Literature DB >> 34975395

Selected Thiadiazine-Thione Derivatives Attenuate Neuroinflammation in Chronic Constriction Injury Induced Neuropathy.

Sonia Qureshi1, Gowhar Ali1,2, Muhammad Idrees3,4, Tahir Muhammad5,6, Il-Keun Kong3,4,7, Muzaffar Abbas8, Muhammad Ishaq Ali Shah9, Sajjad Ahmad10, Robert D E Sewell11, Sami Ullah1.   

Abstract

Neuropathic pain refers to a lesion or disease of peripheral and/or central somatosensory neurons and is an important body response to actual or potential nerve damage. We investigated the therapeutic potential of two thiadiazine-thione [TDT] derivatives, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid [TDT1] and 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid [TDT2] against CCI (chronic constriction injury)-induced neuroinflammation and neuropathic pain. Mice were used for assessment of acute toxicity of TDT derivatives and no major toxic/bizarre responses were observed. Anti-inflammatory activity was assessed using the carrageenan test, and both TDT1 and TDT2 significantly reduced carrageenan-induced inflammation. We also used rats for the induction of CCI and performed allodynia and hyperalgesia-related behavioral tests followed by biochemical and morphological analysis using RT-qPCR, immunoblotting, immunohistochemistry and immunofluorescence. Our findings revealed that CCI induced clear-cut allodynia and hyperalgesia which was reversed by TDT1 and TDT2. To determine the function of TDT1 and TDT2 in glia-mediated neuroinflammation, Iba1 mRNA and protein levels were measured in spinal cord tissue sections from various experimental groups. Interestingly, TDT1 and TDT2 substantially reduced the mRNA expression and protein level of Iba1, implying that TDT1 and TDT2 may mitigate CCI-induced astrogliosis. In silico molecular docking studies predicted that both compounds had an effective binding affinity for TNF-α and COX-2. The compounds interactions with the proteins were dominated by both hydrogen bonding and van der Waals interactions. Overall, these results suggest that TDT1 and TDT2 exert their neuroprotective and analgesic potentials by ameliorating CCI-induced allodynia, hyperalgesia, neuroinflammation and neuronal degeneration in a dose-dependent manner.
Copyright © 2021 Qureshi, Ali, Idrees, Muhammad, Kong, Abbas, Shah, Ahmad, Sewell and Ullah.

Entities:  

Keywords:  allodynia/hyperalgesia; astrocyte; neuropathic pain; thiadiazine-thione; tumor necrotic factor-alpha

Year:  2021        PMID: 34975395      PMCID: PMC8716630          DOI: 10.3389/fnmol.2021.728128

Source DB:  PubMed          Journal:  Front Mol Neurosci        ISSN: 1662-5099            Impact factor:   5.639


Introduction

Neuropathic pain is a condition instigated by a lesion of somatosensory neurons including both the peripheral and/or the central nervous system (Jensen et al., 2011). Neuropathologically, it is an important body response that indicates actual or potential neuronal damage and protects the body from deep injuries. Neuronal damage that leads to neuropathic pain may last for years (Alles and Smith, 2018) and, together with nociceptive pain, represents a fundamental pain condition (Freynhagen et al., 2019). Chronic neuropathic pain usually encompasses both peripheral and central neuropathic pain (Scholz et al., 2019). Often, it is ineffectively controlled clinically, possibly due to its complex etiology regularly characterized by clinical manifestations such as allodynia, paresthesia, stinging pain, numbness, and hyperalgesia that result in generalized discomfort and an altered quality of life (Jensen and Finnerup, 2014; Wu et al., 2019). The exact pathogenesis of neuropathic pain is still largely unknown, however, some evidence indicates that neurotransmitter systems involving ion channels, multiple types of receptor and various peripheral and central nervous system cells interactively contribute to the pathogenesis of neuropathological pain (Descalzi et al., 2015). An epidemiological survey has shown that quite a high proportion of patients with neuropathic pain do not receive completely appropriate therapy (Kapural et al., 2018). For the treatment of peripheral neuropathy, first-line drugs include tricyclic antidepressants (TCA), anticonvulsants, non-steroidal anti-inflammatory drugs (NSAID), topical lidocaine, and selective serotonin and norepinephrine reuptake inhibitors (SNRI). TCAs are effective for multiple types of neuropathic pain including nerve injury pain, diabetic peripheral neuropathic pain and central post-stroke pain (Xu et al., 2012; Pusan and Abdi, 2018), Moreover, selected anticonvulsants are considered to be the drugs of choice for treatment of peripheral neuropathies (Muthuraman and Singh, 2012) but they are associated with adverse effects including dizziness, hallucinations, confusion, somnolence, and sedation. The second-line treatments for neuropathies include opioid analgesics like tramadol, however, long term use of such analgesics may lead to dependence and a withdrawal syndrome at the end of therapy which may limit their chronic use (Johnson et al., 2015). Thiadiazine-thione derivatives (TDT) have been reported for their promising medicinal properties which include antibacterial, antifungal, anthelminthic, antiprotozoal, tuberculostatic (Avuloğlu-Yılmaz et al., 2017), herbicidal and antioxidant activities (Wang et al., 2019). In addition to antimicrobial activity, these compounds have a place in the treatment of arteriosclerosis and possess anti-fibrinolytic (Ozçelik et al., 2007), cytotoxic (Sever et al., 2016), and antiepileptic activity (Ahmad et al., 2017; Arshad et al., 2018). Thiadiazine-thione derivatives have also been studied as potential components of prodrugs for different biological activities. Thus, antibiotic drugs like ampicillin, amoxicillin, and cephalexin have been incorporated with the thiadiazine-thione nucleus to create prodrugs (Arshad et al., 2018). Despite the disclosure of several multiple pharmaceutical and biological activities of thiadiazine-thione derivatives, to date, these compounds have not been screened against neuropathic pain (Shah M. I. A. et al., 2019). Both neuroinflammatory and neuropathic pain involves a range of common mediators. These include nuclear factor-κB (NF-κB), activated microglia (ionized calcium-binding adaptor molecule 1 [Iba-1]), pro-inflammatory cytokines including tumor necrotic factor α (TNF-α), interleukin-1/8(Il-1/8) and the neurotrophin nerve growth factor (NGF). A selection of these mediators has been shown to contribute toward the initiation not only of thermal, but also mechanical hyperalgesia (Woolf et al., 1997). In relation to this, antibodies induced in response to TNF-α reduce hyperalgesia which tends to ameliorate rheumatoid arthritis (Bresnihan et al., 1998) and neuropathic pain. In contrast, there is an indication that endogenous IL-6 may mediate certain hypersensitive responses that characterize peripheral neuropathic pain (Murphy et al., 1999). In our study, we have explored the activity of two specific TDT derived test compounds, i.e., 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid (TDT1) (Figure 1A) and 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid (TDT2) (Figure 1B) in nociceptive and acute inflammation mice models. Then we developed a chronic constriction injury (CCI) rat model of neuropathic pain and examined the potentials of TDT1 and TDT2 against neuropathic pain. During the course of the investigation, we performed behavioral, biochemical and histopathological analyses to appraise the anti-inflammatory and antinociceptive potential of TDT1 and TDT2 against CCI-induced neuropathic pain in rodent models.
FIGURE 1

(A,B) Chemical structure of the test compounds 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid (TDT1) and 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid (TDT2). (C) Representative schematic diagram of the experiment schedule showing CCI-operation, behavioral analysis and treatment plan.

(A,B) Chemical structure of the test compounds 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid (TDT1) and 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid (TDT2). (C) Representative schematic diagram of the experiment schedule showing CCI-operation, behavioral analysis and treatment plan.

Materials and Methods

Chemicals and Kits

The following reagents with sources were employed: dimethyl sulfoxide DMSO (Cas No: 67-68-5) (Sigma, United States), Tween 80 (Cas No: 9005-65-6) (Sigma, United States), gabapentin (Cas No. 60142-96-3 (Sigma, United States), xylene (Cas No: 1330-20-7) (Thermo Fisher Scientific, United States), ketamine (Cas No:1867-66-9) (Sigma, United States), 1% acetic acid (Cas No: 64-19-7) (Sigma, United States), naloxone (Cas No: 357-08-4) (Sigma Aldrich, United States), tramadol (Cas No: 36282-47-0) (Sigma, United States), pentylenetetrazol (Cas No: 54-95-5) (Sigma-Aldrich, United States), 1% carrageenan (Cas No: 9000-07-1) (Sigma-Aldrich, United States), hematoxylin (Cas No: 517-28-2) (Sigma-Aldrich, United States), eosin (Cas No: 548-24-3) (Sigma-Aldrich, United States), normal saline (Cas No: 7647-14-5) (Sigma-Aldrich, United States), Aspirin (Cas No: 50-78-2) (Sigma-Aldrich, United States), ELISA Rat TNF-α Kit (Catalog No: E-EL-R0019) (Elabscience), ImunoCruz (Santa Cruz biotechnology. Inc., United States) (Catalog No: CA95060-5706), ab6789 Goat Pab to Ms IgG (Catalog No: GR311326-6) (Santa Cruz biotechnology), COX-2 mouse monoclonal IgM (Catalog No:sc-376861) (Santa Cruz biotechnology United States), p-NFᶄB p65 mouse monoclonal IgG 2b (Catalog No: sc-136548) Santa Cruz biotechnology, TNF-α IgG1 (Catalog No: sc-52746) (Santa Cruz biotechnology United States), Anti-Iba1 -AIF1 polyclonal antibody (Catalog No: K006764P) (Solarbio Life Sciences).

