Yue Guo1, Lan Wang2, Hui Yang2, Nannan Ding3. 1. Hematology Department, Xiangyang No. 1 People's Hospital, Hubei University of Medicine, Xiangyang, China. 2. Department of Anesthesiology, Xiangyang No. 1 People's Hospital, Hubei University of Medicine, Xiangyang, China. 3. Department of Pharmacy, Xiangyang Central Hospital, Affiliated of Hubei University of Arts and Science, Xiangyang, China.
Abstract
Recently, long noncoding RNAs (lncRNAs) have been revealed to participate in cancer therapy. Especial in tumor radiotherapy, lncRNAs usually could enhance or restrict the radiosensitivity in different ways. LncRNA HCP5 is highly expressed in esophageal cancer and influenced the malignant behaviors of esophageal cancer cells. However, this study dedicates to clarify if lncRNA HCP5 affects the radiosensitivity of esophageal carcinoma. The expression levels of HCP5 in esophageal cancer and adjacent noncancerous tissue were first analyzed on the TCGA database and then detected by qRT-PCR. The related functional experiments were used to investigate whether the radiosensitivity of esophageal squamous cell carcinoma was affected by the inhibition of HCP5. The expression results showed HCP5 is upregulated in esophageal cancers compared to the normal tissues. Meanwhile, knockdown HCP5 further suppressed the proliferation and promoted the apoptosis of esophageal cancer cells treated with a 2 Gy dose of radiotherapy. Moreover, we uncovered that knockdown HCP5 eliminated radiotherapy resistance by modulating the miR-216a-3p/PDK1 axis to inhibit the AKT activation. Finally, rescue experiments pointed that lowering the miR-216a-3p expression weakened the inhibition effect of knockdown HCP5 on cells treated with radiotherapy. To summary, our results indicate that HCP5 is involved in esophageal carcinoma radiotherapy and knockdown HCP5 enhances the radiosensitivity of esophageal carcinoma by modulating AKT signaling activation.
Recently, long noncoding RNAs (lncRNAs) have been revealed to participate in cancer therapy. Especial in tumor radiotherapy, lncRNAs usually could enhance or restrict the radiosensitivity in different ways. LncRNA HCP5 is highly expressed in esophageal cancer and influenced the malignant behaviors of esophageal cancer cells. However, this study dedicates to clarify if lncRNA HCP5 affects the radiosensitivity of esophageal carcinoma. The expression levels of HCP5 in esophageal cancer and adjacent noncancerous tissue were first analyzed on the TCGA database and then detected by qRT-PCR. The related functional experiments were used to investigate whether the radiosensitivity of esophageal squamous cell carcinoma was affected by the inhibition of HCP5. The expression results showed HCP5 is upregulated in esophageal cancers compared to the normal tissues. Meanwhile, knockdown HCP5 further suppressed the proliferation and promoted the apoptosis of esophageal cancer cells treated with a 2 Gy dose of radiotherapy. Moreover, we uncovered that knockdown HCP5 eliminated radiotherapy resistance by modulating the miR-216a-3p/PDK1 axis to inhibit the AKT activation. Finally, rescue experiments pointed that lowering the miR-216a-3p expression weakened the inhibition effect of knockdown HCP5 on cells treated with radiotherapy. To summary, our results indicate that HCP5 is involved in esophageal carcinoma radiotherapy and knockdown HCP5 enhances the radiosensitivity of esophageal carcinoma by modulating AKT signaling activation.
