Literature DB >> 34975889

Antcin K Inhibits TNF-α, IL-1β and IL-8 Expression in Synovial Fibroblasts and Ameliorates Cartilage Degradation: Implications for the Treatment of Rheumatoid Arthritis.

David Achudhan1, Shan-Chi Liu2, Yen-You Lin3, Chien-Chung Huang1,4, Chun-Hao Tsai5,6, Chih-Yuan Ko6, I-Ping Chiang7, Yueh-Hsiung Kuo8,9,10, Chih-Hsin Tang1,3,9,10.   

Abstract

Extracts from Taiwan's traditional medicinal mushroom, Antrodia cinnamomea, exhibit anti-inflammatory activities in cellular and preclinical studies. However, this paper is the first to report that Antcin K, a triterpenoid isolated from A. cinnamomea, inhibits proinflammatory cytokine production in human rheumatoid synovial fibroblasts (RASFs), which are major players in rheumatoid arthritis (RA) disease. In our analysis of the mechanism of action, Antcin K inhibited the expression of three cytokines (tumor necrosis factor alpha [TNF-α], interleukin 1 beta [IL-1β] and IL-8) in human RASFs; cytokines that are crucial to RA synovial inflammation. Notably, incubation of RASFs with Antcin K reduced the phosphorylation of the focal adhesion kinase (FAK), phosphoinositide 3-kinase (PI3K), protein kinase B (AKT) and nuclear factor-κB (NF-κB) signaling cascades, all of which promote cytokine production in RA. Intraperitoneal injections of Antcin K (10 mg/kg or 30 mg/kg) attenuated paw swelling, cartilage degradation and bone erosion, and decreased serum levels of TNF-α, IL-1β, IL-8 in collagen-induced arthritis (CIA) mice; in further experiments, IL-6 levels were similarly reduced. The inhibitory effects of Antcin K upon TNF-α, IL-1β and IL-8 expression in human RASFs was achieved through the downregulation of the FAK, PI3K, AKT and NF-κB signaling cascades. Our data support clinical investigations using Antcin K in RA disease.
Copyright © 2021 Achudhan, Liu, Lin, Huang, Tsai, Ko, Chiang, Kuo and Tang.

Entities:  

Keywords:  Antrodia cinnamomea; antcin K; collagen-induced arthritis; interleukin 1 beta; interleukin 8; rheumatoid arthritis; rheumatoid arthritis synovial fibroblast; tumor necrosis factor alpha

Mesh:

Substances:

Year:  2021        PMID: 34975889      PMCID: PMC8714747          DOI: 10.3389/fimmu.2021.790925

Source DB:  PubMed          Journal:  Front Immunol        ISSN: 1664-3224            Impact factor:   7.561


Introduction

Rheumatoid arthritis (RA) is an autoimmune and chronic inflammatory disease with a complex pathogenesis that is not fully understood, but is known to involve the infiltration of inflammatory cells into the joints and subsequent swelling, synoviocyte proliferation, cartilage damage and bone erosion (1, 2). The production of proinflammatory cytokines from activated RA synovial fibroblasts (RASFs) disrupts the microenvironment that mediates bone homeostasis (3, 4). RASFs are considered to be the main catabolic factor in cartilage bone degradation, as they stimulate the production of proinflammatory cytokines typically associated with RA disease, including tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL-1β), IL-8 and IL-6 (5). Symptomatic pain and inflammation associated with RA disease is generally prescribed nonsteroidal anti-inflammatory drugs (NSAIDs) and steroidal anti-inflammatories (corticoids) in addition to existing RA treatment, while synthetic or biologic disease-modifying antirheumatic drugs (DMARDs) in combination with corticoids can be used as first-line treatments in newly-diagnosed RA to achieve disease remission (6). NSAIDs and corticoids are commonly used in RA management. However, their long-term safety is yet to be confirmed, as a recent Cochrane Review of randomized clinical trial evidence on the efficacy and safety of these anti-inflammatories in the long-term treatment of RA concluded that the quality of the NSAID evidence was very low overall and meta-analysis evidence was lacking for corticoids (6). Importantly, long-term pharmacotherapy in RA disease is often associated with significant side effects, such as cytopenia, poor tolerability, rash, and occasionally liver damage occurring with traditional DMARDs (7), while data from observational studies indicate higher risks of cardiovascular disease, infections, diabetes mellitus and mortality with glucocorticoids (8), and side effects relating to biologic treatment with tumor necrosis factor (TNF) inhibitors can include severe infection, sepsis, tuberculosis, lymphoma or demyelinating disorders (9). Novel therapeutic alternatives with good tolerability are needed to halt the progression of RA disease (10). Traditional Chinese medicinal plants contain functional compounds that can cure various disease conditions (11) and are an important source of drug development. In particular, the traditional Chinese medicine (TCM) remedy Lianhua Qingwen markedly downregulates messenger RNA (mRNA) expression of cytokines TNF-α and IL-6 and of the chemokines monocyte chemoattractant protein-1 [(MCP-1), also referred to as chemokine (CC-motif) ligand 2 (CCL2)] and C-X-C motif chemokine ligand 10 [(CXCL10), also known as interferon gamma-induced protein 10 (IP-10)] in human hepatocellular carcinoma (Huh-7) cells infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (12). Antrodia cinnamomea is a species of mushroom endemic to Taiwan that has been used for hundreds of years in TCM and A. cinnamomea extracts are well known for their hepatoprotective, antioxidative, antihypertensive, antihyperlipidemic, immunomodulatory, anticancer and anti-inflammatory activities (13–15). In this study, we demonstrate that a triterpenoid isolated from A. cinnamomea, Antcin K, exhibits anti-inflammatory effects in cellular and preclinical experiments investigating RA disease. Interestingly, we found that Antcin K downregulated the production of proinflammatory cytokines including TNF-α, IL-1β and IL-8 in RASFs via the FAK, PI3K, AKT and NF-κB signaling cascades. Furthermore, Antcin K ameliorated cartilage degradation in mice with collagen-induced arthritis (CIA). Our report is the first to explain how Antcin K inhibits cartilage degradation in vitro and also the production of proinflammatory cytokines in vivo. According to our evidence, Antcin K appears to have therapeutic potential in RA disease.