Animals and Experimental Groups

For hot plate, tail immersion, abdominal constriction, and carrageenan tests Balb-C mice (18–22 g) of both sexes were used and each group contained n = 6–8 animals. Mice were grouped as; (1) WT-vehicle (vehicle: normal saline with 1% tween and 2% DMSO) group, (2) STD group, (3) TDT 1–30 mg/kg, (4) TDT 1–45 mg/kg, (5) TDT 2–30 mg/kg, and (6) TDT 2–45 mg/kg. Sprague Dawley rats (300–450 g) were used for chronic constriction injury model generation. Animals were randomly assigned to separate groups each containing 6–8 rats. The study continued for 30 days and during this time we measured hind paw withdrawal latency. The experimental groups were designated as (1) Sham-operated group; (2) CCI group (vehicle: normal saline with 1% tween and 2% DMSO); (3) CCI + standard drug (STD) group; (4) CCI + TDT 1–30 mg/kg; (5) CCI + TDT 1–45 mg/kg; (6) CCI + TDT 2–30 mg/kg; (7) CCI + TDT 2–45 mg/kg. Both test compounds (TDT1 and TDT2) were dissolved in 2% DMSO plus 1% Tween 80 and vehicle in a ratio of 5:1:94. All chemical solutions were freshly prepared before drug administration. The experimental area was maintained on a12/12 h light/dark cycle at 22 ± 2°C. Rats were bred in the animal house and bioassay laboratory, Department of Pharmacy University of Peshawar. The animals had ad libitum access to food and water throughout. The experimental procedures on animals were performed according to United Kingdom Animals (Scientific procedures) Act 1986 and following protocols set by the ethical committee of the Department of Pharmacy, University of Peshawar (registration number: 19/EC/F.LIFE-2020). TDT derivatives were checked for their solubility pattern in different solvents that included dimethyl sulfoxide (DMSO), methanol, distilled water and dimethyl formide (DMF). Test compounds suspensions were made by mixing test compound with normal saline and made soluble by adding 1% tween along with 2% DMSO (Khan et al., 2019).

Experimental Design

Mice were acclimatized in the experimental room for 1 week after which they were used for tests like acute toxicity, hot plate, tail immersion abdominal constrictions and carrageenan tests for determination of antinociceptive and anti-inflammatory activities of TDT1 and TDT2. Next, rats were also acclimatized for 1 week in the experimental room followed by initiating the CCI model. Rats were allowed for 14 days to develop neuropathy. The development of neuropathy was confirmed by behavioral studies starting 1 day before CCI operation and continued on 3rd, 14th, 21st, and 28th day of the experiment. Treatment was started 14 days after the CCI operation and continued for 14 days. Rats were euthanized on day 30th and spinal cord tissue samples were collected for further biochemical and morphological analysis (Figure 1C).

Acute Toxicity Analysis

To determine the acute toxicity of either test compound, separate Balb-C mice irrespective of their sex were used in each group injected intraperitoneally with test compounds at doses ranging from Group 1 (250 mg/kg), Group 2 (350 mg/kg), Group 3 (500 mg/kg), Group 4 (650 mg/kg), and Group 5 (control) for each dose n = 6. After administering different doses, the behavior of each animal was observed for 2 h and then kept under longer-term observation during the ensuing 24 h period. Responses which included aggressiveness, ataxia, spontaneous locomotor activity, cyanosis, abdominal constriction reflex, catalepsy, tail pinch response and any bizarre behaviors were considered (Kheir et al., 2010; Kamil et al., 2021).

Anti-nociceptive Potential Analysis

Hot-Plate Test

Balb/C mice (18–22 g) were used to perform the hot-plate test. Animals were habituated in the experimental area for 1–2 h before starting each procedure. A hot-plate Analgesiometer (Harvard Apparatus) was pre-heated and maintained at 54 ± 1°C temperature. Responses entailing jumping, licking and hind paw flicking were carefully observed. At each endpoint, mice were removed from hot plate to avoid any tissue damage. Pre-tests were also performed to exclude animals that showed a latency of more than 15 s. A gap of 30 min was kept between pretesting and the test compound trial. After 30 min, standard drug (Tramadol 30 mg/kg), TDT1 or TDT2 was administered intraperitoneally to the allocated animal groups. The hot-plate readings were measured at 30, 60, 90, and 120 min after intraperitoneal injection of compounds. To establish any underlying mechanism or origin of the pain mechanism, naloxone 1mg/kg (NLX) subcutaneously (s.c) or pentylenetetrazol 15 mg/kg (PTZ) intraperitoneally (i.p.) were administered 10 min before dosing with test compound (Akbar et al., 2016). Percentage analgesia was calculated from the formula:

Tail Immersion Test

To assess the analgesic potential of test compounds, mice were habituated for 2 h in the experimental area. A water bath was maintained at a temperature of 55 ± 5°C and the tail of each animal was immersed in the water bath by gently holding it in a vertical position then carefully immersing the tail. The latency (s) to a tail-flick response was determined and a cut-off time of 15 s was imposed. Pre-drug latency readings were recorded after which animals were given an i.p. injection of standard (STD Tramadol 30 mg/kg), control and test compounds. Post-drug readings were observed at 0, 30, 60, and 120 min after the administration of all drugs (Shahid et al., 2017). Percentage analgesia was calculated according to the following formula:

Abdominal Constriction Test

The abdominal constriction test was performed to assess the mouse abdominal constrictions in peripheral algesia. Intraperitoneal injection of 1% acetic acid (10 ml/kg) was administered to individual mice in each group. Water and food were withheld 2 h before starting the experiment and all treatment groups were given their respective drug/test compound 30 min before administration of 1% acetic acid. Five min after administration of acetic acid, the incidence of abdominal constrictions was counted for 20 min duration which was compared with the standard Aspirin (50 mg/kg) group. Percentage analgesia was calculated by the following formula (Abbas et al., 2011):

Anti-inflammatory Carrageenan Test

To check for any anti-inflammatory propensity of TDT test compounds, the carrageenan test was performed. Each mouse (15–20 g) was given food with free access to water. All test compound groups and standard Aspirin (50 mg/kg) group were given their respective treatments intraperitoneally. After 30 min the same animals of each group were injected with 0.05 ml of 1% carrageenan in the sub plantar area of the right hind paw. The volume of the paw was measured before carrageenan administration, and which were again repeated after administration of carrageenan from 1 to 5 hourly intervals (Fehrenbacher et al., 2012; Zadeh-Ardabili and Rad, 2019). A digital plethysmometer was used to measure the paw volume and relative inflammation was estimated by the following formula: “P1” represented the increased paw volume in the carrageenan-treated group. “P” represented the increased paw volume in the drug-treated group.

Chronic Constriction Injury Model Generation

Neuropathic pain was induced in male rats through the chronic constriction injury (CCI) model by placing loosely constrictive ligatures around the common sciatic nerve (Bennett and Xie, 1988). Each animal was anesthetized with xylene 10 mg/kg and ketamine 100 mg/kg i.p (Medeiros et al., 2020). Each rat was then laid in the prone position on a heat-controlled pad. The left thigh was slightly elevated and the posterior hair was shaved to expose the skin for incision. The skin was then cleaned with topical povidone-iodine 10% w/v solution. The sciatic nerve was exposed by a 3–4 cm incision parallel to the long axis of the femur and down the center of the femoris muscle followed by cutting of connective tissue between the gluteus superficialis and bicep femoris muscle. The gap between the two muscles was opened by a ribbon retractor and up to 10 mm sciatic nerve was exposed and tied with four loose ligature (chromic catgut sutures 4/0, metric 2) with a double knot 1 mm apart from each other. After ligation, the muscle was closed with the help of silk braided 2/0 metric sutures and the skin was then closed up with a surgical skin stapler. There was a sham-operated animal group in which the sciatic nerve was uncovered but not ligated (Gu and Pan, 2015).