Esophageal carcinoma (EC) endangers severely public health with a continually increasing incidence [1,2]. Statistically, esophageal cancer has become the most common and lethal cancer type in the world, ranking 8th and 6th in 2018, respectively [2,3]. Up to date, though esophagectomy with radical lymphadenectomy is preferred for esophageal cancer treatment, radiation, and chemotherapy have also been widespread applied for patients with esophageal cancer [1]. Radiotherapy has emerged as an advantageous therapy alternative for EC patients who are medically inoperable to undergo surgery [1,4]. Whereas still a portion of EC patients cannot profit or poorly benefit from radiotherapy. Improving the radiotherapy sensitivity of tumors is very beneficial to the radiotherapy effect [4,5]. Thus, it is urgent to excavate the underlying mechanism of esophageal cancer radiotherapy for improving the radiosensitivity of esophageal cancer.LncRNA HCP5 (HLA Complex P5) is a kind of RNA gene without protein-coding [6]. Studies have pointed that lncRNA HCP5 is associated with the progressions and developments of various cancers and diseases [6,7]. For instance, lncRNA HCP5 typically acts an oncogenic role to promote the malignant behaviors in thyroid cancer, colorectal cancer, and gastric cancer [8-10]. Moreover, in esophageal cancer, HCP5 induces PI3K/AKT/mTOR signaling to accelerate the development [7]. However, there are few studies that reported that HCP5 is connected with the radiosensitivity of cancer. Here in this study, we attempt to elucidate whether the radiosensitivity of esophageal cancer is governed by HCP5.It is well known that lncRNA sever a ceRNA (Competing endogenous RNA) function to down-regulate the specific miRNAs, which are capable of binding with lncRNA [11]. Through an online database analysis, miR-216a-3p is a downward target of HCP5 with high grades. Although a large number of researchers found that miR-216a-3p has tumor-suppressing function, no works have made the connection between the miR-216a-3p and radiotherapy [12,13]. Similarly, miRNAs could bind at 3ʹUTR of a target gene to inhibit its expression [11,14]. PDK1 (Pyruvate Dehydrogenase Kinase 1) mainly activates the PDH (Pyruvate dehydrogenase) enzyme, which catalyzes the oxidative decarboxylation of pyruvate [15,16]. Through a series of catalytic reactions and signaling transduction, the AKT signaling would be phosphorylated after inducing PDK1 expression [17]. Interestingly, the activation of AKT signaling is closely related to the radiosensitivity of esophageal carcinoma [18,19]. Regardless of the cancer type, the emerging consensus is that inhibition of AKT activation could elevate the radiotherapy curative effect in most cancers [20,21]. Thus, reducing the level of AKT phosphorylation is essential for improving the response to radiotherapy in esophageal cancer.To sum up, we proposed that lncRNA HCP5 could participate in the radiotherapy of esophageal carcinoma. Knockdown of HCP5 modulates the miR-216a-3p/PDK1 axis to inhibit AKT activation, eventually improving the radiosensitivity of esophageal cancer. In all, our study provides a novel radiotherapy strategy or regimen for esophageal cancer. Our presumption would help more esophageal cancer patients benefit from radiotherapy.
Methods
Patient tissues
Total 20 pairs of esophageal cancer and adjacent noncancerous tissues were collected from 20 esophageal cancer patients between 2019 and 2020 with informed written consent. The tissues were immediately frozen in liquid nitrogen after collection and then transferred to a − 80°C refrigerator.
Cell culture
Esophegeal cancer cells (EC9706, KYSE30, and TE-1) and Human esophageal epithelial cells (Het-1A) were all cultured in RPMI 1640 medium (Gibco, USA) with 10% fetal bovine serum (Gibco, USA) in a 37°C, 5% CO2 incubator. All cells were obtained from Shanghai Cell Bank of Type Culture Collection of Chinese Academy of Sciences.
qRT-PCR
The qRT-PCR was used to detected the HCP5, miR-216a-3p, and PDK1 expression in tissues and cell lines. The RNA of tissues and cells were extracted by Trizol (Invitrogen, Carlsbad, CA, USA) and then reversed to cDNA with a reverse transcription kit (Invitrogen). GAPDH and U6 were, respectively, as internal controls for mRNA and miRNA. The analysis was performed with SYBR (TaKaRa, China) on a CFX96 RT-PCR system. The primers in this study are shown in Table 1.
Table 1.
