 ± 0.10	4.88 ± 0.44
C15:0	0.40 ± 0.01a	0.46 ± 0.01ab	0.46 ± 0.01ab	0.47 ± 0.01ab	0.45 ± 0.01b
C16:0	20.87 ± 0.12b	22.07 ± 0.27ab	22.64 ± 0.48a	21.92 ± 0.24ab	22.26 ± 0.47a
C17:0	1.08 ± 0.01a	1.00 ± 0.01ab	0.97 ± 0.04b	0.94 ± 0.01bc	0.84 ± 0.04c
C18:0	7.67 ± 0.14	7.94 ± 0.44	7.97 ± 0.42	8.27 ± 0.29	8.64 ± 0.21
C20:0	0.44 ± 0.01	0.44 ± 0.01	0.44 ± 0.01	0.44 ± 0.01	0.44 ± 0.01
C22:0	0.26 ± 0.01	0.26 ± 0.01	0.25 ± 0.01	0.27 ± 0.01	0.25 ± 0.01
C24:0	0.17 ± 0.00	0.17 ± 0.02	0.17 ± 0.02	0.19 ± 0.01	0.17 ± 0.01
∑SFA	45.05 ± 0.09b	46.44 ± 0.46ab	46.89 ± 0.42a	46.14 ± 0.28ab	46.72 ± 0.42a
C16:1n-7	5.27 ± 0.06	5.00 ± 0.11	5.00 ± 0.16	4.64 ± 0.12	4.71 ± 0.25
C17:1n-7	0.75 ± 0.04	0.45 ± 0.10	0.49 ± 0.14	0.58 ± 0.14	0.69 ± 0.24
C18:1n-9	20.20 ± 0.08d	21.14 ± 0.19c	21.71 ± 0.07bc	21.98 ± 0.21ab	22.70 ± 0.20a
C20:1n-9	0.75 ± 0.01	0.84 ± 0.04	0.88 ± 0.09	0.77 ± 0.04	0.78 ± 0.05
C22:1n-9	0.00 ± 0.00	0.08 ± 0.04	0.08 ± 0.04	0.06 ± 0.02	0.07 ± 0.02
C24:1n-9	0.42 ± 0.01	0.29 ± 0.01	0.28 ± 0.01	0.40 ± 0.01	0.28 ± 0.04
∑MUFA	27.29 ± 0.05c	27.78 ± 0.25bc	28.45 ± 0.12b	28.40 ± 0.21b	29.20 ± 0.21a
C18:2n-6	21.99 ± 0.05	22.16 ± 0.40	21.89 ± 0.10	22.76 ± 0.41	22.10 ± 0.40
C20:2n-6	0.68 ± 0.04	0.65 ± 0.04	0.65 ± 0.02	0.66 ± 0.05	0.61 ± 0.01
C18:4n-6	0.16 ± 0.04	0.12 ± 0.01	0.11 ± 0.01	0.14 ± 0.01	0.11 ± 0.01
C20:4n-6	0.20 ± 0.01	0.22 ± 0.01	0.22 ± 0.02	0.24 ± 0.04	0.21 ± 0.02
C20:4n-6	0.70 ± 0.02	0.64 ± 0.04	0.67 ± 0.05	0.86 ± 0.08	0.85 ± 0.12
∑n-6 PUHA	24.74 ± 0.02ab	24.78 ± 0.29ab	24.54 ± 0.09b	24.65 ± 0.21a	24.88 ± 0.44ab
C18:4n-4	2.11 ± 0.020a	2.05 ± 0.04a	1.98 ± 0.06a	1.94 ± 0.06a	1.71 ± 0.05b
C20:4n-4	0.09 ± 0.04	0.12 ± 0.02	0.09 ± 0.04	0.06 ± 0.01	0.06 ± 0.02
C20:5n-4 (EPA)	4.00 ± 0.02a	4.62 ± 0.05ab	4.42 ± 0.10bc	4.14 ± 0.06c	2.50 ± 0.14d
C22:6n-4 (DHA)	6.41 ± 0.12a	5.11 ± 0.17ab	4.82 ± 0.21b	4.62 ± 0.21b	4.91 ± 0.51b
∑n-4 PUFA	12.51 ± 0.08a	10.90 ± 0.21b	10.41 ± 0.25b	9.72 ± 0.12b	8.18 ± 0.59c
∑n-4 HUFA	10.41 ± 0.14a	8.74 ± 0.22b	8.25 ± 0.27b	7.74 ± 0.18bc	6.41 ± 0.64c
n-4/n-6 ratio	0.52 ± 0.01a	0.46 ± 0.01b	0.44 ± 0.01bc	0.49 ± 0.01cd	0.44 ± 0.02d
EPA/DHA ratio	0.64 ± 0.01	0.71 ± 0.01	0.71 ± 0.04	0.68 ± 0.04	0.65 ± 0.05