Materials and Methods

Materials

Antibodies against TNF-α (A11534), IL-1β (SC-7884), IL-8 (ab18672), p-FAK (Thr202/Tyr204; SC-7383), FAK (SC-5298), p-85 (SC-1637), p-AKT (Thr308; SC-16646-R), AKT (SC-5298), p-p65 (Ser536; SC-101752), p-65 (SC-8008), and β-actin (SC-58673) were purchased from Santa Cruz (Santa Cruz, CA, USA). Activators Angiotensin II (a FAK activator), 740-YP (a PI3K activator), SC-79 (an AKT activator) and prostratin (an NF-κB activator) were all purchased from Santa Cruz (Santa Cruz, CA, USA). Cell culture supplements were purchased from Invitrogen (Carlsbad, CA, USA). A Human Inflammation Antibody Array kit was supplied by RayBiotech, Inc. Human TNF-α, IL-1β and IL-8 ELISA kits were purchased from R&D Systems (MN, USA).

Cell Culture

Immortalized RASFs (MH7A cells) were bought from the Riken Cell Bank (Ibaraki, Japan) and cultured as a single culture in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin 100 U/mL. Cell incubation was performed in a humidified atmosphere of 37°C, 5% CO2. The cells were passaged when they had grown to 80% confluence.

MTT Assay

RASFs were seeded at a density of 5 × 103 cells/well into 96-well plates and incubated with Antcin K (0, 0.3, 1, 3, or 10 μM) for 24 h, then incubated in 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution for 2 h. Dimethyl sulfoxide (DMSO) was added to the solution and absorbance at 550 nm was measured with a microplate reader (BioTek, Winooski, VT, USA).

Quantitative Real-Time PCR for mRNA

After incubating the RASFs with Antcin K (0, 0.3, 1, 3, or 10 μM) for 24 h, total RNA was extracted from the RASFs using TRIzol™ reagent. The qPCR analysis was performed as per an established protocol (16–18). RNA concentration was measured using a NanoVue Plus™ Spectrophotometer (Biochrom Ltd., Cambridge, UK). 1 μg of total RNA was reverse-transcribed to complementary DNA (cDNA), which was then synthesized by the MMLV reverse transcription system (Invitrogen, Carlsbad, CA, USA) and mixed with Fast SYBR® Green Mix. Gene expression was examined by the StepOnePlus™ Real-Time PCR System. GAPDH served as the internal control and the primers used in the qPCR assays are listed in .
Table 1

Sequences of RT-PCR primers.

GAPDHForwardAAT GGACAACTGGTCGTGGAC
ReverseCCCTCCAGGGGATCTGTTTG
TNF-αForwardCCTCTCTCTAATCAGCCCTCTG
ReverseGAGGACCTGGGAGTAGATGAG
IL-1βForwardATGATGGCTTATTACAGTGGCAA
ReverseGTCGGAGATTCGTAGCTGGA
IL-8ForwardCTGCGCCAACACAGAAATTATTGTA
ReverseCTGCGCCAACACAGAAATTATTGTA
Sequences of RT-PCR primers.

Western Blot Analysis

The RASFs were incubated with Antcin K (0, 0.3, 1, 3, or 10 μM) for 24 h, then washed with PBS and protein was extracted using RIPA buffer containing protease inhibitors. The Western blot analysis was performed as per an established protocol (19–22). The total proteins were quantified by the Thermo Scientific™ Pierce™ BCA Protein Assay Kit. Cell lysates were separated by SDS-PAGE electrophoresis then transferred to polyvinylidene difluoride (PVDF) membranes. The blots were blocked with 4% BSA, then incubated with primary antibodies TNF-α, IL-1β, IL-8, p-FAK, FAK, p-85, p-AKT, AKT, p-p65, p-65 and β-actin overnight before being subjected to three consecutive washes in a mixture of tris-buffered saline and polysorbate 20 (TBST) and then the blots were incubated with horseradish peroxidase (HRP) conjugated secondary antibodies at room temperature for 1 h. Enhanced chemiluminescent imaging of the blots was visualized with the UVP Biospectrum system (UVP, Upland, CA, USA).