The primers are as follows
Name
Forward /Reverse
Sequence (5ʹ to 3ʹ)
HCP5
F
CCGCTGGTCTCTGGACACATACT
R
CTCACCTGTCGTGGGATTTTGC
miR-216a-3p
F
TAATCTCAGCTGGCAACT
R
GGTGTCGTGGAGTCG
PDK1
F
CTGTGATACGGATCAGAAACCG
R
TCCACCAAACAATAAAGAGTGCT
GAPDH
F
GAAGGTGAAGGTCGGAGTC
R
GAAGATGGTGATGGGATTTC
U6
F
CTCGCTTCGGCAGCACA
R
AACGCTTCACGAATTTGCGT
The primers are as follows
Cell transfection
Vectors encoding short-hairpin HCP5 (shHCP5) and the negative control (sh-control) were designed and synthesized by Genechem (Genechem Shanghai, China). The corresponding sequence of shHCP5 is 5ʹ-GCTGGTCTCTGGACACATACTCTCGAGAGTATGTGTCCAGAGACCAGCTTTTTG-3ʹ. The KYSE30 and TE-1 cells were infected with the lentivirus shRNA HCP5 and corresponding negative control (shHCP5 and shNC) to knockdown of HCP5 (MOI = 50). The miR-216a-3p mimic, miR NC, miR-216a-3p inhibitor and inhibitor NC were all synthesized to interfere the miR-216a-3p level (RiBoBio, Guangzhou, China). About at 60% confluence, cells were treated with Lipofectamine™2000 (ThermoFisher, USA) and required miR mimic, miR inhibitor or NC.
Cell viability assays
3000 cells were planted into a 96-well plate for 24 h. And then according to the group, cells were exposed to 0 or 2 Gy radiation (once). After 3 days, the cell viability was evaluated by adding 10 μl CCK-8 (Beyotime, Shanghai, China) for another 4 h. The results are read on 450 nm by a Microplate Reader.
Colony assays
About 500 cells were planted into a six-well plate for 2 days. And then according to the group, cells were exposed to a range of radiation doses (0, 2, 4, 6, and 8 Gy) (once). After 10 days, the cell colon was stained and counted. More than 50 cells were identified as a colony.
Apoptosis
The corresponding cells were harvested at 72 h post-transfection. A single dose of radiotherapy was given 1 day after transfection. The apoptosis cells were examined by an Annexin V-FITC/PI kit (Invitrogen, USA) on flow cytometry (Beckman Coulter).
Luciferase reporter system
A luciferase reporter vectors (pRL-TK, Promega) were used to detect the luciferase intensity. The corresponding plasmids with the wild-type sequence or mutant sequence were synthesized from Genepharma. After 48 h at co-transfection with luciferase plasmids and miR mimic or NC, the intensity was detected by Dual-Luciferase Reporter Assay System (Promega).
Western blotting
The cells are lysed by RIPA Lysis Buffer (Beyotime, Shanghai, China) to get protein, and then centrifugation and degeneration. The samples were separated by 10% SDS-PAGE gels and transferred to PVDF membrane (Bio-Rad, USA). The primary antibody, anti-PDK1 (1:1000, ab202468, abcam), p-AKT (1:1000, ab38449, abcam), t-AKT (1:1000, ab8805, abcam) and GAPDH (1:5000, ab8245, abcam) was incubated after blocking with blocking buffer overnight. On the second day, HRP conjugated secondary antibodies were incubated after washing. The results were examined by chemiluminescence. Anti-GAPDH was used as internal reference.
Statistical analysis
Statistical analysis was performed using SPSS 19.0 software (SPSS, Chicago, IL, USA). The data are expressed as the mean ± standard deviation (SD). Differences between groups were evaluated by Student’s t-test. P < 0.05 indicated statistical significance.
Results
Radiotherapy is a common and effective treatment for cancer. This study sets out to explore whether knockdown HCP5 enhances the efficacy of radiotherapy for esophageal carcinoma. Due to HCP5 is upregulated in esophageal cancer, we constructed a lentiviral shRNA to knockdown HCP5. Through a series of functional experiments, we revealed that knockdown lncRNA HCP5 enhances the radiosensitivity of esophageal carcinoma by modulating AKT signaling activation.
