Mey-Fann Lee1, Chu-Hui Chiang2, Shyh-Jye Lin3, Chi-Sheng Wu4, Yi-Hsing Chen4,5. 1. Department of Medical Research, Taichung Veterans General Hospital, Taichung, Taiwan. 2. Department of Plant Medicine, National Pingtung University of Science and Technology, Pingtung, Taiwan. 3. School of Medical Laboratory and Biotechnology, Chung Shan Medical University, Taichung, Taiwan. 4. Division of Allergy, Immunology and Rheumatology, Taichung Veterans General Hospital, Taichung, Taiwan. 5. School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan.
Abstract
Allergic airway disease is the most common chronic airway inflammatory disorder in developed countries. House dust mite, cockroach, and mold are the leading allergens in most tropical and subtropical countries, including Taiwan. As allergen avoidance is difficult for patients allergic to these perennial indoor allergens, allergen-specific immunotherapy (ASIT) is the only available allergen-specific and disease-modifying treatment. However, for patients sensitized to multiple allergens, ASIT using each corresponding allergen is cumbersome. In the present study, we developed a recombinant L. lactis vaccine against the three most common indoor aeroallergens and investigated its effectiveness for preventing respiratory allergy and safety in mice. Three recombinant clones of Der p 2 (mite), Per a 2 (roach), and Cla c 14 (mold) were constructed individually in pNZ8149 vector and then electroporated into host strain L.lactis NZ3900. BALB/c mice were fed with the triple vaccine 5 times per week for 4 weeks prior to sensitization. The effectiveness and safety profile were then determined. Oral administration of the triple vaccine significantly alleviated allergen-induced airway hyper-responsiveness in the vaccinated mice. The allergen-specific IgG2a was upregulated. IL-4 and IL-13 mRNA expressions as well as inflammatory cell infiltration in the lungs decreased significantly in the vaccinated groups. No body weight loss or abnormal findings in the liver and kidneys were found in any of the groups of mice. This is the first report to describe a triple-aeroallergen vaccine using a food-grade lactococcal expression system. We developed a convenient oral delivery system and intend to extend this research to develop a vaccination that can be self-administered at home by patients.
Allergic airway disease is the most common chronic airway inflammatory disorder in developed countries. House dust mite, cockroach, and mold are the leading allergens in most tropical and subtropical countries, including Taiwan. As allergen avoidance is difficult for patients allergic to these perennial indoor allergens, allergen-specific immunotherapy (ASIT) is the only available allergen-specific and disease-modifying treatment. However, for patients sensitized to multiple allergens, ASIT using each corresponding allergen is cumbersome. In the present study, we developed a recombinant L. lactis vaccine against the three most common indoor aeroallergens and investigated its effectiveness for preventing respiratory allergy and safety in mice. Three recombinant clones of Der p 2 (mite), Per a 2 (roach), and Cla c 14 (mold) were constructed individually in pNZ8149 vector and then electroporated into host strain L.lactis NZ3900. BALB/c mice were fed with the triple vaccine 5 times per week for 4 weeks prior to sensitization. The effectiveness and safety profile were then determined. Oral administration of the triple vaccine significantly alleviated allergen-induced airway hyper-responsiveness in the vaccinated mice. The allergen-specific IgG2a was upregulated. IL-4 and IL-13 mRNA expressions as well as inflammatory cell infiltration in the lungs decreased significantly in the vaccinated groups. No body weight loss or abnormal findings in the liver and kidneys were found in any of the groups of mice. This is the first report to describe a triple-aeroallergen vaccine using a food-grade lactococcal expression system. We developed a convenient oral delivery system and intend to extend this research to develop a vaccination that can be self-administered at home by patients.
Allergic airway disease is the most common chronic IgE-mediated hypersensitivity in developed countries and global rates continue to rise [1-3]. In addition to outdoor air pollution and allergens, it has been reported that eight indoor agents are highly involved in the development and exacerbation of asthma: cockroaches, dust mites, cat dander, dog dander, respiratory viruses, fungi, nitrogen dioxide, and environmental tobacco smoke [4]. Among them, aeroallergens derived from dust mite, cockroaches, and molds are the most common sensitizers and elicitors of respiratory allergy in tropical and subtropical regions in the world, including Taiwan [5-9].Although allergen avoidance is theoretically the best way of preventing clinical manifestation of allergy, the pervasive contamination by some aeroallergens, such as dust mites, cockroaches and molds in the household environment, means that in practical terms exposure is inevitable. Allergen-specific immunotherapy (AIT) is the only disease-modifying approach with long-lasting effects through induction of allergen-specific blocking antibodies and regulatory T cells to achieve tolerance to the corresponding allergens [10, 11]. Conventional subcutaneous immunotherapy, though effective, requires frequently repeated injection of natural allergen extracts containing a wide variety of undesirable proteins, which has thus limited its applicability [12, 13].It has been shown in animal models that oral feeding of protein antigens can downregulate systemic immune responses, known as oral tolerance [14, 15]. Oral administration of therapeutic molecules theoretically offers advantages such as ease of administration and reduction in adverse effects. However, aside from the recent approval of an oral peanut immunotherapy agent [16, 17], many of the oral immunotherapeutic agents for aeroallergens failed to demonstrate clinical effectiveness [18-20]. To date, a limited number of sublingual-pastille-like immunotherapeutic vaccines for aeroallergens have demonstrated clinical efficacy and safety and have been approved for clinical use [21-26].In the past few decades, the DNA sequences of the most common allergens have been identified and the corresponding allergens can been produced as recombinant allergens [27, 28]. As a result of these advances, genetically recombinant allergen proteins may be used as source of allergen-specific immunotherapy to improve the quality and safety of allergy vaccines.Gram-positive non-pathogenic lactic acid bacteria have long been widely used in the food industry. The protective or modulatory effects of recombinant L.lactis strains for several diseases have been verified in animal models and clinical trials [29-35]. In this study, we developed a recombinant L. lactis vaccine containing three of the most common indoor aeroallergens and investigated its effectiveness and safety for preventing respiratory allergy in mice.