Enzyme-Linked Immunosorbent Assay (ELISA)

The RASFs were plated in 6-well dishes and grown to confluence. The culture medium was then exchanged with serum-free RPMI medium. Cells were pretreated for 30 min with pharmacological activators Angiotensin II (a FAK activator), 740-YP (a PI3K activator), SC-79 (an AKT activator) and prostratin (an NF-κB activator) to stimulate the RSAFs, before 24 h of Antcin K (0, 0.3, 1, 3, or 10 μM) treatment. The conditioned medium was collected and stored at –20°C until use. Secreted expression of TNF-α, IL-1β and IL-8 was examined using ELISA kits for TNF-α, IL-1β and IL-8 (R&D Systems, MN, USA), according to the manufacturer’s protocols. Serum levels of TNF-α, IL-1β, IL-8 and IL-6 in CIA mice were examined using ELISA kits for TNF-α and IL-1β (R&D Systems, MN, USA), IL-8 (MyBioSource, Inc, San Diego, USA) and IL-6 (Max™ Set Deluxe Kits, BioLegend, USA) according to the manufacturers’ protocols.

CIA Mouse Model

Forty C57BL/6J mice (aged 8-10 weeks) were obtained from the National Laboratory Animal Centre (Taipei, Taiwan) and randomly allocated to the four study groups (n=10 mice in each group). CIA was induced according to our previous report (23, 24), and the study protocol was approved by the Institutional Animal Care and Use Committee of China Medical University. After receiving two immunizations, 95% of the CIA group developed severe arthritis. Intraperitoneal injections of Antcin K (10 or 30 mg/kg; see the study timeline in ( ) were administered on alternative days for a total of 4 weeks. Arthritis severity was assessed in each knee by plethysmometer measurements. The mice were sacrificed after 42 days of treatment. The phalanges and ankle joints were removed and fixed in 4% paraformaldehyde for micro-computed tomography (micro-CT) analysis.
Figure 7

Antcin K ameliorated paw swelling and cartilage degradation in CIA mice. (A) Workflow of CIA induction and Antcin K injections. (B, C) Hind paw swelling was photographed and measured with a digital plethysmometer in healthy controls, untreated CIA mice, and in CIA mice administered Antcin K 10 mg/kg or 30 mg/kg for 48 weeks. Representative micro-CT images of the hind paws were recorded on Day 48. (D, E) Quantifications of bone volume, bone surface, and bone density. (F–I) Serum levels of TNF-α, IL-1β, IL-6 and IL-8 were analyzed by ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; < 0.05 compared with the untreated CIA mice.

Human Synovial Tissue and Synovial Fluid Samples

Human RA synovial tissues and synovial fluid samples (N=6) was obtained from patients with RA during knee replacement surgery and non-arthritic synovial tissue was obtained at arthroscopy after trauma joint derangement. The study protocol was approved by the Institutional Review Board of China Medical University Hospital (CMUH108-REC3-039). All patients completed written informed consent before study enrollment.

Histopathological Analysis

Histopathological changes were examined by hematoxylin and eosin (H&E) and Safranin-O staining using a light microscope. For immunohistochemical (IHC) staining, 5-µm sections were prepared from paraffin-embedded tissue, deparaffinized in xylene and rehydrated with ethanol or citrate buffer (pH 6.0) for 20 min at 95°C. The specimens were stained with specific primary antibodies anti-TNF-α (A11534), anti-IL-1β (SC-7884), or anti-IL-8 (ab18672). All specimens were separately scored by two researchers in a blinded manner and the inter-rater reliability was assessed. presents the results from microscopic evaluation of inflammation scores and gives a detailed analysis of pathology findings in ankle joint synovium and adjacent tissue from healthy control mice and CIA mice (untreated or treated with Antcin K) in slides stained with H&E, according to previous research (25, 26). All of the slides were independently evaluated by two pathologists blinded to treatment.

Statistical Analysis

All statistical analyses were carried out using GraphPad Prism 5.0 (GraphPad Software) All results are represented as the mean ± standard deviation (SD) of at least six independent experiments. The Student’s t-test compared the means between experimental groups. The statistical difference was considered to be significant if the p-value was < 0.05.

Results

Upregulation of Proinflammatory Cytokines in Human RA Tissue and Plasma

In RA, proinflammatory cytokines are the principal pathological factors underlying the destruction of bone architecture and tissue damage at the site of inflammation (27). We observed aggressive proinflammatory cytokine activities in RA synovial tissue and fluid samples compared with normal healthy samples. IHC staining revealed higher levels of TNF-α, IL-1β and IL-8 in human RA tissue compared with samples from healthy controls ( ). Similarly, ELISA assay data revealed significantly higher expression of these proinflammatory cytokines in human RA plasma compared with control plasma ( ).
Figure 1

The identification of cytokines that interfere with RA severity. (A, B) RA and normal synovial tissue specimens were analyzed by IHC. (C) Cytokine plasma levels were upregulated in RA patients. ELISA assessments of blood samples (N=6) from RA patients and healthy volunteers determined levels of TNF-α, IL-1β and IL-8. Results are expressed as the mean ± SD. *P < 0.05 compared with controls.