Behavioral Analysis

Static Mechanical Allodynia

A consecutive series of 8 von Frey filaments (0.4, 0.7, 1.2, 2.0, 3.0, 5.0, 8.0, and 15.1g) were applied at 90 degrees to mid plantar fasciitis surface of the constricted left leg hind paw to an extent where bending of the von Frey filament occurred up to a cut-off time of 6 s or until the appearance of an animal positive response (paw withdrawal PWD or licking). Paw flinching and lifting on the removal of the filament were recorded as a positive response. The same procedure was repeated four times after the first positive response or five consecutive negative responses. A15.1 g force was selected as a cut-off force after which further force application was terminated (La and Chung, 2017).

Dynamic Mechanical Allodynia

To evaluate dynamic mechanical allodynia, a cotton bud was lightly stroked on the mid plantar surface of the operated rat hind paw, with a cut-off time of 15 s. Licking or withdrawal of the paw was taken as a positive response and the time for this to occur, was considered as the paw withdrawal latency (PWL) (Nakazato-Imasato et al., 2009).

Cold Allodynia

The mid plantar surface of the operated rat hind paw was covered with a 50 μl drop of acetone using a blunt needle without touching the skin. The paw withdrawal response was recorded with an arbitrary minimal value of 0.5 s and a maximum of 15 s (Decosterd and Woolf, 2000).

Thermal Hyperalgesia

To measure the thermal nociceptive threshold following test compound treatment, the hot-plate Analgesiometer method (Harvard Apparatus) was employed at a maintained temperature of 52 ± 2°C. Each animal was placed in a hot-plate chamber surrounded by transparent walls and a lid. The nociceptive response latency to paw licking, flicking or jumping was recorded with cut-off time of 15 s (Su et al., 2017).

Pinprick Test

The mid plantar surface of the operated rat hind paw was touched perpendicularly with a blunt needle applying sufficient force to evoke a pinprick withdrawal response but at an intensity which was insufficient to penetrate the skin. Paw withdrawal duration (PWD) was recorded and compared with the normal value of 0.5 s (Kukkar et al., 2013). Hyperalgesia analysis was performed according to Erichsen and Blackburn-Munro (2002).

Enzyme-Linked Immunosorbent Assay

At the end of the treatment, male rats (n = 3–4) were euthanized by administering xylene (20 mg/ml) and ketamine (50 mg/ml). Spinal cords (lumbar region) were removed carefully and stored at −80°C until further analysis. Spinal cord samples were then homogenized in Tris buffer saline with protease inhibitor mix and 1% Triton X-100. The homogenized spinal cord tissues were then centrifuged at 17,000 × g at 4°C for 30 min. The supernatant was then collected and stored at −80°C to be analyzed later. Spinal cord TNF-α was measured using an ELISA kit (Rat TNF-α Elabscience), according to the manufacturer’s instructions (Jung et al., 2017).

RNA Extraction and Reverse Transcription-Quantitative PCR

For RT-qPCR analysis of mRNA expression, spinal cord tissue (lumbar region) samples were used for mRNA isolation using a Dynabeads Direct kit for mRNA (Cat#: 61012, Thermo Fisher Scientific, MA, United States). The mRNA concentration was determined via NanoDrop™ (Cat#: 2000C, Fisher Scientific, MA, United States). cDNA was synthesized from mRNA by utilizing the iScriptRcDNA Synthesis Kit (Cat#: 1708890, Bio-Rad Laboratories, CA, United States). RT-qPCR primers were designed (Table 1) using the online primer blast tool[1], which was used to analyze the transcription level of genes of interest. ASYBR Green Super Mix Kit (cat#: 170-8882, Bio-Rad Laboratories, CA, United States) was used for gene expression analysis of the level of genes of interest via aCFX98 instrument (Ref#:1855195, Bio-Rad Laboratories, CA, United States). Samples were processed in triplicate and the relative gene expression was calculated by employing the threshold ΔΔ C(t) method. We used the GAPDH gene as endogenous control and for data standardization (Idrees et al., 2020).
TABLE 1

Details of primers and primary antibodies used in RT-qPCR, WB, IHC, and IF analysis.

NameAccession no.Order nameSequence (5′–3′)Product size (bp)
Iba1 (Aif1) NM_017196.3 FCAGCCTCATCGTCATCTCCC112
RTTCCTGTTGGGCTTTCAGCA
NF-κB (Rela) NM_199267.2 FTGGTCACCAAAGACCCACCT150
RGGTCTCGCTTCTTCACACAC
TNF-α NM_012675.3 FCATCCGTTCTCTACCCAGCC146
RAATTCTGAGCCCGGAGTTGG
Cox2 S67722.1 FGTTCCATTTGTGAAGATTCCTGTGT102
RCTCACTGGCTTATGCCGAAA

Antibody Host Application Concentration Catalog #

Anti-Iba1 (Aif1)RabbitIHC1:100K006764P
Anti-Iba1 (Aif1)RabbitWB1:1000, 1:800#17198
Anti-NF-κB (p65)MouseWB, IHC1:500, 1:100sc-136548
Anti-TNF-αMouseWB, IF, IHC1:500, 1:100, 1:100sc-52746
Anti-Cox2MouseWB, IHC1:500, 1:100sc-376861

F, forward; R, reverse; WB, Western blot; IF, Immunofluorescence; IH, immunohistochemistry.

Details of primers and primary antibodies used in RT-qPCR, WB, IHC, and IF analysis. F, forward; R, reverse; WB, Western blot; IF, Immunofluorescence; IH, immunohistochemistry.

Immunoblotting

Western blot analysis was performed as previously described (Muhammad et al., 2019) with some minor changes. In brief, spinal cord tissue (lumbar region) samples were dissolved in the protein extraction buffer (PRO-PREP, Cat#: 17081, iNtRON Biotechnology, NJ, United States). Samples were homogenized and the lysates were then centrifuged and fractionated on an SDS-PAGE gel. The protein was subsequently transferred to a polyvinylidene fluoride membrane, blocked with 3% BSA for 1 h, washed and incubated with primary antibodies of interest (Table 1) overnight at 4°C on a shaker. Afterward, membranes were incubated with secondary HRP conjugated antibody at RT for 2 h and then protein was visualized by using a chemiluminescence detection kit (Pierce™ECL substrate, Cat# 32109).

Immunohistochemistry

Spinal cord samples (lumbar region) were fixed in 4% paraformaldehyde and embedded in paraffin. The tissue was then sectioned in a cryostat with a microtome blade set at a thickness of 40 μm and the slices were processed for immune-staining by the free-floating method. The spinal cord tissue sections were deparafinised with three absolute xylene washes followed by rehydration with ethyl alcohol (from 100 to 70%). In the next step slides were washed with distilled water and immersed in 0.01 M in PBS for 10 min. The heat method was used for antigen retrieval followed by slide cooling and washing with PBS twice. After the antigen retrieval step, slides were quenched with 3% hydrogen peroxide in methanol for 5–10 min. The sections were then blocked with 5% normal goat serum for 1.5 h at room temperature. Slides were then divided to check different markers. Slides were washed with primary antibodies (Table 1) overnight at 4°C. The next day after washing with PBS for 10 min, slides were washed with secondary antibody ab6789 Goat pAb to MsIgG (HRP) and incubated for 2 h at room temperature followed by incubation in ABC complex (Immune Cruz ABC kit) for 1 h. The tissue on slides was then washed with PBS and stained with Dab solution until they appeared brown. Afterward, slides were washed with distilled water and rehydrated in graded ethanol (70, 80, 90, and 100%). Slides were fixed in xylene and covered sliped with mounting media. Images were taken by connecting a light microscope with a digital photomicroscopy system. Four slides were processed for each primary antibody. The quantification of the % area for each primary antibody occupied was carried out using Image J software for all the groups and was expressed as the relative integrated density relative to the sham group (Jia et al., 2015; Shah F. A. et al., 2019).

Confocal Immunofluorescence Analyses

For immunofluorescence staining, the spinal cord tissue samples (lumbar region) were blocked in 4% (v/v) paraformaldehyde in 1 M PBS and stored at 4°C as previously described (Ikram et al., 2019; Ahmad et al., 2020). On the day of staining, tissue samples were washed 2× with 0.3% polyvinyl alcohol in 1× PBS (PBS-PVA). The tissue samples were further permeabilized with 0.1% protein K solution for 5 min then after washing twice with PBS-PVA the samples were incubated in 5% blocking solution (BSA-PBS-PVA) for 90 min. After blocking, TNF-a primary antibody was applied to samples and stored at 4°C overnight. The next day, samples were again washed twice with PBS-PVA for 10 min and samples had secondary antibodies (FITC and TRITC)applied at room temperature for 90 min. Samples were then treated for nuclear staining with 4, 6-diamidino-2-phenylindole (10 μg/ml) for about 5 min. After completing the final staining step, samples were washed with PBS-PVA three times for at least 5 min and final tissue samples were then mounted with a fluorescent mounting medium and covered with a coverslip. To capture the images, a confocal laser scanning microscope (Fluoview FV 1000, Olympus, Japan) was used and the images were analyzed by Image J software (National Institute of Health, Bethesda, MD, United States) for relative integrated density of the signals.