Materials and methods
Bacterial strain and vector
The L. lactis NZ3900 strain and plasmid pNZ8149 used in this work were purchased from MoBiTec (Goettingen, Germany). NZ3900 was used for food-grade expression based on its ability to grow on lactose. Deletion of the lacF gene renders this strain unable to grow on lactose unless LacF is provided in a plasmid. pNZ8149 contains the LacF gene for food-grade selection for growth on lactose and a nisA promoter for gene expression by nisin induction. Nisin is a 34-amino acid anti-microbial peptide and is now widely permitted as a food-safe preservative.
Construction of pNZ8149-Per a 2/Der p 2/Cla c 14 and transformation by electroporation
To construct the recombinant plasmid expressing the fusion genes under the control of the regulative promoter nisA, three primer pairs for each of the allergen genes were used for the polymerase chain reaction, as listed in Table 1. The amplified sizes of cDNA and the molecular weights of the derived proteins are shown in Table 1. The amplified PCR products were cloned into the pCR2.1 vector and confirmed by DNA sequencing with an automated DNA analyzer (ABI Prism 3700). Then, the three fragments of Per a 2, Der p 2, and Cla c 14 were subcloned into the NcoI/XbaI or PstI/XbaI sites of the pNZ8149 vector in-frame. The constructed plasmids were extracted, purified, and transformed into L.lactis. Briefly, NZ3900 cells were cultured in an M17 broth (OXOID, UK) with 0.5 M sucrose, 2.5% glycine, and 0.5% glucose (M17B-S/G/Glucose) at 30°C until the OD600 of 0.2~0.3 was reached; it was then washed and resuspended in 1/100 volume of 0.5 M sucrose containing 10% glycerol. Competent cells were added to the ligation mixture and electroporated using a Gene Pulser (2500 V, 200 Ω, 25 μF, 5 ms, Bio-Rad, USA). The electroporated mixture was immediately diluted in 1 ml of M17B-S/G/Lactose containing 20 mM MgCl2 and 2 mM CaCl2 at 30°C for 1 hour. Then the mixture was plated onto Elliker plates according to the manufacturer’s instructions (MoBiTec, Germany). The lactose-positive colonies were visible in yellow color after 48 hours of incubation at 30°C.
Table 1
Specific primers of allergens used in the study.
Primers
Sequences
Restriction site
cDNA /MW
Per a 2-F
CCATGGATCCAGTCGTCGTTCCT
NcoI
995 bp/38 kDa
Per a 2-R
TCTAGACTACAGTTCTTCTACGGA
XbaI
Der p 2-F
CTGCAGCTGATCAAGTTGATGTTAAAGAT
PstI
404 bp/16 kDa
Der p 2-R
TCTAGATTAATCACGAATTTTAGCATG
XbaI
Cla c 14-F
CTGCAGTGTCTTCCTCCCTCGACCA
PstI
971 bp/36 kDa
Cla c 14-R
TCTAGACTTCTCGATCTTCTCGCGGA
XbaI
The underlined nucleotides indicate the added restriction sites for cloning.
The underlined nucleotides indicate the added restriction sites for cloning.
Protein expression with the food-grade inducer nisin
In this study, the recombinant allergens Per a 2, Der p 2, and Cla c 14 were intracellularly produced under nisin induction in L. lactis NZ3900 clones. The selected L.lactis recombinant clones were propagated in M17 medium containing 0.5% lactose as the sole carbon source at 30°C. The L. lactis strains harboring plasmids with Per a 2/Der p 2/Cla c14 genes were grown until an OD600 of 0.1~0.2 was reached and induced with different concentrations of nisin (0~400 ng/ml, Sigma, Missouri, USA) for 1~16 hours. The harvested cells were monitored for protein expression by SDS-PAGE and immunodetection using rabbit anti-rPer a 2/Der p 2/Cla c 14 polyclonal antibodies.
SDS-PAGE and western blot
Harvested cells of L.lactis were suspended in PBS and disrupted by sonication using a Branson digital sonifier for 30 minutes on ice. After centrifugation at 8000 rpm for 10 minutes, the supernatants were subjected to protein quantitation by the Bradford method using BSA as standards (Bio-Rad, Hercules, CA, USA). Cell lysates of L.lactis were loaded on a 4% polyacrylamide stacking gel with a 12% separating gel, and the gel was run with discontinuous buffer by Laemmli’s method. After electrophoresis, gels were fixed and stained with 0.2% Coomassie brilliant blue R250. For immunoblotting, the gels were transferred to nitrocellulose membranes and blocked with 2% BSA. The membranes were then probed with rabbit anti-rPer a 2/rDer p 2/rCla c 14 antibodies (lab-prepared) followed by a peroxidase-labeled goat anti-rabbit IgG antibody (10000-fold dilution, Millipore). Detection was performed using 3-amino-9-ethylcarbazole (AEC) as an enzyme substrate.
Batch fermentation of recombinant L.lactis strains for oral vaccination
The recombinant L.lactis strains NZ3900 harboring pNZ8149-Per a 2/Der p 2/Cla c 14 were cultured in a bench-top fermentor (Firstek, Taiwan) equipped with a digital pH controller, a temperature-control system, a dissolved oxygen sensor, and a blender. Prior to fermentation, the L. lactis strain was propagated twice in M17 broth and statically incubated in a 30°C incubator for 48 hours. An inoculum comprising 1% (v/v) of the seed culture was transferred to a 5-L fermentor containing 3-L M17 medium for culture. The fermentor was operated at 30°C and the pH was controlled at 6.8~7.2 by automatically adding 2N NaOH solution with a pump. A slow agitation (40 rpm) was maintained to keep the broth homogeneous. Samples were withdrawn aseptically from the broth for analysis of the optical density at 600 nm at regular time intervals. Recombinant protein inducer nisin was added to the broth with optimal dosage and time determined by pre-experiments. The harvested cell pellets were washed with PBS and then resuspended in PBS to a concentration of 1×1011 CFU/ml. The expressed rPer a 2/rDer p 2/rCla c 14 protein was determined by immunoblotting using purified E.coli-derived rPer a 2 /Der p 2/ Cla c 14 as standards, respectively. The corresponding control strain NZ3900 harboring empty plasmid was treated in the same way.