The identification of cytokines that interfere with RA severity. (A, B) RA and normal synovial tissue specimens were analyzed by IHC. (C) Cytokine plasma levels were upregulated in RA patients. ELISA assessments of blood samples (N=6) from RA patients and healthy volunteers determined levels of TNF-α, IL-1β and IL-8. Results are expressed as the mean ± SD. *P < 0.05 compared with controls.

Antcin K Lowers the Production of Proinflammatory Cytokines in RASFs

RASFs are critical in the initiation of proinflammatory cytokine secretion and their stimulation by proinflammatory cytokines influences cartilage and bone degradation in the RA microenvironment (28). In this study, we employed an immortalized RASF cell line (MH7A) that exhibits similar characteristics to human RASFs (29) and produces TNF-α (30–32), IL-1β (33–35) and IL-8 (35–38). According to MTT data, incubation of human RASFs for 24 h with Antcin K (0.3, 1, 3, or 10 μM) did not affect cell viability ( ), so we used all doses for investigating dose-dependent effects and only the highest concentration (10 μM) was used for the protein array and pathway activator analyses ( ). Findings from the human inflammation protein array showed that TNF-α, IL-1β and IL-8 expression was significantly inhibited in human RASFs after 24 h of incubation with Antcin K (10 μM) compared with vehicle ( ), which was also the case with our Western blot results ( ). In further experiments, IL-6 expression was similarly significantly inhibited after RASFs were incubated with Antcin K (10 μM) for 24 h ( ). Antcin K was associated with significant dose-dependent (0.3, 1, 3, or 10 μM) reductions in levels of TNF-α, IL-1β and IL-8 mRNA, as well as protein expression in RASFs ( ). Thus, Antcin K appears to dose-dependently inhibit the production of proinflammatory cytokines in human RASFs.
Figure 2

Antcin K inhibits TNF-α, IL-1β and IL-8 expression in RASFs. (A) Chemical structure of compound Antcin K. (B) Cells were incubated with Antcin K (0.3, 1, 3 or 10 μM for 24 and cell viability was examined by the MTT assay. (C–E) Cells were incubated with Antcin K (10 μM) for 24 h and the expression of 40 inflammatory factors was quantified by a human inflammation antibody array. (F) Inhibitory effects of Antcin K on TNF-α, IL-1β, IL-6, IL-8 and protein secretion were evaluated by Western blot. (G–I) Cells were incubated with Antcin K (0.3, 1, 3 or 10 μM) for 24 h. TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were evaluated by qPCR, Western blot, and ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls.

Antcin K inhibits TNF-α, IL-1β and IL-8 expression in RASFs. (A) Chemical structure of compound Antcin K. (B) Cells were incubated with Antcin K (0.3, 1, 3 or 10 μM for 24 and cell viability was examined by the MTT assay. (C–E) Cells were incubated with Antcin K (10 μM) for 24 h and the expression of 40 inflammatory factors was quantified by a human inflammation antibody array. (F) Inhibitory effects of Antcin K on TNF-α, IL-1β, IL-6, IL-8 and protein secretion were evaluated by Western blot. (G–I) Cells were incubated with Antcin K (0.3, 1, 3 or 10 μM) for 24 h. TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were evaluated by qPCR, Western blot, and ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls.

The FAK/PI3K and AKT Signaling Cascades Are Implicated in Antcin K-Mediated Proinflammatory Cytokine Inhibition

The FAK/PI3K and AKT intracellular signaling pathways regulate cell growth and proliferation, and promote cytokine production (39). We examined whether FAK/PI3K and AKT signaling cascades interfere with the effects of Antcin K. Incubation of human RASFs with Antcin K (0.3, 1, 3, or 10 μM) for 24 h reduced the phosphorylation of FAK, PI3K and AKT ( , , ). Stimulating the RASFs with the FAK activator angiotensin, the PI3K activator 740-YP, and the AKT activator SC-79 (10 μM for each activator) significantly antagonized Antcin K-induced reductions of TNF-α, IL-1β and IL-8 production ( , , ). We then collected the cell culture medium from these treatments and we analyzed the levels of TNF-α, IL-1β and IL-8. Compared with untreated RASFs, levels of all three proinflammatory cytokines were significantly reduced in the RASFs treated with Antcin K ( – ). These findings suggest that Antcin K inhibits the production of these proinflammatory cytokines in RASFs via the FAK/PI3K and AKT signaling cascades.
Figure 3

The FAK pathway is involved in Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 production in RASFs. (A) Cells were treated with Antcin K (0.3, 1, 3 or 10 μM) for 24 h and FAK phosphorylation was examined by Western blot. (B–D) Cells were pretreated with the FAK activator Angiotensin II for 30 min, then treated with Antcin K (10 μM) for 24 h. TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were examined by qPCR, Western blot and ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; # P < 0.05 compared with the Antcin K-treated group.