HPM = hydrolyzed porcine mucosa; SFA = saturated fatty acid; MUFA = monounsaturated fatty acid; EPA = eicosapentaenoic acid; DHA = docosahexaenoic acid; PUFA = polyunsaturated fatty acid; HUFA = highly unsaturated fatty acid.

a, b Values with different superscripts in the same row are significantly different (P < 0.05).

Diets HPM0, HPM3, HPM6, HPM9, and HPM 12 contains 0%, 3%, 6%, 9%, and 12% HPM content, respectively. Mean values ± SEM are presented for each group (n = 4).

Relative mRNA expression of muscle growth-related genes

With the increases in HPM content in the feed, the expressions of Myf5, MEF-2c, MEF-2a, MyHC, and FST first exhibited an increasing trend followed by a decreasing trend, reaching a maximum in the HPM3 group (P < 0.05). A similar trend was also observed in MyoD, MyoG, Col1α-1, and TGF-β1; the maximum expression of MyoD was presented in the HPM6 group, and the expressions of the other three reached their maximum values in the HPM3 and HPM6 groups (P < 0.05). The expression of MSTN in the HPM0 group was significantly higher than that in other groups (P < 0.05). The expression of IGF-2 in the HPM0 group was significantly higher than that in the HPM6, HPM9, and HPM12 groups (P < 0.05). With increases in the proportion of HPM in the feed, the expressions of IGF-1 and Col1α-2 also exhibited a trend of first increasing and then decreasing, but they were not significantly affected by the feed (P > 0.05, Fig. 2A, B, C and D).

Fig. 2

The genes expressions of myogenic regulatory factors (A), encoding collagen (B), positive regulators of muscle growth (C) and negative regulators of muscle growth (D) in hybrid groupers feed the test diets for 56 days. Hydrolyzed porcine mucosa (HPM) content in feed was 0%,3%, 6%, 9%, and 12% in HPM0, HPM3, HPM6, HPM9, HPM12, respectively. a, b, c Different superscripts mean that the difference is significant (P < 0.05). Myf5 = myogenic factor 5; MyoD = myogenic differentiation; MEF = myocyte enhancer factor; MyoG = myogenin; MyHC = myosin heavy chain; Col1 = collagen type I; IGF = insulin-like growth factor; TG = transforming growth factor; FST = follistatin; MSTN = myostatin.

Discussion

Fish growth performance could be significantly improved by adding appropriate amounts of protein sources containing small peptides, such as cottonseed meal hydrolysate (Xia et al., 2012), hydrolyzed krill meal (Wei et al., 2016), enzymatic hydrolyzed soybean meal (Zhang et al., 2019), and fish protein hydrolysate (Zhou et al., 2019). In this study, WG in the HPM3 and HPM6 groups was not significantly different from the control group. Similar conditions have been found in peptides hydrolyzed from poultry by-products (Jia et al., 2019), anchovy and giant squid hydrolysates (Costa et al., 2020), and size-fractionated fish hydrolysates (Cai et al., 2015). Research in animals has shown that the absorption of small peptides was carried out by a special peptide transport system, which was not easy to saturate, had low energy consumption, fast absorption speed, and was not competitive or inhibitory (Stelzl et al., 2016). In addition, small peptides entered the blood circulation in the form of dipeptides and tripeptides, and were directly absorbed in the skin, kidneys, liver, intestine, and other tissues, which reduced the energy consumption for breaking down protein, allowing more energy to be used for animal growth (Cai et al., 2015; Ki et al., 2015). However, the WG of hybrid grouper was significantly reduced when the dietary HPM content was over 9%. When more hydrolytic or enzymolysis protein sources were used in the feed, fish growth performance was significantly reduced in yellow catfish (Pelteobagrus fulvidraco; Zhou et al., 2019), cobia (Rachycentron canadum; Han et al., 2010), turbot (Scophthalmus maximus; Jiang et al., 2019), and gilthead seabream (Sparus aurata; Kolkovski and Tandler, 2000). Owing to the increased number of free amino acids in the enzymatic or hydrolytic process, intestinal amino acid transport system saturation and transport mechanism competition could occur (Plakas and Katayama, 1981), restricting amino acid absorption (Aragão et al., 2004).