Preparation of Per a 2/Der p 2/Cla c 14 recombinant proteins for sensitization
E.coli-expressed Per a 2/Der p 2/Cla c 14 recombinant proteins (E-rPer a 2/E-rDer p 2/E-rCla c 14) were purified by rapid affinity column chromatography (Novagen, Darmstadt, Germany). The recombinant proteins were further purified by Endotoxin Detoxi-Gel (Pierce, Illinois, USA) and sterilized with a 0.22-μm syringe filter (Millipore, Billerica, MA, USA). Finally, the protein concentration was determined by the Coomassie brilliant G-250 protein-dye binding method of Bradford with bovine serum albumin as a standard according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA).
Animals
BALB/c mice (6 weeks old, female) were purchased from the National Laboratory Animal Center, Taiwan, and raised under specific pathogen-free conditions. All animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee of Taichung Veterans General Hospital (no. La1071603).
Experimental design of prophylactic L.lactis vaccination
The scheme of the experimental design is shown in Fig 1. The mouse model was established as previously described [29]. To evaluate the prophylactic effect of recombinant L.lactis vaccination, BALB/c mice were intragastrically (IG) administered 200 μl of recombinant L.lactis in PBS containing 1 μg each of the rPer a 2, rDer p 2 and rCla c 14 once a day on weekdays for 4 weeks before sensitization. Mice were fasted for 2 hours before each oral treatment. On days 21, 28, and 35, mice were sensitized intraperitoneally (IP) with 2 μg each of E-rPer a 2/E-rDer p 2/E-rCla c 14/1 mg alum. Between day 49 and day 56, the mice were challenged intratracheally (IT) with E-rPer a 2/E-rDer p 2/E-rCla c 14 for four consecutive days. To check the response of sensitization, airway hyperresponsiveness (AHR) was performed on day 56 after the fourth IT challenge. Serum samples were collected from the retro-orbital venous plexus bi-weekly and stored at -20°C until analysis. All mice were sacrificed on day 57 and spleen, lung, kidney, and liver were removed for further study.
Fig 1
Experimental design of prophylactic triple allergy vaccine in a murine model.
BALB/c mice were intragastrically (IG) administered triple vaccine or wild-type L.lactis once a day on weekday for 4 weeks. On days 21–35, mice were sensitized intra-peritoneally (IP) once a week with three shots of the mixture of Per a 2/Der p 2/Cla c 14 or PBS as the negative control. From days 49–56, all groups were challenged intratracheally (IT) for four consecutive days and sacrificed on day 57.
Experimental design of prophylactic triple allergy vaccine in a murine model.
BALB/c mice were intragastrically (IG) administered triple vaccine or wild-type L.lactis once a day on weekday for 4 weeks. On days 21–35, mice were sensitized intra-peritoneally (IP) once a week with three shots of the mixture of Per a 2/Der p 2/Cla c 14 or PBS as the negative control. From days 49–56, all groups were challenged intratracheally (IT) for four consecutive days and sacrificed on day 57.
Measurement of specific antibodies by ELISA
Serum-specific IgE, IgG1 and IgG2a antibodies were determined by ELISA with the required antibodies purchased from BD Pharmingen (San Jose, CA, USA). Microtiter plates were coated with specific antigens for 2 hours at 37°C. After washing with PBST, plates were blocked with 2% BSA for 2 hours at room temperature. Murine sera were diluted (1:10 for IgE or 1:100 for IgGs) in PBST and incubated at room temperature for 2 hours. For IgE measurement, the plates were incubated with biotin-conjugated rat anti-mouse IgE (1:1000) for 2 hours at room temperature. Subsequently, horseradish peroxidase-conjugated streptavidin (1:4000) (Sigma) was added to the plates for 1 hour followed by addition of tetramethylbenzidine (TMB) as a substrate for 10 minutes. Finally, the reaction was stopped by adding 2M sulfuric acid. For IgG measurement, the plates were incubated with horseradish peroxidase-conjugated rabbit anti-mouse IgG1 or IgG2a (1:10000) for 2 hours at room temperature and developed by adding 2,2’-azino-bis(3-ethylbenzthiazoline-sulfonic acid (ABTS, Sigma). Then, the optical density was analyzed on a Sunrise Absorbance Reader (TECAN, Austria) at 450 or 415 nm, respectively.
Measurement of airway hyperresponsiveness (AHR)
AHR, an exaggerated bronchoconstrictor response to inhaled stimuli, is a key feature of asthma, which is closely related to the severity and frequency of symptoms. The airway resistance of mice was measured using a whole-body Buxco mouse plethysmograph (Buxco, NY, USA) after the last challenge. Mice were placed in the main chamber and challenged with aerosolized methacholine at concentrations of 50 mg/ml generated by a nebulizer (Buxco aerosol distribution system). Methacholine is an inhaled drug that causes narrowing of the airways in the lungs. The methacholine challenge test is a type of bronchial challenge test used to help diagnose asthma. The degree of bronchoconstriction was measured and averaged for 3 minutes after each nebulization. Data are expressed as enhanced pause (Penh) by the following equation: Penh = pause × (PEP/PIP). Pause, PEP, and PIP represent the expiration time, the peak expiratory pressure, and the peak respiratory pressure, respectively.