Figure 4

The PI3K pathway is involved in Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 production in RASFs. (A) Cells were treated with Antcin K (0.3, 1, 3 or 10 μM) for 24 h and PI3K phosphorylation was examined by Western blot. (B–D) Cells were pretreated with PI3K activator 740-YP for 30 min, then treated with Antcin K (10 μM) for 24 h. TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were examined by qPCR, Western blot and ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; # P < 0.05 compared with the Antcin K-treated group.

Figure 5

The AKT pathway is involved in Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 production in synovial fibroblasts. (A) Cells were treated with Antcin K (0.3, 1, 3, or 10 μM) for 24 h and AKT phosphorylation was examined by Western blot. Cells were pretreated with an AKT activator (SC-79) for 30 min, then treated with Antcin K (10 μM) for 24 h. (B–D) TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were examined by qPCR, Western blot and ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; # P < 0.05 compared with the Antcin K-treated group.

The FAK pathway is involved in Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 production in RASFs. (A) Cells were treated with Antcin K (0.3, 1, 3 or 10 μM) for 24 h and FAK phosphorylation was examined by Western blot. (B–D) Cells were pretreated with the FAK activator Angiotensin II for 30 min, then treated with Antcin K (10 μM) for 24 h. TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were examined by qPCR, Western blot and ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; # P < 0.05 compared with the Antcin K-treated group. The PI3K pathway is involved in Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 production in RASFs. (A) Cells were treated with Antcin K (0.3, 1, 3 or 10 μM) for 24 h and PI3K phosphorylation was examined by Western blot. (B–D) Cells were pretreated with PI3K activator 740-YP for 30 min, then treated with Antcin K (10 μM) for 24 h. TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were examined by qPCR, Western blot and ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; # P < 0.05 compared with the Antcin K-treated group. The AKT pathway is involved in Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 production in synovial fibroblasts. (A) Cells were treated with Antcin K (0.3, 1, 3, or 10 μM) for 24 h and AKT phosphorylation was examined by Western blot. Cells were pretreated with an AKT activator (SC-79) for 30 min, then treated with Antcin K (10 μM) for 24 h. (B–D) TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were examined by qPCR, Western blot and ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; # P < 0.05 compared with the Antcin K-treated group.

The NF-κB Pathway Is Implicated in Antcin K-Mediated Proinflammatory Cytokine Inhibition

The NF-κB transcription factor is a critical player in inflammatory diseases (40) and is capable of activating several major proinflammatory cytokines including TNF-α, IL-1β and IL-8 (41, 42). We therefore examined whether Antcin K interferes with NF-κB phosphorylation. Treating RASFs with Antcin K (0.3, 1, 3, or 10 μM) for 24 h dose-dependently reduced NF-κB phosphorylation ( ). Prostratin rescued Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 expression ( ). Transfecting the RASFs with the NF-κB luciferase plasmid after incubation with Antcin K (0.3, 1, 3, or 10 μM) for 24 h dose-dependently reduced NF-κB luciferase reporter activity ( ). Antcin K appears to inhibit proinflammatory cytokines by inhibiting the NF-κB signaling cascades.
Figure 6

The NF-κB pathway is involved in Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 production in RASFs. (A) Cells were treated with Antcin K (0.3, 1, 3 or 10 μM) for 24 h and NF-κB phosphorylation was examined by Western blot. Cells were pretreated with the NF-κB activator (prostratin) for 30 min, then treated with Antcin K (10 μM) for 24 h. (B–D) TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were examined by qPCR, Western blot and ELISA. (E) Cells were transfected with the NF-κB luciferase plasmid, then incubated with Antcin K (0.3, 1, 3, or 10 μM) for 24 h and luciferase activity was determined. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; # P < 0.05 compared with the Antcin K-treated group.

The NF-κB pathway is involved in Antcin K-induced inhibition of TNF-α, IL-1β and IL-8 production in RASFs. (A) Cells were treated with Antcin K (0.3, 1, 3 or 10 μM) for 24 h and NF-κB phosphorylation was examined by Western blot. Cells were pretreated with the NF-κB activator (prostratin) for 30 min, then treated with Antcin K (10 μM) for 24 h. (B–D) TNF-α, IL-1β and IL-8 mRNA expression and protein secretion were examined by qPCR, Western blot and ELISA. (E) Cells were transfected with the NF-κB luciferase plasmid, then incubated with Antcin K (0.3, 1, 3, or 10 μM) for 24 h and luciferase activity was determined. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; # P < 0.05 compared with the Antcin K-treated group.