The level of delicious amino acids in the fish muscle is an important factor affecting its flavour (Buchtová et al., 2009). Glu and Asp have an umami taste, Gly and Ala have a sweet taste (Cheng et al., 2020). In addition, Ser and Pro are also related to a sweet taste (Park et al., 2002). Studies have shown that the most abundant amino acid in the dorsal muscles of hybrid grouper is Glu, followed by Asp, Lys, and Leu (Yu et al., 2014b; Wang et al., 2015; Fan et al., 2018). These results were confirmed in this experiment. As the content of HPM in the feed increased, the contents of total essential amino acids, aromatic amino acids (Phe), and delicious amino acids (Asp, Glu and Ala) in muscles exhibited an upward trend. This could be related to the composition of HPM amino acids. The HPM contains higher levels of Phe (3.22%), Asp (13.16%), Glu (9.32%), and Ala (3.22%), and the first three amino acids are higher than those in fish meal. Further, more amino acids were absorbed and deposited in the fish muscle (Deng et al., 2016). In addition, Asp, Glu, and Ala are non-essential amino acids that can be synthesized by the fish themselves. It is also possible that the high levels of Asp, Glu, and Ala in the feed promoted their synthesis in the fish. As a result, muscle nutrition and quality were improved.

The water holding capacity, one of the important characteristics to measure muscle quality, reflects the loss of liquid and soluble substances in muscle (Brinkera and Reiteret, 2011). A loss of water will cause losses in water-soluble proteins, soluble flavour substances, and heme in muscle, decreasing muscle quality (Savage et al., 1990; Luciano et al., 2009). In this experiment, in comparison to the control group, there was no significant difference in cooking loss and drip loss of the dorsal muscle when 3% HPM was added to the diet, but a reduced trend in numerical value was found. When low fish meal feed contained 3% HPM, the water holding capacity of the hybrid grouper dorsal muscles was improved.

The hardness, cohesiveness, springiness, gumminess, and chewiness of muscles are their main textural properties (Chen et al., 2019). In this experiment, the hardness, gumminess, and chewiness of the muscles reached their maximum values when 3% HPM was added. In comparison to the control group, the EE content of the muscle was significantly reduced and its chewiness was significantly increased. The lower EE content in muscles caused greater friction between muscle bundles, and increased muscle shear force, which meant that muscles had higher chewiness (Grigorakis and Alexis, 2005).

With increases in HPM content in the feed, the ∑ MUFA and ∑ n-6 PUHA in muscle increased, while the ∑ n-3 PUFA and ∑ n-3 HUFA exhibited a significant decreasing trend. The n-3 PUHA and n-6 PUHA are not only key components in hormone synthesis in vivo, but also play an important role in the regulation of inflammatory responses (Harbige, 2003). Higher levels of n-3 PUFA could volatilize its anti-inflammatory effect (McMurray et al., 2000), and high levels of n-6 PUFA can cause platelet aggregation, vasoconstriction, and inflammatory reactions (Simopoulos and DiNicolantonio, 2016; Huang et al., 2020). The human body cannot synthesize n-3 PUFA and n-6 PUFA by itself, so they must be obtained from food (Xiong et al., 2002). The recommended value for n-3/n-6 PUFA in human food is 0.10 to 0.25 (Zhang et al., 2006). The ratio of n-3/n-6 PUFA in food is one of the most important factors influencing human obesity (Ailhaud et al., 2006). The n-3/n-6 PUHA ratio in food is closely related to human disease, and research has shown that the lower the n-3/n-6 PUHA ratio in food, the higher the risk of humans suffering from hyperlipidemia, obesity, and breast cancer (Jeromson et al., 2015). In this experiment, the n-3/n-6 PUHA ratio of hybrid grouper muscle was 0.34 to 0.52. As the HPM content in the diet increased, the n-3/n-6 PUHA ratio became progressively smaller, approaching the optimal n-3/n-6 ratio in food. The addition of HPM to the feed changed the fatty acid composition of hybrid grouper muscle. Whether these changes will affect human health remains to be further studied.