Organ histopathology
Histopathology of vital organs was carried out to rule out any vaccine-induced organ toxicity. At the end of the experiments, the lungs, livers, and kidney were removed and processed for routine histological analysis. Briefly, tissue was fixed with 10% formalin and embedded in paraffin. Four-micrometer sections were cut and stained with a hematoxylin and eosin (H&E) staining kit (CIS-Biotechnology, Taiwan) and corresponding images were captured using an Olympus BX51 microscopic/DP71 Digital Camera System (Nagano, Japan). Moreover, the infiltrating inflammatory cells of lung sections were quantified by light microscopy under 400-fold view.
Real-time PCR
To get a better idea of how various molecules were expressed in the lungs of the experimental mice, we used quantitative PCR on a StepOnePlusTM system (Applied Biosystems, CA, USA) to measure the expression of cytokines. The predesigned primer sequences are listed in Table 2. In brief, cDNA was prepared from 1 μg total RNA using a SuperScript III kit (Invitrogen, Carlsbad, CA). A total volume of 10 μl of PCR mixture, which included 5 μl of Real-Time SYBR Green/ROX PCR master mix from Applied Biosystems (Life technologies, CA, USA), 4 μl of double-distilled H2O, and 1 μl of template cDNA, were added in each well of the PCR array. PCR amplification was conducted with an initial 10-min step at 95°C followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The fluorescent signal from SYBR Green was detected immediately after the extension step of each cycle, and the cycle at which the product was first detectable was recorded as the cycle threshold. Gene expression levels were quantified relative to the expression of β-actin using the optimized comparative Ct (2−ΔΔCt) value method.
Table 2
The sequences of gene-specific primers for mice used in real-time PCR.
Gene (mouse)
Sequences
Produce size (bp)
IL-4
F
5’ AGC CAT ATC CAC GGA TGC GAC AAA 3’
176
R
5’ AAT ATG CGA AGC ACC TTG GAA GCC 3’
IL-13
F
5’ AGA CCA GAC TCC CCT GTG CA 3’
123
R
5’ TGG GTC CTG TAG ATG GCA TTG 3’
IL-10
F
5’ CCA AGC CTT ATC GGA AAT GA 3’
155
R
5’ AGG GGA GAA ATC GAT GAC AG 3’
GM-CSF
F
5’ GCT GCT GAG ATG AAT GAA AC 3’
265
R
5’ AGT CAA AGG GGA TGA CAA G 3’
β-actin
F
5’ GGC CAA CCG TGA AAA GAT GA 3’
251
R
5’ CAC GCT CGG TCA GGA TCT TC 3’
Statistical analysis
Statistical analysis was performed using IBM SPSS software version 22 (IBM Corporation, Armonk, NY, USA). All values are expressed as means ± SD, and differences between groups were analyzed by one-way analysis of variance with a Bonferroni multiple comparison test. P-values less than 0.05 were considered to be significant.
Results
Construction, expression, and immunoreactivity of the three recombinant L.lactis-Per a 2/Der p 2/Cla c 14
Three strains of recombinant L.lactis producing Per a 2, Der p 2, and Cla c 14 were constructed and the insertions into pNZ8149 plasmid were confirmed by restriction enzyme digestion as shown in Fig 2. The expression of Per a 2, Der p 2, and Cla c 14 via nisin induction in the recombinant L.lactis NZ3900 was evaluated by Western blots using in-house anti-Per a 2 (Fig 3A), anti-Der p 2 (Fig 3B), and anti-Cla c 14 (Fig 3C) polyclonal antibodies, respectively. Maximal recombinant protein productions were reached at an OD600 of 0.16 under the following culture condition: 30°C using 50 ng/ml (for Per a 2 and Der P 2) or 20 ng/ml (for Cla c 14) nisin with 3 hours of induction.
Fig 2
Ethidine bromide-stained agarose gel of the digested recombinant plasmids as indicated.
The purified DNA of pNZ8149-Per a 2, pNZ8149-Der p 2 and pNZ8149-Cla c 14 were digested with restriction enzymes of NcoI/XbaI, PstI/XbaI and PstI/XbaI, respectively. Numbers at left indicate size of standard DNA fragments in kilo base pairs (Kb).
Fig 3
Immunoblot analyses of Per a 2 (A), Der p 2 (B) and Cla c 14-producing (C) engineered L. lactis. Intracellular production of the allergens were detected in total cell extracts after various doses of nisin induction using Per a 2, Der p 2 or Cla c 14-specific polyclonal antibodies, respectively. The results indicated that the selected recombinant L.lactis strain successfully expressed Per a 2, Der p 2 and Cla c 14 proteins.
Ethidine bromide-stained agarose gel of the digested recombinant plasmids as indicated.
The purified DNA of pNZ8149-Per a 2, pNZ8149-Der p 2 and pNZ8149-Cla c 14 were digested with restriction enzymes of NcoI/XbaI, PstI/XbaI and PstI/XbaI, respectively. Numbers at left indicate size of standard DNA fragments in kilo base pairs (Kb).Immunoblot analyses of Per a 2 (A), Der p 2 (B) and Cla c 14-producing (C) engineered L. lactis. Intracellular production of the allergens were detected in total cell extracts after various doses of nisin induction using Per a 2, Der p 2 or Cla c 14-specific polyclonal antibodies, respectively. The results indicated that the selected recombinant L.lactis strain successfully expressed Per a 2, Der p 2 and Cla c 14 proteins.
Recombinant L. lactis triple vaccine modulated allergen-specific antibody responses
The prophylactic potential of the triple allergy vaccine was assessed in a lab-developed Per a 2/Der p 2/Cla c 14 sensitization murine model. Our model revealed that serum-specific IgE levels against corresponding allergens were significantly higher in the sensitized/not vaccinated and sensitized/vector only groups compared with the naive group (Fig 4A, 4C and 4E). However, the allergenic-specific IgE responses were significantly reduced in the sensitized/triple vaccinated group (Fig 4A, 4C and 4E) and the specific IgG2a levels increased (Fig 4B, 4D and 4F) in sera compared with the not vaccinated group or naive group, respectively.