Hematoxylin and Eosin Staining

After completion of the 15 days CCI protocol, rat spinal cord tissue (lumbar region) was collected and subjected to Hematoxylin and eosin (H and E) staining by a well-established method (Fischer et al., 2008). After curing the mounting media, the samples were observed under a light microscope and the lesion area was measured using Image J software. The relative lesion was defined as an inflammatory area divided by the area of the whole longitudinal spinal cord 2 mm from the epicenter of the injury.

Molecular Docking

Molecular docking is useful in silico approach widely employed in predicting the binding affinity and binding mode of ligands to a given biomolecule. In this work, our objective was to rank the binding affinities of TDT1 and TDT2 for COX-2 (PDB ID: 3NT1) and TNF-α (PDB ID: 1TNF) to correlate with the experimental findings that these proteins could be potential targets for the compounds. The compound structures were drawn in Chem Draw Ultra 12. 0 (Milne, 2010), and minimized in Chem3D 12.0. Protein minimization was performed in UCSF Chimera 1.15 (Pettersen et al., 2004) through the steepest descent and conjugate gradient algorithm as per the procedure described by the manufacture. All the docking calculations were done using Auto Dock 4.2 (Morris et al., 2009) on a Linux workstation (Ubuntu 20.0) with Intel Core i7-10700 processor (10th generation) and 32 GB (3,200 MHz). The Graphical User Interface program Auto Dock Tools (ADT) (Huey et al., 2012) was considered to generate pdbqt files for both proteins and compounds as well as creating grid box. Assigning polar hydrogen atoms, solvation parameters, united atom Kollman charges and fragmental volumes to the proteins was carried out using ADT. The grid box was prepared for each protein using AutoGrid. The grid size allowed was to 25 × 25 × 25 along XYZ keeping the grid spacing of 0.375 Å. The grid center dimensions for each protein were as follows: COX-2 (X: −42.96 Å, Y: −48.29 Å, Z: −22.53 Å), TNF-α (X: 31.68 Å, Y: 56.29 Å, Z: 33.64 Å). The grid box parameters addressing information for docking the compounds to the proteins were written in a configuration file. In the docking procedure, the proteins were kept rigid whereas the compounds were treated as flexible. Compound poses were clustered together and the one with lowest energy value in kcal/mol was aligned with the protein(s) for visual examination. Complex visualization and chemical interaction analyses were done in UCSF Chimera 1.15 (Pettersen et al., 2004) and Discovery studio visualizer v.2021, respectively (Studio, 2008).

Statistical Analysis

The data of all behavioral and biochemical data are expressed as Mean ± SEM and are representative of three experiment repeats. The densitometric analysis of immunoblot bands, immunohistochemistry, and confocal images were analyzed by Image J software programs[2]. Differences between the WT vs. Tramadol and Sham vs. CCI groups were analyzed using student’s t-test and the difference between tramadol and sham vs. other treated groups of were analyzed using One-way analysis of variance (ANOVA) followed by Bonferroni post hoc test. For Paw and tail withdrawal latency, allodynia and hyperalgesia where repeated measurement over a period of time was involved, a two-way ANNOVA followed by Bonferroni post hoc test was used. All statistical analysis were carried out with Graph-Pad Prism Version-6 software (GraphPad Software Inc., San Diego, CA, United States). Significance: *p < 0.05, **p < 0.01, #p < 0.001, and ##p < 0.0001; ns, non-significant.

Results

Assessment of the Acute Toxicity and Tolerance of TDT1 and TDT2 Test Compounds

For the assessment of a safety profile for TDT derivatives, an acute toxicity test was performed initially monitoring animal behavior and well-being for 2, 4, and 6 h and then up to 24 h after intraperitoneal compound administration. No animals displayed any bizarre or atypical responses like spontaneous activity, ataxia, tail pinch response, catalepsy, abnormal weight loss, abdominal constrictions, convulsions or aggressiveness at doses up to 500 mg/kg. There was no mortality/death seen in any mice treated with both the test compounds below 500 mg/kg dose. The combined results indicated that TDT1 and TDT2 were both safe up to a dose of 500 mg/kg body weight which was considered as a maximum tolerated dose (MTD).

Analgesic Potential of TDT1 and TDT2 Test Compounds in Adult Mice

To evaluate the potential acute antinociceptive effect of the test compounds two way ANOVA test was performed (Bannon and Malmberg, 2007). The two way ANOVA revealed nociception varied significantly between treatment groups [F(Interaction) (10,90) = 1.319, p = ns; F (Group factor) (5,90) = 86.22, p < 0.0001; F(Time factor) (2,90) = 1.346. p = ns]. Both TDT1 (30 and 45 mg/kg) and TDT2 (45 mg/kg) were found to produce an statistically significant antinociceptive effect (p < 0.05) 30 min after administration as compared to WT. This effect was sustained after 60 min for both TDT1 and TDT2 (45 mg/kg) doses and after 90 min for TDT1 and TDT2 (45 mg/kg) (Figure 2A). The two way ANOVA revealed tail immersion withdrawal varied significantly between experiment groups [F(Interaction) (8,75) = 0.9790, p = ns; F(Group factor) (4,75) = 8.192, p < 0.0001; F(Time Factor) (2,75) = 1.166, p = ns]. In the tail immersion test when compared to WT, TDT2 (45 mg/kg), displayed an antinociceptive effect at 30 min while at 60 and 90 min TDT1 and TDT2 (45 mg/kg) showed antinociceptive effect (Figure 2B).
FIGURE 2

Analgesic effects of tramadol (30 mg/kg) and TDT1 and TDT2 test compounds (30 and 45 mg/kg) on nociception in adult mice. (A) Paw withdrawal latency (PWL) in the mouse hot plate test. (B) Tail withdrawal response latency of mice in the tail immersion test. (C,D) PWL of mice in different experimental groups after administration of pentylenetetrazol (15 mg/kg i.p) (PTZ) or Nalaxone (1 mg/kg s.c.) (NLX) respectively. (E) Incidence of abdominal constrictions after the administration of drugs to different animal groups. The data are presented as the mean ± SEM of 6–8 mice per group and representative of three repeats. Data analyses were performed using t-test between WT and Tramadol group, and two-way ANOVA followed by Bonferroni post hoc test for (A,B), and one-way ANOVA followed by Bonferroni post hoc test for (C–E) was used for comparative analysis between Tramadol and Tramadol+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001, ##p < 0.0001, and ns = non-significant. WT, wild-type vehicle administered group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

Analgesic effects of tramadol (30 mg/kg) and TDT1 and TDT2 test compounds (30 and 45 mg/kg) on nociception in adult mice. (A) Paw withdrawal latency (PWL) in the mouse hot plate test. (B) Tail withdrawal response latency of mice in the tail immersion test. (C,D) PWL of mice in different experimental groups after administration of pentylenetetrazol (15 mg/kg i.p) (PTZ) or Nalaxone (1 mg/kg s.c.) (NLX) respectively. (E) Incidence of abdominal constrictions after the administration of drugs to different animal groups. The data are presented as the mean ± SEM of 6–8 mice per group and representative of three repeats. Data analyses were performed using t-test between WT and Tramadol group, and two-way ANOVA followed by Bonferroni post hoc test for (A,B), and one-way ANOVA followed by Bonferroni post hoc test for (C–E) was used for comparative analysis between Tramadol and Tramadol+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001, ##p < 0.0001, and ns = non-significant. WT, wild-type vehicle administered group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid. To confirm any assumed mechanism of action of our test compounds, animals were co-administered either an opioid or GABA antagonist. The one way ANOVA of naloxone test revealed nociception varied significantly between treatment groups [F(2.346,11.73) = 25.88, p < 0.0001]. The antinociceptive activity of tramadol was significantly decreased (p < 0.05) by naloxone. Naloxone also reduced the antinociceptive activity of TDT1 and TDT2 significantly (p < 0.05) suggesting opioidergic signaling involvement. The one way ANOVA of PTZ test revealed nociception varied significantly between treatment groups [F(2.966,14.83) = 51.25, p < 0.0001]. PTZ also reduced the thermal antinociception effects of TDT derivatives suggesting the role of GABAergic signaling (Figures 2C,D). The one way ANOVA of abdominal constriction test revealed nociception varied significantly between treatment groups [F(1.768,8.841) = 1.431, p = ns]. In the abdominal constriction test, the incidence of constrictions to intraperitoneal 1% acetic acid, was markedly reduced (p < 0.0001) by both doses of TDT1 and TDT2 along with the aspirin (standard positive control – STD) (Figure 2E).