The higher expression of lncRNA HCP5 is in esophageal cancer tissues
Through analyzing the expression profile of HCP5 in esophageal cancer tissues and adjacent tissues on an online database (http://gepia.cancer-pku.cn), we found that HCP5 is upregulated in esophageal cancer tissues compared with normal tissues (Figure 1(a)). Similarly in our collected samples (Figure 1(b)), the expression level of HCP5 in esophageal tissues is higher than adjacent tumor tissues. Meanwhile, we detected the expression in esophageal cancer cells (EC9706, KYSE30, and TE-1) and normal esophageal cells (Het-1A). The result shows that HCP5 arises in all three cancer cells compared to the Het-1A cell (Figure 1(c)). In addition, after a single dose of radiation, the HCP5 level in KYSE30 and TE-1 cells are apparently elevated with the increase in time or dose (Figure 1(d,e)). All the expression profile results indicated that HCP5 is upregulated in esophageal cancer and is also lifted by radiation.
Figure 1.
The higher expression of lncRNA HCP5 is in esophageal cancer tissues. (a), The expression levels of HCP5 in esophageal cancer tissues and normal tissues were analyzed by TCGA database; (b), HCP5 expression in total pairs of esophageal cancer tissues and adjacent tissues was examined by RT-qPCR; (c), The levels of HCP5 were examined by RT-qPCR in Het-1A and esophageal cancer cells; (d), The expressions of HCP5 in KYSE30 and TE-1 cells were detected after a single 2 Gy dose of radiation; (e), The expressions of HCP5 in KYSE30 and TE-1 cells were detected after different dose of radiation. Data are presented as mean ± SD, n = 3. *P < 0.05, **P < 0.01, ***P < 0.001.
The higher expression of lncRNA HCP5 is in esophageal cancer tissues. (a), The expression levels of HCP5 in esophageal cancer tissues and normal tissues were analyzed by TCGA database; (b), HCP5 expression in total pairs of esophageal cancer tissues and adjacent tissues was examined by RT-qPCR; (c), The levels of HCP5 were examined by RT-qPCR in Het-1A and esophageal cancer cells; (d), The expressions of HCP5 in KYSE30 and TE-1 cells were detected after a single 2 Gy dose of radiation; (e), The expressions of HCP5 in KYSE30 and TE-1 cells were detected after different dose of radiation. Data are presented as mean ± SD, n = 3. *P < 0.05, **P < 0.01, ***P < 0.001.
Knockdown of HCP5 further inhibits esophageal cancer cells proliferation and promotes apoptosis combined with a single dose of radiation
We constructed a lentiviral shRNA to knockdown HCP5 expression in KYSE30 and TE-1 cells. As shown in Figure 2(a), the HCP5 level is obviously repressed after infecting with the lentiviral shRNA. Subsequently, we divided the cells for four groups (1. shNC + 0 Gy, 2. shHCP5 + 0 Gy, 3. shNC + 2 Gy, 4. shHCP5 + 2 Gy) to investigate whether knockdown of HCP5 could further inhibit the malignant behaviors of esophageal cancer cells combined with a single dose of radiation. ShNC or shHCP5 esophageal cancer cells were treated with a single 2 Gy dose of radiation on day 0. After 3 days, the CCK-8 assays showed that knockdown of HCP5 or 2 Gy radiation alone both suppressed the cell viability on KYSE30 and TE-1 cells, however, HCP5 knockdown plus 2 Gy radiation exhibited the strongest inhibitory effect compared to the other 3 groups (Figure 2(b)). Similarly, in Figure 2(c), it also reflected consistent results that the clonal proliferation of cells was the weakest in the combination therapy group. Moreover, Knockdown of HCP5 further promotes KYSE30 and TE-1 cell apoptosis combined with a single 2 Gy dose of radiation (Figure 2(d)). From the results of these trials, we can consider that HCP5 is associated with esophageal cancer radiotherapy.
Figure 2.
Knockdown of HCP5 further inhibits esophageal cancer cells proliferation and promotes apoptosis combined with a single dose of radiation. (a), The expression levels of HCP5 were detected after cells infected with lentiviral shHCP5; (b), The cell viability was detected by CCK-8 assay in KYSE30 and TE-1 cells; (c), The colony formation was examined in KYSE30 and TE-1 cells; (d), The apoptosis was examined in KYSE30 and TE-1 cells. Data are presented as mean ± SD, n = 5. * compared to the group of shNC + 0 Gy; *P < 0.05, **P < 0.01, ***P < 0.001; # compared to other group of shHCP5 + 2 Gy; #P < 0.05, ##P < 0.01.