Fig 4
Serum levels of specific-IgE (A C, E) and -IgG2a (B, D, F) antibodies for individual antigens among four groups at week 8 determined by ELISA. Results are mean±SD of 6 mice from each group. *p< 0.05; **p<0.01 by one-way analysis of variance with the Bonferroni multiple range test.
Serum levels of specific-IgE (A C, E) and -IgG2a (B, D, F) antibodies for individual antigens among four groups at week 8 determined by ELISA. Results are mean±SD of 6 mice from each group. *p< 0.05; **p<0.01 by one-way analysis of variance with the Bonferroni multiple range test.
Recombinant L. lactis triple vaccine alleviated airway hyperresponsiveness and pulmonary inflammation
To explore the prophylactic potential of triple vaccine on the development of allergic asthma, mice underwent IP sensitization and IT challenge with the combination of three recombinant allergens. After the final challenge, mice were treated with 50 mg/ml of methacholine aerosol and Penh value was measured. In the not vaccinated and vector alone groups, mice showed markedly increased Penh upon methacholine exposure. In the triple vaccinated group, mice showed a significant reduction of Penh either compared with not vaccinated or VO groups (Fig 5).
Fig 5
Effect of triple vaccine on airway hyperresponsiveness in mice sensitized to 3 allergens.
Mean enhanced pause (Penh) values were evaluated at 50 mg/ml of methacholine in the four groups. *p<0.05 by one-way analysis of variance with the Bonferroni multiple range test.
Effect of triple vaccine on airway hyperresponsiveness in mice sensitized to 3 allergens.
Mean enhanced pause (Penh) values were evaluated at 50 mg/ml of methacholine in the four groups. *p<0.05 by one-way analysis of variance with the Bonferroni multiple range test.Furthermore, the cytokine mRNA expressions in the lungs of mice in each group were determined by real-time PCR as shown in Fig 6. There was significant downregulation of mRNA levels of IL13 (Fig 6A), IL-4 (Fig 6B), IL10 (Fig 6C), and GM-CSF (Fig 6D) in the triple vaccine group compared with the not vaccinated group. Additionally, histopathologic features of the murine lungs are shown in Fig 7A. The examination of the lung tissues from either the not vaccinated or vector alone group revealed numerous inflammatory cells surrounding the airways (Fig 7A), whereas the oral triple vaccine group produced a marked decrease in cellular infiltration and changes similar to the naïve group (Fig 7A). The results of differential cell counts revealed that oral recombinant L.lactis triple vaccine could significantly reduce infiltration of total inflammatory cells and eosinophils in lungs (Fig 7B).
Fig 6
Cytokine mRNA levels of lungs from each group of mice by real-time PCR.
(A) IL-13, (B) IL-4, (C) IL-10, (D) GM-CSF. Data are expressed as mean of 2-ΔCt ±SD. The statistical significance of differences among groups was assessed by the Bonferroni multiple range test. *denoted p<0.05; **denoted p<0.01.
Fig 7
The effects of triple vaccine on histopathology of lung.
(A) The representative lung sections obtained 24 hours after intratracheal challenge and stained with H&E. (B) The infiltrating inflammatory cells were quantified by light microscope under 400-fold view. The results are expressed as mean±SD of the cell numbers. The statistical significance of differences among groups was assessed by the Bonferroni test. **denoted p<0.01.
Cytokine mRNA levels of lungs from each group of mice by real-time PCR.
(A) IL-13, (B) IL-4, (C) IL-10, (D) GM-CSF. Data are expressed as mean of 2-ΔCt ±SD. The statistical significance of differences among groups was assessed by the Bonferroni multiple range test. *denoted p<0.05; **denoted p<0.01.
The effects of triple vaccine on histopathology of lung.
(A) The representative lung sections obtained 24 hours after intratracheal challenge and stained with H&E. (B) The infiltrating inflammatory cells were quantified by light microscope under 400-fold view. The results are expressed as mean±SD of the cell numbers. The statistical significance of differences among groups was assessed by the Bonferroni test. **denoted p<0.01.
Safety testing in the vaccinated mice
To evaluate the safety of oral vaccine using genetically modified L.lactis, BALB/c mice were first fed with triple vaccine once a day 5 times per week for 4 weeks (20 doses) and then sensitized and challenged with recombinant Per a 2/Der p 2/Cla c14 allergens. No major change in feed consumption was observed among any of the groups of mice. Final body weight and relative organ weights of all mice were measured after sacrifice (Table 3). There were no significant differences in body weight and organ weights among groups, indicating that there were no vaccine-specific changes. Moreover, histopathological examination of hematoxylin and eosin (H&E)-stained liver and kidney showed normal hepatic architecture with central vein and surrounding hepatocytes, and normal glomeruli and renal tubules in the kidneys of mice in all groups (Fig 8).
Table 3
Body and organ weights of the mice.
Groups
Body weight (g)
Liver (g)
Spleen (g)
Kidney (g)
Naïve
24.27±1.07
1.23±0.06
0.12±0.01
0.39±0.02
Not vaccinated
23.23±1.54
1.21±0.12
0.14±0.03
0.35±0.02
VO
22.34±0.92
1.17±0.05
0.14±0.03
0.33±0.03
Triple vaccine
23.7±1.94
1.21±0.19
0.16±0.03
0.37±0.04
Data are expressed as mean±SD for each group.
Fig 8
Hematoxylin and eosin (H&E)-stained liver and kidney sections of mice from four groups.
The results showed normal hepatic architecture with central vein and surrounding hepatocytes, and normal glomeruli and renal tubules in the kidneys from all groups of mice. Magnification × 200.