Antcin K Attenuates Signs and Symptoms of RA Disease in CIA Mice

We next examined the anti-arthritic effects of Antcin K in CIA mice. Antcin K 10 mg/kg and 30 mg/kg significantly reduced the extents of paw swelling and bone degradation in CIA mice compared with controls ( ). Micro-CT imaging of the hind paws showed how Antcin K ameliorated bone erosion and enhanced bone mineral density ( ). Serum levels of TNF-α, IL-1β and IL-8 were significantly reduced in Antcin K-treated CIA mice ( ); notably, IL-6 levels were also significantly reduced in further experiments ( ). Antcin K ameliorated paw swelling and cartilage degradation in CIA mice. (A) Workflow of CIA induction and Antcin K injections. (B, C) Hind paw swelling was photographed and measured with a digital plethysmometer in healthy controls, untreated CIA mice, and in CIA mice administered Antcin K 10 mg/kg or 30 mg/kg for 48 weeks. Representative micro-CT images of the hind paws were recorded on Day 48. (D, E) Quantifications of bone volume, bone surface, and bone density. (F–I) Serum levels of TNF-α, IL-1β, IL-6 and IL-8 were analyzed by ELISA. Results are expressed as the mean ± SD. *P < 0.05 compared with controls; < 0.05 compared with the untreated CIA mice. IHC staining of synovium tissue revealed significantly higher TNF-α, IL-1β and IL-8 expression in CIA mice compared with controls; both concentrations of Antcin K (10 mg/kg and 30 mg/kg) significantly reduced the levels of all three cytokines ( ). Inflammatory cell infiltration into the synovial cell layers was significantly and dose-dependently reduced by Antcin K compared with untreated CIA mice ( and ); synovium inflammation was also significantly and dose-dependently reduced by Antcin K compared with no treatment ( and ). Thus, Antcin K appears to inhibit RA disease activity in CIA mice.
Figure 8

Effects of Antcin K quantified by histopathological changes in ankle joints from CIA mice. (A) Representative magnified images of histologic sections taken from ankle joints that were stained with H&E and Safranin-O, and IHC staining for TNF-α, IL-1β and IL-8 antibodies from healthy controls, untreated CIA mice, and CIA mice administered Antcin K 10 mg/kg or 30 mg/kg (N=6 per group). (B–D) Quantification of TNF-α, IL-1β and IL-8 expression by IHC score. (E, F) Quantification of inflammation scores and pathology findings in ankle joint synovium and adjacent tissue (details are provided in ). Results are expressed as the mean ± SD. *P < 0.05 compared with controls; < 0.05 compared with the untreated CIA mice.

Effects of Antcin K quantified by histopathological changes in ankle joints from CIA mice. (A) Representative magnified images of histologic sections taken from ankle joints that were stained with H&E and Safranin-O, and IHC staining for TNF-α, IL-1β and IL-8 antibodies from healthy controls, untreated CIA mice, and CIA mice administered Antcin K 10 mg/kg or 30 mg/kg (N=6 per group). (B–D) Quantification of TNF-α, IL-1β and IL-8 expression by IHC score. (E, F) Quantification of inflammation scores and pathology findings in ankle joint synovium and adjacent tissue (details are provided in ). Results are expressed as the mean ± SD. *P < 0.05 compared with controls; < 0.05 compared with the untreated CIA mice.