Activity of TDT1 and TDT2 on CCI-Induced Allodynia and Hyperalgesia in Adult Rats

Allodynia is potentially useful for rapidly illustrating the analgesic profile of compounds and conducting mechanistic studies. Drug treatment was instigated on protocol day 14 after the development of neuropathy in ligated rats. Two way ANOVA test was performed to analyze the significance of our test compound effect. The treatment had a significant main dose effect on CCI induced static allodynia (Figure 3A). The two way ANOVA revealed antiallodynic effect varied significantly between treatment groups [F(Interaction) (24,175) = 3.386, p < 0.0001; F(Group factor) (6,175) = 15.98, p < 0.0001; F(Time factor) (4,175) = 68.93, p < 0.0001]. Daily administration of gabapentin (75 mg/kg, i.p.) (standard positive control – STD) (p < 0.0001), and derivatives of TDT1 and TDT2 (30 and 45 mg/kg) (p < 0.001) started to reverse the decreased paw withdrawal threshold of CCI (PWT) indicating a decrease on the plantar surface of evoked nociception in the hind paw plantar surface. It was noted that no static mechanical allodynia was observed in the sham-operated control group. The two way ANOVA revealed that there was statistically significant decrease in nociception of treated group as compare to CCI group (p < 0.0001).
FIGURE 3

Effects of TDT1 and TDT2 test compounds (30 and 45 mg/kg) versus STD (75 mg/kg) on allodynia and hyperalgesia behavior in rats. (A,B) Representative histograms showing the effects of TDT1 and TDT2 on static and dynamic mechanical allodynia. (C) Effects of TDT1 and TDT2 on cold allodynia (acetone drop test) in adult rats. (D,E) Representative histograms showing the effects of TDT1 and TDT2 on heat-induced and pinprick-induced hyperalgesia behavioral tests. The data are presented as the mean ± SEM of 6–8 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and Two-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001, ##p < 0.0001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

Effects of TDT1 and TDT2 test compounds (30 and 45 mg/kg) versus STD (75 mg/kg) on allodynia and hyperalgesia behavior in rats. (A,B) Representative histograms showing the effects of TDT1 and TDT2 on static and dynamic mechanical allodynia. (C) Effects of TDT1 and TDT2 on cold allodynia (acetone drop test) in adult rats. (D,E) Representative histograms showing the effects of TDT1 and TDT2 on heat-induced and pinprick-induced hyperalgesia behavioral tests. The data are presented as the mean ± SEM of 6–8 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and Two-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001, ##p < 0.0001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid. To evaluate the effect of our test compound on CCI induced dynamic allodynia non-painful stimulus was applied to the mid plantar region of the ligated left hind paw. The two way ANOVA revealed antiallodynic effect varied significantly between treatment groups [F(Interaction) (24,120) = 7.513, p < 0.0001; F(Group factor) (6,30) = 35.86, p < 0.0001; F(Time factor) (4,20) = 32.83, p < 0.0001]. There was a noticeable reduction (p < 0.0001) in the PWT in the CCI-operated group as compared to the sham and pre-surgery operated group when a cotton swab was lightly stroked on the mid-plantar foot surface during the last 2 weeks of the study protocol (Figure 3B). After treatment with TDT1 and TDT2, there was a significant elevation in CCI-induced reduction at dose of 30 mg/kg (p < 0.001) and 45 mg/kg (p < 0.0001) in PWT on days 21 and 28. The two way ANOVA revealed PWD varied significantly between experiment groups [F(Interaction) F(24,175) = 17.77, p < 0.0001; F(Group factor) (6,175) = 133.0, p < 0.0001; F(Time factor) (4,175) = 299.9, p < 0.0001]. Moreover, in the cold allodynia test, the paw withdrawal duration (PWD) reflex was significantly prolonged upon acetone drop application to the mid-plantar foot surface of the operated hind paw in the CCI group (p < 0.0001) compared to the sham-operated group. This extended PWD was markedly reduced in the TDT1 (p < 0.0001), TDT2 (p < 0.0001), and standard gabapentin treated groups (Figure 3C). A heat hyperalgesia test was performed to assess the anti-nociceptive effect of test compounds against non-painful heat stimuli evoked nociception. The two way ANOVA revealed antiallodynic effect varied significantly between experiment groups [F(Interaction) (24,120) = 1.840, p = ns; F(Group factor) (6,30) = 10.80, p < 0.0001; F(Time factor) (4,20) = 29.96, p < 0.0001]. After the development of an elevated nociceptive response on day 14 post-surgery, animals were treated with gabapentin, TDT1 or TDT2, respectively. There was a marked elevation of response in the untreated CCI group (p < 0.001) compared to the sham-operated animals. The nociceptive thermal sensation in the mid-plantar area was significantly alleviated as indicated by an increased PWL in the gabapentin (p < 0.001), TDT1 (p < 0.05), and TDT2 (p < 0.05), treatment groups (Figure 3D). Subsequently, we evaluated the hyperalgesia induced by pinprick in the mid plantar surface of the operated paw. The two way ANOVA revealed that PWT varied statistically experiment groups [F(Interaction) (24,175) = 15.98, p < 0.0001; F(Group factor) (6,175) = 136.8, p < 0.0001; F(Time factor) (4,175) = 293.1, p < 0.0001]. In consequence, pinprick significantly raised the PWT on day 3 in the CCI-operated group as compared to the sham-operated animals. On the other hand, treatment with gabapentin, TDT1 orTDT2 manifested a significant reduction (p < 0.0001), in the PWT compared with CCI-operated rats and this response was evident from protocol day 21 to the final test day (day 28) (Figure 3E).

Activity of TDT1 and TDT2 on Carrageenan-Induced Acute Inflammation in Adult Rats

Carrageenan induces acute inflammation and gives rise to other signs related to inflammation such as hyperalgesia, edema, and erythema (Morris, 2003). Our results demonstrated that carrageenan induced an acute inflammatory response characterized by an increase in paw size, edema, and erythema. In contrast, TDT1 and TDT2 significantly (p < 0.001), decreased carrageenan-induced inflammation compared with standard aspirin (50 mg/kg), reflecting a strong anti-inflammatory effect of the test compounds (Table 2).
TABLE 2

TDT1 and TDT2 activity on carrageenan-Induced inflammatory edema and erythema in rat paw.

Time (hrs)ControlCarrCarr+ Asp% InhibitionCarr+ TDT1-30% InhibitionCarr+ TDT1-45% InhibitionCarr+ TDT2-30% InhibitionCarr+ TDT2-45% Inhibition
10.01240.068#0.032***41.80.032***41.60.030***45.30.028***45.60.024***52.8
20.01260.068#0.032***41.80.03***45.50.026***50.40.024***52.10.020***57.0
30.01340.068#0.032***41.80.025***49.70.026***52.10.023***49.60.020***56.2
40.01040.068#0.032***41.80.024***52.50.025***50.450.026***49.70.025***54.1
50.01000.070#0.032***44.30.03***45.450.028***48.20.030***45.40.028***48.2

Results are presented as mean ± SEM of 6–8 mice per group, one-way ANOVA followed by Bonferroni’s post hoc analysis was performed.

TDT1 and TDT2 activity on carrageenan-Induced inflammatory edema and erythema in rat paw. Results are presented as mean ± SEM of 6–8 mice per group, one-way ANOVA followed by Bonferroni’s post hoc analysis was performed.

Thiadiazine-Thione Derivatives Mitigate the Elevated Expression of Chronic Constriction Injury-Induced Microgliosis

Mounting literature suggests that microglia is an important source of various cytokines that contribute toward neuroinflammation, pain, and neuronal apoptosis (Suter et al., 2007; Muhammad et al., 2019). To evaluate the expression of ionized calcium-binding adaptor molecule 1 (Iba1)as a marker of activated microglia (microgliosis), rat spinal cord tissue from different experimental groups was prepared for RT-qPCR. The one way ANOVA revealed the expression of Iba1 varied significantly between experimental groups [F(6,35) = 14.54, p < 0.0001]. The mRNA expression level of Iba1 was significantly higher in the CCI group (p < 0.001) while TDT1 (p < 0.05), and TDT2 (p < 0.05) at 45 mg/kg dose, both reduced its expression (Figure 4A). Similarly, we confirmed this outcome by western blot analysis and found that the Iba1 protein level was substantially elevated in the CCI group (p < 0.05) and that it was markedly reduced by TDT1 (p < 0.001) and TDT2 (p < 0.001) at 45 mg/kg treatment (Figures 4B,C). Furthermore, immunohistochemistry also supported the above results, i.e., the expression of Iba1 was significantly elevated by CCI (p < 0.05) while TDT derivative administration reduced (p < 0.05) its expression at 45 mg/kg dose (Figures 4D,E). These results demonstrate that our TDT1 and TDT2 compounds exerted their neuroprotective activity by lowering the expression of Iba1 in a dose-dependent manner.
FIGURE 4