Hematoxylin and eosin (H&E)-stained liver and kidney sections of mice from four groups.
The results showed normal hepatic architecture with central vein and surrounding hepatocytes, and normal glomeruli and renal tubules in the kidneys from all groups of mice. Magnification × 200.Data are expressed as mean±SD for each group.
Discussion
The increasing prevalence of allergic diseases is having an enormous impact on patients’ quality of life. Management that is capable of improving chronic allergic inflammation without impairing patients’ immune function is especially important during the current COVID-19 pandemic [30, 31]. It has been reported that antecedents of allergic diseases might influence hospitalization risk in relatively young patients [32]. A recent Korean nationwide cohort showed that patients with allergic rhinitis and asthma have a greater risk of SARS-CoV-2 infection as well as worse clinical outcomes of COVID-19 [33]. The COVID-19 pandemic has also changed clinical practice in the treatment of allergy, as the number of conventional injectable allergen-specific immunotherapies has decreased markedly [34]. The COVID-19 pandemic has revealed the unmet need for a safe, effective, and convenient allergen-specific immunotherapy vaccine that can be administered at home.In this study, we established an in vivo mouse model to investigate whether a combination of the three major perennial indoor aeroallergens, engineered in L. lactis as a live vaccine, can prevent common airway allergy. Our data show that a total of only 20 doses of oral L.lactis triple vaccine resulted in a significant decrease in clinical bronchial hyper-responsiveness and inflammatory cell infiltration in the lungs of the vaccinated mice compared with the control mice. The protective effect was associated with an upregulation of specific IgG2a, one of the surrogate markers of successful allergen-specific immunotherapy in mice, and decreases in IL-4 and IL-13 expressions in the lung, which may affect specific IgE response. The results open the window to the possibility of developing a new convenient route of oral allergen-specific immunotherapy that could be safely administered by the patient at home. A similar idea was demonstrated by Saito et al. They used a transgenic rice seed-based oral allergy vaccine to treat Japanese cedar pollen allergic Japanese monkeys, and noted a suppression of allergen-specific cell proliferation after only two months of administration [35].Many Lactic acid bacteria (LAB) are generally regarded as safe by the American Food and Drug Administration. L. lactis is the model microorganism in LAB research as it is a potential carrier of heterologous genes. Our study also demonstrated the safety of this oral vaccine as none of the mice demonstrated signs of illness/loss of appetite during administration and there were no changes in body weight and organ weight in any of the groups.There were some limitations in this study. As we did not check inflammatory cells, cytokines and secretary IgE, IgG isotypes and IgA in the nasal secretion and bronchial lavage fluid, whether this triple vaccine is able to induce both local and systemic tolerance required further studies. As a proof-of-concept triple oral allergen vaccine, the scope of this investigation was restricted to the prophylactic effects of the oral vaccine. Further investigation is required to establish whether or not this oral vaccine is effective in established allergic subjects, as in the study by Saito et al. Also, it is unclear whether the oral vaccine has a dose-dependent response and thus further study is needed. However, this pilot study opens the possibility that this type of therapy might be applied in tailor-made component-resolving immunotherapy depending on the individual allergen profile of each patient in the future.In conclusion, this is the first report to describe the development of a triple-aeroallergen vaccine using a food-grade lactococcal expression system. We developed a convenient oral delivery system using a mouse model and intend to extend these results with the goal of developing a vaccination that can be self-administered at home by patients.(ZIP)Click here for additional data file.3 Aug 2021PONE-D-21-11729Effectiveness and Safety of oral lactococci-based vaccine encoding triple common allergens to prevent airway allergy in micePLOS ONEDear Dr. Chen,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Regarding the experiments, the authors should complete the data by including the evaluation of antibodies (IgE, IgA and IgG2a) in samples collected from the airways (lung supernatants or BAL, for instance).The authors should also comment on the interval chosen for analyzes of the adverse effects measured by histological evaluation of organs as well as other parameters that could be applied.The final text (introduction, material and methods, discussion) should be improved according to the considerations of the reviewers.Please submit your revised manuscript by Sep 10 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Maria Leonor S Oliveira, PhDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. As part of your revision, please complete and submit a copy of the ARRIVE Guidelines checklist, a document that aims to improve experimental reporting and reproducibility of animal studies for purposes of post-publication data analysis and reproducibility: https://www.nc3rs.org.uk/arrive-guidelines. Please include your completed checklist as a Supporting Information file. Note that if your paper is accepted for publication, this checklist will be published as part of your article.3. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.We will update your Data Availability statement to reflect the information you provide in your cover letter.5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.6. Please amend the manuscript submission data (via Edit Submission) to include author Chi-Sheng Wu.7. Please upload a new copy of Figures 1 and 3 as the detail is not clear. Please follow the link for more information: https://blogs.plos.org/plos/2019/06/looking-good-tips-for-creating-your-plos-figures-graphics/" https://blogs.plos.org/plos/2019/06/looking-good-tips-for-creating-your-plos-figures-graphics/.