Knockdown of HCP5 further inhibits esophageal cancer cells proliferation and promotes apoptosis combined with a single dose of radiation. (a), The expression levels of HCP5 were detected after cells infected with lentiviral shHCP5; (b), The cell viability was detected by CCK-8 assay in KYSE30 and TE-1 cells; (c), The colony formation was examined in KYSE30 and TE-1 cells; (d), The apoptosis was examined in KYSE30 and TE-1 cells. Data are presented as mean ± SD, n = 5. * compared to the group of shNC + 0 Gy; *P < 0.05, **P < 0.01, ***P < 0.001; # compared to other group of shHCP5 + 2 Gy; #P < 0.05, ##P < 0.01.
Knockdown HCP5 enhances the efficacy of radiotherapy for esophageal carcinoma
To clearly clarify whether knockdown HCP5 enhances the efficacy of radiotherapy for esophageal carcinoma, a single-hit, multi-target model that commonly and standardly evaluates the experimental irradiation fractionation was to apply. According to the model requirements, shNC or shHCP5 KYSE30 and TE-1 cells were exposed to the different radiotherapy doses (Figure 3(a,c)). As shown in Figure 3(b,d), the cellular survival curves of two esophageal cancer cells pointed that HCP5 repressed indeed elevates the radiosensitivity of esophageal carcinoma. The relative radiosensitizaion effects data (such as D0, Dq, N, and SF2) confirmed this sensibilization as well in Table 2. Thus, we can conclude that knockdown HCP5 enhances the efficacy of radiotherapy for esophageal carcinoma.
Figure 3.
Knockdown HCP5 enhances the efficacy of radiotherapy for esophageal carcinoma. (a) and (c), The colony formation was examined in KYSE30 and TE-1 cells with different dose of radiation; (b) and (d), The cellular survival curves of KYSE30 and TE-1 cells.
Table 2.
The relative radiosensitization effects in KYSE30 and TE-1
D0 (Gy)
Dq (Gy)
N
SF2 (%)
KYSE30
shNC
2.957 ± 0.113
1.881 ± 0.053
1.889 ± 0.024
73.9 ± 0.2
shHCP5
1.740 ± 0.102*
1.489 ± 0.047
1.354 ± 0.031*
59.2 ± 0.1*
TE-1
shNC
3.004 ± 0.149
0.751 ± 0.042
1.216 ± 0.062
59.6 ± 0.2
shHCP5
1.853 ± 0.124*
0.901 ± 0.113
1.688 ± 0.109*
52.1 ± 0.1*
Unpaired student t test. * P < 0.05.
The relative radiosensitization effects in KYSE30 and TE-1Unpaired student t test. * P < 0.05.Knockdown HCP5 enhances the efficacy of radiotherapy for esophageal carcinoma. (a) and (c), The colony formation was examined in KYSE30 and TE-1 cells with different dose of radiation; (b) and (d), The cellular survival curves of KYSE30 and TE-1 cells.
HCP5 functions by regulating miR-216a-3p/PDK1 axis
As to how HCP5 functions in esophageal carcinoma radiotherapy, we speculate that lncRNA HCP5 should sever a ceRNA participating in regulation. By analyzing an online database (http://starbase.sysu.edu.cn/), the latent binding site between HCP5 and miR-216a-3p is gained in Figure 4(a). Interestingly, we also found that the miR-216a-3p occurred a significant augment after KYSE30 and TE-1 cells knockdown of HCP5 (Figure 4(b)). Then, the miR-216a-3p mimic was synthesized to verify this interaction (Figure 4(c)). As shown in Figure 4(d), miR-216a-3p only affected the fluorescence intensity of wild-type HCP5 reporter but did not affect that of mutant-type. Also analyzing the target of miR-216a-3p, it indicates that miR-216a-3p could bind the 3ʹUTR of PDK1 (Figure 4(e)). The luciferase assays also confirmed that miR-216a-3p interacts with the 3ʹUTR of PDK1 (Figure 4(f)). Moreover, miR-216a-3p mimic both inhibits the expression of PDK1 on mRNA and protein level (Figure 4(g,h)). Therefore, HCP5 should be supposed to functions by regulating miR-216a-3p/PDK1 axis.