TDT1 and TDT2 (30 and 45 mg/kg) and STD (75 mg/kg) ameliorates the expression of CCI-induced astrogliosis. (A) mRNA level of Iba1 gene analyzed via RT-qPCR in rat spinal cord tissue of different experimental groups. (B,C) Western blot analysis of Iba1 in the spinal cord tissue lysate of adult rats and representative histograms. (D,E) Immunohistochemistry images of Iba1 in the rat spinal cord sections. Scale bar 20 μm, magnification 40×. The data are presented as the mean ± SEM of 3–4 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and One-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

TDT1 and TDT2 (30 and 45 mg/kg) and STD (75 mg/kg) ameliorates the expression of CCI-induced astrogliosis. (A) mRNA level of Iba1 gene analyzed via RT-qPCR in rat spinal cord tissue of different experimental groups. (B,C) Western blot analysis of Iba1 in the spinal cord tissue lysate of adult rats and representative histograms. (D,E) Immunohistochemistry images of Iba1 in the rat spinal cord sections. Scale bar 20 μm, magnification 40×. The data are presented as the mean ± SEM of 3–4 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and One-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

Thiadiazine-Thione Derivatives Mitigate Chronic Constriction Injury -Induced Activated Microglia and p-NF-κB Expression

Nuclear factor-kappa B (NF-κB), a key transcription factor, is known to play a critical role in neuropathic pain by regulating several inflammatory genes (Fu et al., 2018). Therefore, we assessed NF-κB mRNA levels in rat spinal cord tissue. The one way ANOVA revealed NF-κB mRNA levels varied significantly between experiment groups [F(6,35) = 19.32, p < 0.0001]. The RT-qPCR results disclosed that the CCI (p < 0.05) procedure resulted in a higher NF-κB level while both TDT1 (p < 0.05) and TDT2 (p < 0.05) reduced its expression (Figure 5A). Moreover, we further validated the effects of TDT derivatives on phosphorylated-NF-κB (p-NF-κB) expression using western blot and immunohistochemistry (Figures 5B–E). These results revealed that TDT1 (p < 0.05) and TDT2 (p < 0.05) significantly reduced the level of the active NF-κB transcription factor that is involved in the regulation of several other neuro-inflammatory cytokines.
FIGURE 5

Effects of TDT1 and TDT2 test compounds (30 and 45 mg/kg) and STD (75 mg/kg) on the expression of NF-κB. (A) Representative histogram showing the mRNA level of NF-κB gene analyzed via RT-qPCR in the experimental groups. (B,C) Western blot analysis of p-NF-κB in the rat spinal cord tissue and its representative histograms. (D,E) Immunohistochemistry results of p-NF-κB in spinal cord sections. Scale bar 20 μm, magnification 40×. The data are presented as the mean ± SEM of 3–4 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and One-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

Effects of TDT1 and TDT2 test compounds (30 and 45 mg/kg) and STD (75 mg/kg) on the expression of NF-κB. (A) Representative histogram showing the mRNA level of NF-κB gene analyzed via RT-qPCR in the experimental groups. (B,C) Western blot analysis of p-NF-κB in the rat spinal cord tissue and its representative histograms. (D,E) Immunohistochemistry results of p-NF-κB in spinal cord sections. Scale bar 20 μm, magnification 40×. The data are presented as the mean ± SEM of 3–4 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and One-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

Protective Effects of Thiadiazine-Thione Derivatives Against Chronic Constriction Injury-Induced Neuroinflammation

TNF-α is a critical cytokine released by glia and several immune cells which is intrinsic to the pathogenesis of both central and peripheral neuropathic pain (Leung and Cahill, 2010). To evaluate the anti-inflammatory effects of TDT derivatives, we examined the expression of TNF-α protein through Elisa in rat spinal cord tissue. The one way ANOVA revealed TNF-α protein expression varied significantly between experiment groups [F(6,35) = 19.90, p < 0.0001]. Our findings divulged that CCI significantly enhanced the expression level of TNF-α in CCI group (p < 0.001) but in contrast; TDT1 (p < 0.05) and TDT2 (p < 0.05) reversed this elevated expression of TNF-α (Figure 6A). Similarly, we followed this up with RT-qPCR to assess the mRNA level of TNF-α and found that both of our TDT test compounds markedly reduced (p < 0.05) TNF-α mRNA expression (Figure 6B). Moreover, we performed western blot analysis to examine the protein level of TNF-α in the spinal cord tissue lysates. The protein level of TNF-α was significantly elevated in the CCI group (p < 0.001) while it was substantially diminished in the TDT1 (p < 0.05) and TDT2 (p < 0.05) treated groups (Figures 6C,D). To further support these findings, we performed immunofluorescence confocal microscopy and immunohistochemistry. The results further confirmed that our test compounds significantly reduced (p < 0.05) the immunoreactivity of TNF-α antibodies in spinal cord sections in comparison with the CCI group (Figures 6E–H).
FIGURE 6

Protective effects of TDT1 and TDT2 (30 and 45 mg/kg) and STD (75 mg/kg) against CCI-induced inflammation. (A) TNF-α protein levels measured via Elisa. (B) mRNA expression level of the TNF-α gene evaluated by RT-qPCR in rat spinal cord tissue. (C,D) Western blot analysis of TNF-α and its representative histograms in spinal cord lysates. (E,F) Representative images of anti-TNF-α antibody immunoreactivity in rat spinal cord sections and respective histograms. Scale bar 40 μm, magnification 40×. (G,H) Immunohistochemistry results of anti-TNF-α immunoreactivity. Scale bar 20 μm, magnification 40×. The data are presented as the mean ± SEM of 3–4 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and One-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

Protective effects of TDT1 and TDT2 (30 and 45 mg/kg) and STD (75 mg/kg) against CCI-induced inflammation. (A) TNF-α protein levels measured via Elisa. (B) mRNA expression level of the TNF-α gene evaluated by RT-qPCR in rat spinal cord tissue. (C,D) Western blot analysis of TNF-α and its representative histograms in spinal cord lysates. (E,F) Representative images of anti-TNF-α antibody immunoreactivity in rat spinal cord sections and respective histograms. Scale bar 40 μm, magnification 40×. (G,H) Immunohistochemistry results of anti-TNF-α immunoreactivity. Scale bar 20 μm, magnification 40×. The data are presented as the mean ± SEM of 3–4 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and One-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, #p < 0.001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

Activity of Thiadiazine-Thione Derivatives on Cox-2 Expression and Histopathological Changes in the Chronic Constriction Injury-Induced Neuropathic Pain Rat Model

Previous studies have reported that cyclooxygenase-2 (Cox-2) is elevated in invading macrophages in the nervous system of rats and humans. It has also been reported that Cox-2 results in the maintenance of neutral endopeptidase (NeP) in aged rats (Ma et al., 2010). To determine any possible protective effect of our TDT compounds against Cox-2, we evaluated the mRNA expression and protein level of the enzyme in different experimental groups. The one way ANOVA revealed Cox-2 mRNA expression varied significantly between experiment groups [F(6,35) = 17.95, p < 0.0001]. We found that both Cox-2 mRNA expression and the protein level were higher in CCI-induced neuropathic pain. Conversely, TDT1 (p < 0.05) and TDT2 (p < 0.05) reduced their levels in a dose-dependent manner (Figures 7A–C). In addition, our immunohistochemistry (p < 0.05) and western blot (p < 0.05) results also supported the notion that TDT1 and TDT2 exerted significant anti-inflammatory effects by reducing the immunoreactivity of the Cox-2 antibody in spinal cord sections of adult rats (Figures 7D,E).
FIGURE 7

Effects of TDT1 and TDT2 (30 and 45 mg/kg) and STD (75 mg/kg) on CCI-induced COX-2. (A) COX-2 mRNA expression level in rat spinal cord tissue examined using RT-qPCR. (B,C) COX-2 protein level was assessed by immunoblotting with representative histograms in rat spinal cord tissue lysates of different experimental groups. (D,E) Immunohistochemistry images of anti-TNF-α immunoreactivity in spinal cord sections. Scale bar 20 μm, magnification 40×. (F,G) Hematoxylin and eosin (H and E) staining showing the neuronal morphology and extent of survival in spinal cord sections of different experimental groups, and representative histograms. Scale bar 20 μm, magnification 40×. The data are presented as the mean ± SEM of 3–4 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and One-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, and #p < 0.001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid.