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: N/AReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: NoReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: I find the manuscript interesting, considering the approach of a potential preventive strategy to avoid allergies to certain allergens. The studies carried out both to obtain recombinant L. lactis for 3 antigens and the assays in a mice experimental model involve laborious work. However, I have some suggestions and inquiries to the authors:1- I suggest to improve the introduction, to avoid the repetition of concepts (lines from 50 to 59)2- L. lactis is simple to cultivate and it has the ability to secrete recombinant proteins to the growth medium, which together facilitates downstream processing of recombinant protein. In this work the proteins are not secreted, are produced in cytoplasm. If this is so, it should be clearly redacted in Material and Methods.3- The authors evaluated the potential adverse effects of vaccination outside the lung through very general parameters such as weight of mice, weight of spleen, liver and kidney. It is likely that the animals will need to be monitored longer to see changes in these parameters. Histological studies were carried out in kidney and liver and they are important. However, there are simple serological parameters that provide specific data on kidney (creatinine levels in serum) and liver functionality (AST and ALT enzyme blood levels), for example. It would have been interesting to evaluate these parameters.4- The IgE and IgG2a levels were evaluated in serum. I consider it is important to evaluate these parameters in bronchoalveolar lavage (BAL).5- Methacholine is an inhaled drug that causes a slight narrowing of the airways in the lungs. The methacholine challenge test is a type of bronchial challenge test used to help diagnose asthma. I think that to include a brief sentence about this would facilitate the understanding of non-expert researchers on the subject.5- In Table 2: Il should be changed by IL.6- In Figures 4 (AB, CD, EF) Is it possible used the same scale for IgE and IgG2a?7- The authors mentioned the limitations of this study but considering globally the results, I think the discussion could be improved.Reviewer #2: The manuscript is well-written and describes, in a concise way, the aims of this investigation. Vaccine-based interventions represent a cost-effective alternative to prevent and treat many diseases, especially those related to hypersensitivities. Although this formulation is not the pioneer in the prevention or treatment of allergies, the research's originality relies on a combined allergens (expressed in GRAS) strategy. In this context, the work is relevant and consists of an original contribution to a preventive as well as potential therapeutic use of vaccines. The manuscript also reveals a substantial amount of work and the use of adequate techniques to characterize their system.There are just some minor questions that would be addressed by the authors:1. In Materials and Methods (lines 169-180), the authors describe the immunization protocol, with specific doses, besides the sensitization and challenge methods. It is not clear how they made this experimental design, since this section does not bring any references. These protocols, mentioned previously, were not referenced. Therefore, I recommend that the authors add more information about the experimental design regarding these methods.2. The information of protein sizes (in kDa) is lacking in the text (Materials and Methods and Results as well). I suggest that this piece of information appears in Results section (for instance, between lines 246-254).3. The statistical analysis was not properly described in the text (lines 240-243). The authors only mention that "appropriate methods" were performed to analyze the results. The specific information about statistics of antibodies levels can be found only in the figure 4 description, for instance.4. I was wondering why the authors did not collect nasal as well as bronchoalveolar lavages to determine IgA levels. Hypersensitivities that affect respiratory tracts (upper and lower) usually result in local and systemic response, characterized by IgG (from Th2 profile), IgE and secretory IgA production. For this reason, the authors would address this question, in other words, they should clarify the reason why this isotype was not analyzed.If the authors address these questions, the manuscript will be suitable for publication at PLoS One.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.31 Oct 2021Dear Dr. Oliveira and the reviewers:Thank you so much for reviewing our manuscript. Please find below our point-by-point responses to the reviewers’ comments. We gratefully appreciate the valuable suggestions.Reviewer #1: I find the manuscript interesting, considering the approach of a potential preventive strategy to avoid allergies to certain allergens. The studies carried out both to obtain recombinant L. lactis for 3 antigens and the assays in a mice experimental model involve laborious work. However, I have some suggestions and inquiries to the authors:Question 1. I suggest to improve the introduction, to avoid the repetition of concepts (lines from 50 to 59)Reply: We have condensed the last part of introduction (original lines 50-59) to 5 lines (new lines 51-55) as the recommendation of the reviewer.Question 2. L. lactis is simple to cultivate and it has the ability to secrete recombinant proteins to the growth medium, which together facilitates downstream processing of recombinant protein. In this work the proteins are not secreted, are produced in cytoplasm. If this is so, it should be clearly redacted in Material and Methods.Reply: Thank you for the reminding. The description has been added to the revised manuscript. Please see lines 90-91: ” In this study, the recombinant allergens Per a 2, Der p 2, and Cla c 14 were intracellularly produced under nisin induction in L. lactis NZ3900 clones.”Question 3. The authors evaluated the potential adverse effects of vaccination outside the lung through very general parameters such as weight of mice, weight of spleen, liver and kidney. It is likely that the animals will need to be monitored longer to see changes in these parameters. Histological studies were carried out in kidney and liver and they are important. However, there are simple serological parameters that provide specific data on kidney (creatinine levels in serum) and liver functionality (AST and ALT enzyme blood levels), for example. It would have been interesting to evaluate these parameters.Reply: Thank you for the comments. We love to have more biochemical safety data if possible. Unfortunately, after doing the immunological testing, the residual amount of the blood drawn from retro-orbital space of each tiny mouse was not enough to check these biochemical tests. However, we have data from rabbits to look at the safety of this triple-allergen vaccine using a 13-week oral toxicity study (data see below table). The routine hematological and serum biochemical parameters were monitored monthly and the data are summarized in the following tables. The serum liver protein, including aspartate transaminase (AST), alanine transaminase (ALT), albumin (ALB) and total protein (TP); renal function indicators: blood urea nitrogen (BUN) and creatinine (CRE); and serum cholesterol (CHOL) and glucose (GLU) levels were not significantly different between the groups receiving oral administration of Triple vaccine and the control group (NC) in either male or female animals, and all data were within the normal ranges.Question 4. The IgE and IgG2a levels were evaluated in serum. I consider it is important to evaluate these parameters in bronchoalveolar lavage (BAL).Reply: Thank you for the comments. IgE and IgE-allergen immune complex in the airway are indeed good markers for airway inflammation. It is unfortunate we did not