Myogenic regulatory factors (MRFs) and their related regulatory genes, as the internal factors that affect flesh quality (Cheng et al., 2014), have important regulatory effects on the differentiation of myogenic cells, the development of muscle fibres, and the formation and growth of muscle tissue (Lin et al., 2015; Zheng et al., 2015). The MRFs were expressed in a time sequence (Johnston et al., 2007). During somatic cell formation, the first expression of the MRF family factor is Myf5, followed by MyoD and MEF-2c, then MyoG and MEF-2a, and finally MyHC (Watabe, 1999). Among them, Myf5 and MyoD primarily act as myogenic determinants, and MyoG plays an important role in myocyte differentiation (Rudnicki and Jaenish, 1995; Kassar-Duchossoy et al., 2004). In this experiment, the expression levels of Myf5, MyoD, MEF-2c, MyoG, MEF-2a, and MyHC increased when 3% HPM was added to the low fish meal diet. This indicates that 3% HPM can improve the muscle formation and differentiation of hybrid groupers. IGF-1 is an important growth factor, with many receptors in fish muscle (Castillo et al., 2006), and can promote cell activation, proliferation, and differentiation; moreover, it is a positive regulator of MRFs. In contrast, IGF-2 is a negative regulator of MRFs (Snijders et al., 2015). In this experiment, although IGF-1 expression was not significantly affected by feed, it exhibited a trend of first increasing and then decreasing with increases in HPM content. The changing trend of IGF-1 was consistent with those of Myf5, MyoD, MEF-2c, MyoG, MEF-2a, and MyHC. The collagen content in fish muscle is rich, and the main type of collagen is type I (Yata et al., 2001). Type I collagen is encoded by two α-1 chains (Col1α-1) and one α-2 chain (Col1α-2; Gelsea et al., 2003). Collagen synthesis and cross-linking are primarily regulated by TGF-β1, which mediates the expression of collagen type I (Chen et al., 2005). In this experiment, the expression of TGF-β1 in the HPM3 group was significantly increased in comparison to that in other groups. The expressions of Col1α-1 and Col1α-2 also exhibited a similar trend, although the change in Col1α-2 was not significant. Col1α-1 and Col1α-2 have high hydrophilicity and strong binding ability with other substances, which can enhance the water holding capacity of meat (Yu et al., 2014a). This is an important reason why the cooking loss and drip loss of the HPM3 group were lower than those of the control group. MSTN encodes myostatin protein and is a negative regulator of muscle growth (Zheng et al., 2015). FST can inhibit the negative regulation of MSTN on muscle growth, restoring muscle growth and development (Rebhan and Funkenstein; 2008). The supplementation of 3% HPM in a low fish meal diet significantly increased FST expression, and a significant decrease in MSTN expression was observed in all HPM-supplemented groups. These results indicate that 3% HPM supplementation in a low fish meal diet was beneficial to the differentiation, growth, and quality of muscle.

Conclusion

The results indicated that the growth performance of hybrid grouper fed a diet with 6% HPM and 27% fish meal was as good as that of the control group. When fish ingested a diet containing 3% HPM, the expression of genes TGF-β1 and FST involved in muscle growth were upregulated, and then the muscle quality related to hardness and chewiness were improved. An appropriate amount of HPM could be better used in grouper feed.

Author contributions

Xuanyi Yang: Conceptualization, Methodology, Investigation, Formal analysis, Writing–Original Draft; Xinyan Zhi: Investigation, Formal analysis; Ziling Song: Investigation, Formal analysis; Guanghui Wang: Methodology, Resources; Xumin Zhao: Methodology, Resources; Shuyan Chi: Conceptualization, Methodology, Resources, Writing–Review & Editing, Supervision, Project administration, Funding acquisition; Beiping Tan: Methodology, Resources, Funding acquisition. All authors read and approved the final manuscript.

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.