Effects of TDT1 and TDT2 (30 and 45 mg/kg) and STD (75 mg/kg) on CCI-induced COX-2. (A) COX-2 mRNA expression level in rat spinal cord tissue examined using RT-qPCR. (B,C) COX-2 protein level was assessed by immunoblotting with representative histograms in rat spinal cord tissue lysates of different experimental groups. (D,E) Immunohistochemistry images of anti-TNF-α immunoreactivity in spinal cord sections. Scale bar 20 μm, magnification 40×. (F,G) Hematoxylin and eosin (H and E) staining showing the neuronal morphology and extent of survival in spinal cord sections of different experimental groups, and representative histograms. Scale bar 20 μm, magnification 40×. The data are presented as the mean ± SEM of 3–4 rats per group and representative of three repeats. Data analyses were performed using t-test between Sham and CCI group, and One-way ANOVA followed by Bonferroni post hoc test was used for comparative analysis between CCI and CCI+ treated groups. Significance: *p < 0.05, **p < 0.01, and #p < 0.001; ns, non-significant. Sham, CCI-operated vehicle administered group; STD, standard (gabapentin) group; TDT1, 2-(5-propyl-6-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid; TDT2, 2-(5-propyl-2-thioxo-1, 3, 5-thiadiazinan-3-yl) acetic acid. To understand the consequences of CCI-induced morphological changes in the neuron in the context of apoptotic necrotic neuronal death, we performed Hematoxylin and Eosin (H and E) staining. The results revealed that CCI induced significant apoptosis and morphological changes characterized by cytoplasmic and nuclear condensation, nuclear budding and fragmentation compared to the sham-operated group. However, histopathologically, the number of dead neuronal cells was significantly reduced in the TDT1 (p < 0.05) and TDT2 (p < 0.05) treated groups compared to the CCI untreated group (Figures 7F,G). Overall, these findings suggest that our TDT derivatives significantly downregulated the expression of apoptosis and other pathophysiological processes and mitigated CCI-induced neuronal degeneration and neuropathic pain.

Molecular Docking Studies Predicting the Binding Modes of TDT1 and TDT2 With Cox-2 and TNF-α

In silico molecular docking studies on both compounds were carried out with two receptors: COX-2 and TNF-α, not only to elucidate their binding affinity and molecular interactions but also to perform a comparative analysis with experimental findings. In comparison, a control (naproxen in case of COX-2 and etanercept in case of TNF- α) was also run in the docking studies. The binding energy score of the compounds is tabulated in Table 3. Both compounds displayed good binding energy for the receptors, however, their affinities were predicted as less than the controls used. Moreover, the compounds exhibited similar binding energies suggesting that they had comparable binding strength with the receptors. The compounds were observed to show deep binding with both receptors and established a strong network of hydrophilic and hydrophobic interactions. In the case of COX-2, TDT1 possessed the ability to form hydrogen bonds with Tyr115, Arg120, and Glu524. On the other hand, TDT2 interacted with Arg120, and Glu524 hydrophilically and produced several hydrophobic contacts. The binding mode and interactions of compounds at the docked pocket of COX-2 are presented in Figure 8.
TABLE 3

Molecular docking score of compounds and controls with COX-2 and TNF-α.

Target proteinTDT1TDT2Control
COX-2−5.3−5.3Naproxen (−8.1)
TNF-α−4.3−4.4Etanercept (−7.1)
FIGURE 8

Binding conformation of TDT1 (tan stick) and TDT2 (sky blue stick) in complex with COX-2 receptor (sandy brown cartoon). Different chemical interactions produced by the compounds with the residues of the active pocket.

Molecular docking score of compounds and controls with COX-2 and TNF-α. Binding conformation of TDT1 (tan stick) and TDT2 (sky blue stick) in complex with COX-2 receptor (sandy brown cartoon). Different chemical interactions produced by the compounds with the residues of the active pocket. In the case of TNF-α, TDT2 appeared to be a more efficient binder than TDT1 mainly because of the prospective formation of short distance hydrogen bonds with residues such as Asn92, Ser95, Ser147, and Gln149. TDT1 in contrast was notable in this regard with only two hydrogen bonds: Thr77 and Thr79 (Figure 9).
FIGURE 9

Binding conformation of TDT1 (tan stick) and TDT2 (sky blue stick) in complex with TNF-α (tan cartoon). Different chemical interactions produced by the compounds with the residues of the active side.

Binding conformation of TDT1 (tan stick) and TDT2 (sky blue stick) in complex with TNF-α (tan cartoon). Different chemical interactions produced by the compounds with the residues of the active side.

Discussion

Neuropathic pain is highly variable and it develops when neuronal fibers are either damaged or dysfunctional invariably leading to further complications (St John Smith, 2018). Despite the availability of several approved drugs for the management of neuropathic pain, there is a lack of wholly efficacious therapeutic agents with relatively low side effects for chronic neuropathic pain treatment. Thus, we explored a conceivable therapeutic prospect for our test compounds, TDT1 and TDT2, for antiallodynic, anti-inflammatory, neuro-protective, and analgesic potentials against CCI-induced neuropathic pain. However, chronic constriction injury is a broadly used nerve injury model of chronic neuropathic pain. It evokes chronic neuropathic pain in the rat model resulting from damage to both the peripheral and central nervous systems (Austin et al., 2012). CCI-induced neuropathic pain involves pathological changes observed in both myelinated and non-myelinated neuronal axons. It has also been reported that inflammatory cytokines secreted by glial cells and injured neurons activate spontaneous activity in non-injured neurons resulting in neuropathic pain behavior (Gabay and Tal, 2004). Additionally, spontaneous mechanical and/or thermal hyperalgesia are frequently associated with neuropathic pain (Huang et al., 2019). In our study, the safety profile of selected TDT derivatives was evaluated in an acute toxicity test by giving the number of doses from minimum to a maximum of 650 mg/kg. It was found that animals did not show any adverse or bizarre responses such as spontaneous activity, ataxia, tail pinch response, catalepsy, abdominal constrictions, convulsions or aggressiveness upto the dose of 500 mg/kg. After confirming the safety profile of our test compounds, we evaluated the antinociceptive potential of our test compounds of derivative TDT1 and TDT2. In the preliminary hot plate and tail immersion tests, it was found that TDT1 and TDT2 significantly increased the PWL and tail withdrawal latency (Figures 2A,B). To determine the possible role of opioidergic and/or GABAergic signaling in the antinociceptive effects of TDT1 and TDT2 derivatives, we co-administered NLX or PTZ as opioid and GABA antagonists respectively. Both NLX and PTZ significantly blocked TDT1 and TDT2 antinociception suggesting the involvement of opioid and GABA signaling (Figures 2C,D). Furthermore, we also evaluated the antinociceptive activity of TDT derivatives against the acetic acid-induced peripheral algesia by reducing the number of abdominal constrictions (Figure 2E). Hence, taken together, these outcomes suggest that the two TDT derivatives exhibit significant analgesic potentials. Nerve injury instigates resident immune cells such as macrophages and microglia, which release other nociceptive mediators recruiting additional immune cells and mediators that further exacerbate neuropathic pain (Wen et al., 2018). Previously, it has been reported that inhibiting glial cells ameliorates allodynia and hyperalgesia in CCI-induced neuropathic pain (Hassel et al., 1992; Tikka and Koistinaho, 2001), in light of this fact we performed a static mechanical allodynia behavioral analysis which disclosed that there was a substantial reduction in nociceptive threshold produced by mechanical Von Frey filament pressure in sciatic nerve ligated left hind paw. Subsequently, a dynamic mechanical allodynia test divulged a notable reduction in the PWL as compared to sham-operated animals when a light stroke of a cotton swab was applied on the mid-plantar foot surface (Figures 3A,B). A reduction in PWT was noticeable for succeeding weeks after surgery. However, TDT1 or TDT2 treatment significantly reduced the prolonged PWT in the third and last week of the test protocol as compared to the CCI group. Similarly, an elevated PWD reflex was also observed in the cold allodynia test after CCI sciatic nerve ligation and the administration of TDT1 or TDT2 reduced this prolonged cold allodynia response (Figure 3C). In the heat hyperalgesia test, there was a diminished latency to paw withdrawal in the untreated CCI group compared to the sham-operated controls. Consequently, the nociceptive thermal sensation in the mid-plantar area expressed as the PWL was reduced significantly in the CCI group as compared to the sham group. Hyperalgesia was induced by pinprick in the CCI group versus the sham group while treatment with TDT1or TDT2 reduced this hyperalgesic response to noxious pinprick (Figures 3D,E). Subcutaneous injection of carrageenan induces acute inflammation characterized by hyperalgesia, edema plus erythema and the overall response is usually quantified by an increase in the paw size (Morris, 2003; Islam et al., 2017). Both TDT1 and TDT2 reduced carrageenan-induced inflammation as indicated by a reduction in paw volume in the CCI group and this reflected an inherent anti-inflammatory property of these TDT derivatives (Table 2). Microglia, the most common glial cell type in the CNS, play a key role in providing structural and nutrient support and they are also involved in many neural processes. Nerve injury and any noxious stimuli can alter the function and gene expression of reactive gliosis which undergoes morphological, molecular, and functional changes to become reactive microglia in a process termed astrogliosis (Hu et al., 2019; Ji et al., 2019; Li et al., 2019). Mounting evidence proposes that glial cells are vital regulators of CNS diseases including neuro-inflammatory, neurodevelopmental, neuropsychiatric, and neurodegenerative conditions (Wen et al., 2018; Li et al., 2019). In this context, we examined the expression of activated microglia and found that their mRNA expression and the protein level of Iba1 were significantly elevated in CCI animals. Conversely, treatment with TDT1 or TDT2 substantially reversed CCI-induced astrogliosis, activated microglia mRNA expression and the protein level of Iba1 (Figure 4). NF-κB, a ubiquitously expressed protein complex, is a key transcription factor that regulates the transcription of several other genes associated with neuroinflammation and chronic pain conditions (Hartung et al., 2015). The mRNA expression level of NF-κB in our study was increased by CCI although at a higher treatment dose, TDT1 or TDT2 both reduced this level of mRNA expression. Phosphorylated-NF-κB (p-NF-κB) using western blot and immunohistochemical analysis suggested that the p-NF-κB protein level was substantially elevated by CCI while TDT1 or TDT2 markedly decreased it (Figure 5). TNF-α is certainly a crucial participant in neuropathic pain as part of the cytokine mediator system which contributes to the pathogenesis of pain either at the peripheral or central level (Leung and Cahill, 2010; Wen et al., 2018). Several lines of study have reported that expressing TNF-α in animal model exacerbates allodynia and hyperalgesia. In addition, intrathecal injection of TNF-α treated astrocytes induces intense allodynia suggesting that the adoptive transfer to reactive astrocytes is sufficient to evoke neuropathic pain (Ji et al., 2019; Li et al., 2019). In our study, evaluation of TNF-α mRNA expression using RT-qPCR revealed an increased expression in the CCI animals while TDT1 and TDT2 both reduced this expression. Elisa assay and western blot analysis also accorded with the above result where by an augmented TNF-α protein level in the CCI group was disclosed, which was then attenuated by TDT1 and TDT2. Likewise, the confocal immunofluorescence and immunohistochemistry experiments confirmed the ameliorative effects of the TDT derivatives against TNF-α (Figure 6). Hence, TNF-α immunoreactivity was high after CCI and both TDT1 and TDT2 markedly reduced anti-TNF-α antibody reactivity. Furthermore, the level of the COX-2 protein has been reported to be elevated after nerve injury, which indicates a contributing role in neuroinflammation and pain. In light of this, inhibition of COX-2 rather than COX-1 using specific enzyme inhibitors has previously been shown to mitigate hyperalgesia in the CCI neuropathic pain model (Jean et al., 2009; Wang and Wang, 2017). Similarly, the protein level and immunoreactivity were also higher after CCI. Furthermore, we performed H and E staining to evaluate the effects of TDT1 and TDT2 on neuronal morphology. It was evident that CCI brought about distinctive morphological changes such as cytoplasmic and nuclear condensation, nuclear budding, and fragmentation in spinal cord tissue (Figure 7) which were noticeably slowed down by TDT1 and TDT2. These findings suggest that TDT derivatives exerted substantial anti-inflammatory effects by downregulating Iba1 p-NF-κB, TNF-α, and COX-2 inflammatory markers. Lastly, molecular docking studies were performed to demonstrate the effective binding of TDT1 and TDT2 to COX-2 and TNF-α receptors. The effectual binding of the compounds to the targeted proteins was the outcome of a balanced network of hydrogen bonds and various van der Waals interactions. Overall, our findings have marked the prospective analgesic activity of the TDT1 and TDT2 test compounds. These compounds exerted protective effects against CCI-induced static and dynamic allodynia as well as hyperalgesia. TDT1 and TDT2 both reduced the expression and protein level of activated microglia (Iba1), p-NF-κB, TNF-α, and COX-2 that were elevated by CCI suggesting a significant anti-inflammatory effect. Furthermore, the TDT test compounds attenuated the histopathological changes associated with nerve injury (Figure 10). Additionally, molecular coupling studies were performed that concluded that there was an effective binding of the compounds to COX-2 and TNF-α and that this binding was dominated by strong hydrogen bonds supported by van der Waals interactions.
FIGURE 10