look at IgE and IgG2a in BAL fluid in this study. The statement has been added to the study limitation in the Discussion section lines 341-343.Question 5. Methacholine is an inhaled drug that causes a slight narrowing of the airways in the lungs. The methacholine challenge test is a type of bronchial challenge test used to help diagnose asthma. I think that to include a brief sentence about this would facilitate the understanding of non-expert researchers on the subject.Reply: The description regarding methacholine challenge was added in the Section of Materials and Methods lines 183-184.” Methacholine is an inhaled drug that causes narrowing of the airways in the lungs. The methacholine challenge test is a type of bronchial challenge test used to help diagnose asthma.”Question 5. In Table 2: Il should be changed by IL.Reply: The typo has been corrected in the new Table 2 as recommended by the reviewer.Question 6. In Figures 4 (AB, CD, EF) Is it possible used the same scale for IgE and IgG2a?Reply: A new Figure 4 with the Y-axis on the same scale has been made as recommended by the reviewer.Question 7. The authors mentioned the limitations of this study but considering globally the results, I think the discussion could be improved.Reply: We have added more discussion regarding the study limitations as the comments of the reviewer.Reviewer #2: The manuscript is well-written and describes, in a concise way, the aims of this investigation. Vaccine-based interventions represent a cost-effective alternative to prevent and treat many diseases, especially those related to hypersensitivities. Although this formulation is not the pioneer in the prevention or treatment of allergies, the research's originality relies on combined allergens (expressed in GRAS) strategy. In this context, the work is relevant and consists of an original contribution to a preventive as well as potential therapeutic use of vaccines. The manuscript also reveals a substantial amount of work and the use of adequate techniques to characterize their system.There are just some minor questions that would be addressed by the authors:Question 1. In Materials and Methods (lines 169-180), the authors describe the immunization protocol, with specific doses, besides the sensitization and challenge methods. It is not clear how they made this experimental design, since this section does not bring any references. These protocols, mentioned previously, were not referenced. Therefore, I recommend that the authors add more information about the experimental design regarding these methods.Reply: We have specifically cite a reference describing our previous study as recommended by the reviewer. Please see lines 143-144: The mouse model was established as previously described[29] .Question 2. The information of protein sizes (in kDa) is lacking in the text (Materials and Methods and Results as well). I suggest that this piece of information appears in Results section (for instance, between lines 246-254).Reply: More details regarding the sizes of cDNA and the corresponding recombinant proteins were added in new Table 1. Please see line 73-74: The amplified sizes of cDNA and the molecular weights of the derived proteins are also shown in new Table 1.Question 3. The statistical analysis was not properly described in the text (lines 240-243). The authors only mention that "appropriate methods" were performed to analyze the results. The specific information about statistics of antibodies levels can be found only in the figure 4 description, for instance.Reply: Yes. The detailed information regarding statistic methods has been added to the revised manuscript. Please see lines 217-218: All values are expressed as means ± SD, and differences between groups were analyzed by one-way analysis of variance with a Bonferroni multiple comparison test.Question 4. I was wondering why the authors did not collect nasal as well as bronchoalveolar lavages to determine IgA levels. Hypersensitivities that affect respiratory tracts (upper and lower) usually result in local and systemic response, characterized by IgG (from Th2 profile), IgE and secretory IgA production. For this reason, the authors would address this question, in other words, they should clarify the reason why this isotype was not analyzed.Reply: Thank you for the comments. We have added sentences regrading study limitation in the Discussion section lines 341-343 “As we did not check inflammatory cells, cytokines and secretary IgE, IgG isotypes and IgA in the nasal secretion and bronchial lavage fluid, whether this triple vaccine is able to induce both local and systemic tolerance required further studies.”.Submitted filename: Response to the reviewers.docxClick here for additional data file.1 Dec 2021Effectiveness and Safety of oral lactococci-based vaccine encoding triple common allergens to prevent airway allergy in micePONE-D-21-11729R1Dear Dr. Chen,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Maria Leonor S Oliveira, PhDAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The manuscript was substantially improved.I think that the authors responded favorably to the suggestions and questions raised, and in its current form, the manuscript should be accepted for publication.Reviewer #2: The authors presented a document with all comments addressed. I would like to add some minor correction regarding the answer to question 4 of my comments. It is a matter of misspelling. They must write "secretory" instead of "secretary" and "requires" instead of "required". In spite of this minor issue, the paper is ready for publication.**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No9 Dec 2021PONE-D-21-11729R1Effectiveness and Safety of oral lactococci-based vaccine encoding triple common allergens to prevent airway allergy in miceDear Dr. Chen:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Maria Leonor S OliveiraAcademic EditorPLOS ONE
Authors: Holger Mosbech; Regina Deckelmann; Fréderic de Blay; Elide Anna Pastorello; Ewa Trebas-Pietras; Luis Prieto Andres; Inga Malcus; Christian Ljørring; Giorgio Walter Canonica Journal: J Allergy Clin Immunol Date: 2014-05-03 Impact factor: 10.793
Authors: Pascal Demoly; Jonathan Corren; Peter Creticos; Frédéric De Blay; Philippe Gevaert; Peter Hellings; Krzysztof Kowal; Martine Le Gall; Natalia Nenasheva; Giovanni Passalacqua; Oliver Pfaar; Miguel Tortajada-Girbés; Carmen Vidal; Margitta Worm; Thomas B Casale Journal: J Allergy Clin Immunol Date: 2020-09-02 Impact factor: 10.793
Authors: G Roberts; O Pfaar; C A Akdis; I J Ansotegui; S R Durham; R Gerth van Wijk; S Halken; D Larenas-Linnemann; R Pawankar; C Pitsios; A Sheikh; M Worm; S Arasi; M A Calderon; C Cingi; S Dhami; J L Fauquert; E Hamelmann; P Hellings; L Jacobsen; E F Knol; S Y Lin; P Maggina; R Mösges; J N G Oude Elberink; G B Pajno; E A Pastorello; M Penagos; G Rotiroti; C B Schmidt-Weber; F Timmermans; O Tsilochristou; E-M Varga; J N Wilkinson; A Williams; L Zhang; I Agache; E Angier; M Fernandez-Rivas; M Jutel; S Lau; R van Ree; D Ryan; G J Sturm; A Muraro Journal: Allergy Date: 2017-10-30 Impact factor: 13.146