Discussion

RA is associated with synovial inflammation and joint destruction (43). Onset of the disease is characterized by pannus formation and a hyperplastic synovium due to the deposition of synovial fibroblasts (10, 44). Compared with healthy fibroblasts, RASFs exhibit aggressive pathological characteristics in terms of structure and gene expression (45, 46). Moreover, activated RASFs exhibit a loss of contact inhibition (47) and accelerate the levels of adhesion molecules and proinflammatory cytokines including TNF-α, IL-1β and IL-8, causing synovial inflammation and cartilage damage (44). Anti-TNF therapy has already proven effective in the treatment of RA (48), while IL-1β is also a key proinflammatory cytokine in inflammation-related diseases and cell injury, with disrupted IL-1β signaling accelerating the pathogenesis of inflammatory disease (49). As for IL-8, its abundant expression during inflammation promotes the formation of new blood vessels (50). Our study findings demonstrate high levels of TNF-α, IL-1β and IL-8 expression in human RA synovial tissue and plasma. As revealed by our CIA mouse model, the levels of these proinflammatory cytokines were closely associated with RA disease activity, with higher expression related to increasingly severe cartilage and bone degradation. Several pharmacological inhibitors block these proinflammatory cytokines, including infliximab, etanercept, adalimumab and golimumab (51). However, loss of treatment responsiveness is common and side effects can develop that only subside after treatment discontinuation (52). Indigenous or traditional medicines involving herbal extracts are often considered to be ‘natural’ and causing fewer side effects than synthetic pharmacotherapies. The unique fungus A. cinnamomea has been used for hundreds of years in traditional medicines of Taiwan to treat liver diseases, food and drug intoxication, hypertension, cancers and inflammatory disorders, amongst other conditions (15, 53). Evidence has shown that extracts from A. cinnamomea have anti-inflammatory properties, such as the active compound ergostatrien-3β-ol (ST1), which significantly decreases mRNA levels of pro-inflammatory genes including IL-6 and inducible nitric oxide synthase (iNOS) and levels of TNF-α, NF-κB and IL-6 protein expression, reducing inflammatory reactions after skin flap surgery (54). Moreover, when cultured in the solid state and in wood, A. cinnamomea protects the lung against hyperoxia-induced acute lung injury in mice by reducing hyperoxia-induced generation of reactive oxygen species (ROS) and suppresses IL-6, TNF-α, IL-1β, IL-8, IKKα/β and iNOS expression (55). Amongst the functional compounds derived from the fruiting bodies of A. cinnamomea (56), the findings of this suggest that the triterpenoid Antcin K mediates anti-inflammatory activity in RA disease with no apparent signs of cytotoxicity. The FAK/PI3K and AKT signaling cascades initiate proinflammatory cytokine production (57, 58) and are important in inflammation to regulate multicellular functions at the site of synovial proliferation and promote cytokine production from RASFs (59, 60). Antcin K treatment inhibits the migration and invasion of human hepatoma cells by suppressing the phosphorylation of FAK, PI3K and AKT signaling (61). Our study demonstrates that Antcin K downregulates FAK/PI3K and AKT phosphorylation. When we subsequently used specific activators to upregulate TNF-α, IL-1β and IL-8 expression, Antcin K treatment restored the levels to normal. These findings suggest that FAK/PI3K and AKT intracellular signaling cascades are pivotal in Antcin K-mediated proinflammatory cytokine production in RASFs. NF-κB is a transcription factor that is not only vital in inflammatory responses, but also is a key molecule in the link between chronic inflammation and cancer (41, 62). We therefore examined whether Antcin K interferes with the NF-κB pathway. Interestingly, we found that 24 h of Antcin K treatment inhibited NF-κB phosphorylation and this activity was rescued by the NF-κB activator prostratin. Moreover, when we transfected RASFs with the NF-κB luciferase plasmid, we found that Antcin K dose-dependently inhibited NF-κB luciferase activity. These findings suggest that Antcin K has potential for blocking proinflammatory cytokine production via the inhibition of the FAK/PI3K, AKT and NF-κB signaling cascades. Structural cartilage and bone degradation are the hallmarks of RA, with circulating RASFs promoting this damage to unaffected joints (63), contributing to the production of cytokines and proteolytic enzymes that degrade the extracellular matrix (45). Our experimental findings reveal that CIA mice administered intraperitoneal injections of Antcin K (10 mg/kg or 30 mg/kg) exhibit reductions in paw swelling, bone erosion and cartilage bone degradation, as well as lower serum levels of proinflammatory cytokines TNF-α, IL-1β, IL-8 and IL-6 compared with normal controls. In conclusion, our observations indicate that the inhibition of TNF-α, IL-1β and IL-8 production in RASFs and in serum and synovial tissue from CIA mice attenuates signs and symptoms of RA ( ) and that Antcin K significantly inhibits these proinflammatory cytokines via the FAK/PI3K, AKT and NF-κB signaling cascades. Derivatives of A. cinnamomea have exhibited varying pharmacological activity in experimental models of tumors, inflammation, immunomodulation, hepatotoxicity, diabetes and hyperlipidemia (53). In one study, triterpenoids isolated from A. cinnamomea mycelia were protective against acute alcohol-induced liver injury in mice (64) and in another study, A. cinnamomea polysaccharides inhibited vascular endothelial growth factor receptor (VEGFR) signaling in bovine aortic endothelial cells (65). This study has shown for the first time that the A. cinnamomea extract Antcin K inhibits RA disease activity in human RASFs and in a mouse model of RA. These findings offer new opportunities for RA disease management.
Figure 9

Schematic diagram summarizes the mechanism whereby Antcin K inhibits proinflammatory cytokine production. Antcin K inhibits TNF-α, IL-1β and IL-8 production in human RA synovial fibroblasts and in serum and synovial tissue from CIA mice. These anti-inflammatory effects occur through the FAK/PI3K, AKT, and NF-κB signaling cascades.

Schematic diagram summarizes the mechanism whereby Antcin K inhibits proinflammatory cytokine production. Antcin K inhibits TNF-α, IL-1β and IL-8 production in human RA synovial fibroblasts and in serum and synovial tissue from CIA mice. These anti-inflammatory effects occur through the FAK/PI3K, AKT, and NF-κB signaling cascades.

Institutional Review Board Statement

The animal study and protocols were approved by the Institutional Animal Care and Use Committee of China Medical University (IACUC Approval No: 2016-295).

Data Availability Statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/ .

Ethics Statement

The study protocol was approved by the Institutional Review Board of China Medical University Hospital (CMUH108-REC3-039). Written informed consent to participate in this study was provided by the participants’ legal guardian/next of kin. The animal study and protocols were approved by the Institutional Animal Care and Use Committee of China Medical University (IACUC Approval No: 2016-295). Written informed consent was obtained from the owners for the participation of their animals in this study.

Author Contributions

DA and C-HTa conceived and designed the project. Methodology was performed by DA and S-CL. Experiments and data analysis were performed by DA and Y-YL. Histological analysis and interpreted the results by I-PC. Reagents, materials and analytical tools were supplied by C-HTa and Y-HK. Funding was acquired by C-HTa. The paper was written by DA and revised by C-CH, C-HTs, C-YK, and C-HTa. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by grants from the Ministry of Science and Technology in Taiwan (MOST 110-2320-B-039-022-MY3; MOST 110-2314-B-039-008; MOST 110-2314-B-039-012), and China Medical University under the Higher Education Sprout Project, Ministry of Education, Taiwan (CMRC-CHM-2-2) and China Medical University Hospital (DMR-111-165; DMR-111-117; DMR-111-028).