Graphical representation of the study showing the protective effects of TDT1 and TDT2 on CCI-induced allodynia, hyperalgesia and neuroinflammation.

Graphical representation of the study showing the protective effects of TDT1 and TDT2 on CCI-induced allodynia, hyperalgesia and neuroinflammation.

Conclusion

Our findings imply that there may be a potential application of these compounds against inflammation and pain associated with nerve injuries. We aim to conduct further studies in the future to investigate the mechanism of action and any related side effects of these TDT derivatives.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics Statement

The animal study was reviewed and approved by Ethical Committee of the Department of Pharmacy, University of Peshawar (registration number: 19/EC/F.LIFE-2020).

Author Contributions

SQ designed and conducted experiments, analyzed the results, and wrote the preliminary manuscript. MI helped in conducting experiments and reviewed and edited the manuscript. TM helped with the study design, experimental analysis, and final manuscript drafting. MS synthesized the test compounds (TDT1 and TDT2), their characterization and analysis. GA, MA, and I-KK helped with study design, supervised and organized, reviewed, and edited the final draft of manuscript. SA performed molecular docking of test compounds. RS and SU had an intellectual input throughout and reviewing and editing the final manuscript draft. All authors reviewed and approved the manuscript.

Conflict of Interest

I-KK was employed by The Kingkong Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
  62 in total

1.  Indomethacin based new triazolothiadiazine derivatives: Synthesis, evaluation of their anticancer effects on T98 human glioma cell line related to COX-2 inhibition and docking studies.

Authors:  Belgin Sever; Mehlika Dilek Altıntop; Gökhan Kuş; Mete Özkurt; Ahmet Özdemir; Zafer Asım Kaplancıklı
Journal:  Eur J Med Chem       Date:  2016-02-16       Impact factor: 6.514

Review 2.  Astrocytes in chronic pain and itch.

Authors:  Ru-Rong Ji; Christopher R Donnelly; Maiken Nedergaard
Journal:  Nat Rev Neurosci       Date:  2019-09-19       Impact factor: 34.870

3.  Acute toxicity of berberine and its correlation with the blood concentration in mice.

Authors:  Michael M Kheir; Yugang Wang; Lei Hua; Jun Hu; Lele Li; Fan Lei; Lijun Du
Journal:  Food Chem Toxicol       Date:  2010-02-04       Impact factor: 6.023

4.  Synthetic β-hydroxy ketone derivative inhibits cholinesterases, rescues oxidative stress and ameliorates cognitive deficits in 5XFAD mice model of AD.

Authors:  Syed Ilyas Ahmad; Gowhar Ali; Tahir Muhammad; Rahim Ullah; Muhammad Naveed Umar; Aisha Nasir Hashmi
Journal:  Mol Biol Rep       Date:  2020-11-19       Impact factor: 2.316

5.  AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility.

Authors:  Garrett M Morris; Ruth Huey; William Lindstrom; Michel F Sanner; Richard K Belew; David S Goodsell; Arthur J Olson
Journal:  J Comput Chem       Date:  2009-12       Impact factor: 3.376

6.  Effect of mexiletine on dynamic allodynia induced by chronic constriction injury of the sciatic nerve in rats.

Authors:  Etsuko Nakazato-Imasato; Sachi Tanimoto-Mori; Yoichi Kurebayashi
Journal:  J Vet Med Sci       Date:  2009-07       Impact factor: 1.267

Review 7.  Translational investigation and treatment of neuropathic pain.

Authors:  Bo Xu; Giannina Descalzi; Hai-Rong Ye; Min Zhuo; Ying-Wei Wang
Journal:  Mol Pain       Date:  2012-03-09       Impact factor: 3.395

8.  Electroacupuncture Relieves CCI-Induced Neuropathic Pain Involving Excitatory and Inhibitory Neurotransmitters.

Authors:  Chun-Ping Huang; Yi-Wen Lin; Der-Yen Lee; Ching-Liang Hsieh
Journal:  Evid Based Complement Alternat Med       Date:  2019-10-20       Impact factor: 2.629

9.  Toxicological Evaluation of Novel Cyclohexenone Derivative in an Animal Model through Histopathological and Biochemical Techniques.

Authors:  Muhammad Kamil; Arifa Fatima; Sami Ullah; Gowhar Ali; Rasool Khan; Naila Ismail; Mughal Qayum; Marius Irimie; Catalina Georgeta Dinu; Hanadi Talal Ahmedah; Maria Elena Cocuz
Journal:  Toxics       Date:  2021-05-25

Review 10.  Peripheral afferents and spinal inhibitory system in dynamic and static mechanical allodynia.

Authors:  Jun-Ho La; Jin Mo Chung
Journal:  Pain       Date:  2017-12       Impact factor: 7.926

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.