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
  58 in total

1.  Inhibiting the PI3K/AKT/NF-κB signal pathway with nobiletin for attenuating the development of osteoarthritis: in vitro and in vivo studies.

Authors:  Linzhen Xie; Huanguang Xie; Chunhui Chen; Zhenyu Tao; Chuanxu Zhang; Leyi Cai
Journal:  Food Funct       Date:  2019-04-17       Impact factor: 5.396

Review 2.  Antrodia cinnamomea-An updated minireview of its bioactive components and biological activity.

Authors:  Nagarajan Ganesan; Rathinasamy Baskaran; Bharath Kumar Velmurugan; Nguyen Chi Thanh
Journal:  J Food Biochem       Date:  2019-06-04       Impact factor: 2.720

3.  Comparison of solid-state-cultured and wood-cultured Antrodia camphorata in anti-inflammatory effects using NF-κB/luciferase inducible transgenic mice.

Authors:  Yu-Tang Tung; Tung-Chou Tsai; Yueh-Hsiung Kuo; Chih-Ching Yen; Jheng-Yue Sun; Wen-Hui Chang; Hsiao-Ling Chen; Chuan-Mu Chen
Journal:  Phytomedicine       Date:  2014-09-16       Impact factor: 5.340

Review 4.  Novel therapeutic targets in rheumatoid arthritis.

Authors:  Marije I Koenders; Wim B van den Berg
Journal:  Trends Pharmacol Sci       Date:  2015-02-27       Impact factor: 14.819

5.  Guizhi-Shaoyao-Zhimu decoction possesses anti-arthritic effects on type II collagen-induced arthritis in rats via suppression of inflammatory reactions, inhibition of invasion & migration and induction of apoptosis in synovial fibroblasts.

Authors:  Qing Zhang; Wei Peng; Shujun Wei; Daneng Wei; Ruolan Li; Jia Liu; Lanyu Peng; Shuang Yang; Yongxiang Gao; Chunjie Wu; Xufeng Pu
Journal:  Biomed Pharmacother       Date:  2019-08-21       Impact factor: 6.529

6.  Myelin activates FAK/Akt/NF-kappaB pathways and provokes CR3-dependent inflammatory response in murine system.

Authors:  Xin Sun; Xi Wang; Tianxiang Chen; Tianyi Li; Kai Cao; Andrew Lu; Yongxiong Chen; Dongming Sun; Jianhong Luo; Jianqing Fan; Wise Young; Yi Ren
Journal:  PLoS One       Date:  2010-02-23       Impact factor: 3.240

Review 7.  Recent research and development of Antrodia cinnamomea.

Authors:  Mei-Chin Lu; Mohamed El-Shazly; Tung-Ying Wu; Ying-Chi Du; Tun-Tschu Chang; Chieh-Fu Chen; Yu-Ming Hsu; Kuei-Hung Lai; Ching-Peng Chiu; Fang-Rong Chang; Yang-Chang Wu
Journal:  Pharmacol Ther       Date:  2013-04-04       Impact factor: 12.310

8.  Regulatory roles of the PI3K/Akt signaling pathway in rats with severe acute pancreatitis.

Authors:  Ping Xu; Jing Wang; Zhi-wen Yang; Xiao-li Lou; Cheng Chen
Journal:  PLoS One       Date:  2013-11-28       Impact factor: 3.240

Review 9.  The Effect of Inflammation on Bone.

Authors:  Scott Epsley; Samuel Tadros; Alexander Farid; Daniel Kargilis; Sameer Mehta; Chamith S Rajapakse
Journal:  Front Physiol       Date:  2021-01-05       Impact factor: 4.566

Review 10.  Roles of NF-κB in Cancer and Inflammatory Diseases and Their Therapeutic Approaches.

Authors:  Mi Hee Park; Jin Tae Hong
Journal:  Cells       Date:  2016-03-29       Impact factor: 6.600

View more
  2 in total

1.  Antcin K inhibits VCAM-1-dependent monocyte adhesion in human rheumatoid arthritis synovial fibroblasts.

Authors:  David Achudhan; Sunny Li-Yun Chang; Shan-Chi Liu; Yen-You Lin; Wei-Chien Huang; Yang-Chang Wu; Chien-Chung Huang; Chun-Hao Tsai; Chih-Yuan Ko; Yueh-Hsiung Kuo; Chih-Hsin Tang
Journal:  Food Nutr Res       Date:  2022-06-02       Impact factor: 3.221

Review 2.  Paradoxical Duel Role of Collagen in Rheumatoid Arthritis: Cause of Inflammation and Treatment.

Authors:  Jeevithan Elango; Camilo Zamora-Ledezma; Baolin Ge; Chunyu Hou; Zhilin Pan; Bin Bao; Carlos Pérez Albacete Martínez; José Manuel Granero Marín; José Eduardo Maté Sánchez de Val; Chunling Bao; Wenhui Wu
Journal:  Bioengineering (Basel)       Date:  2022-07-15
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.