Figure 4.
HCP5 functions by regulating miR-216a-3p/PDK1 axis. (a), The binding site between HCP5 and miR-216a-3p; (b), The expression of miR-216a-3p in shHCP5 KYSE30 and TE-1 cells; (c), The expression of miR-216a-3p in KYSE30 and TE-1 cells with miR-216a-3p mimic; (d), The luciferase intensity in KYSE30 and TE-1 cells; (e), The binding site between 3ʹUTR of PDK1 and miR-216a-3p; (f), The luciferase intensity in KYSE30 and TE-1 cells; (g), The mRNA expression of PDK1 in shHCP5 KYSE30 and TE-1 cells; (h), The protein expression of PDK1 in KYSE30 and TE-1 cells. Data are presented as mean ± SD, n = 5. *P < 0.05, **P < 0.01, ***P < 0.001.
HCP5 functions by regulating miR-216a-3p/PDK1 axis. (a), The binding site between HCP5 and miR-216a-3p; (b), The expression of miR-216a-3p in shHCP5 KYSE30 and TE-1 cells; (c), The expression of miR-216a-3p in KYSE30 and TE-1 cells with miR-216a-3p mimic; (d), The luciferase intensity in KYSE30 and TE-1 cells; (e), The binding site between 3ʹUTR of PDK1 and miR-216a-3p; (f), The luciferase intensity in KYSE30 and TE-1 cells; (g), The mRNA expression of PDK1 in shHCP5 KYSE30 and TE-1 cells; (h), The protein expression of PDK1 in KYSE30 and TE-1 cells. Data are presented as mean ± SD, n = 5. *P < 0.05, **P < 0.01, ***P < 0.001.
Knockdown HCP5 modulates the miR-216a-3p/PDK1 axis to inhibit AKT activation
To prove HCP5 regulates the radiosensitivity of esophageal carcinoma by miR-216a-3p/PDK1 axis, the miR-216a-3p inhibitor was performed in rescue experiments (Figure 5(a)). Before the rescue experiments, we confirmed that knockdown HCP5 directly inhibits the protein expression of PDK1 (Figure 5(b)). Subsequently, all experiments were treated with a single 2 Gy dose of radiation. As shown in Figure 5(c), miR-216a-3p inhibitor weakened the inhibition effect of knockdown HCP5 on cell viability. In Figure 5(d), the colony numbers of shHCP5 with miR-216a-3p inhibitor group picked up compared to shHCP5 with inhibitor NC. Meanwhile, the previously high rate of shHCP5 cells apoptosis was also suppressed by miR-216a-3p inhibitor compared to inhibitor NC (Figure 5(e)). From the molecular point of view, these results should be attributed to the change of the AKT signaling activation (Figure 5(f)). Based on these results, we concluded that knockdown HCP5 modulates the miR-216a-3p/PDK1 axis to inhibit AKT activation.
Figure 5.
Knockdown HCP5 modulates the miR-216a-3p/PDK1 axis to inhibit AKT activation. (a), The expression of miR-216a-3p in KYSE30 and TE-1 cells with miR-216a-3p inhibitor; (b), The protein expression of PDK1 in shHCP5 KYSE30 and TE-1 cells; (c), The cell viability was detected by CCK-8 assay in KYSE30 and TE-1 cells; (d); The colony formation was examined in KYSE30 and TE-1 cells; (e), The apoptosis was examined in KYSE30 and TE-1 cells; (f), The activation AKT signaling in KYSE30 and TE-1 cells was examined by Western blot. Data are presented as mean ± SD, n = 5. * compared to the group of shNC + inhibitor NC; *P < 0.05, **P < 0.01; # compared to other group of shHCP5 + inhibitor NC; #P < 0.05.
Knockdown HCP5 modulates the miR-216a-3p/PDK1 axis to inhibit AKT activation. (a), The expression of miR-216a-3p in KYSE30 and TE-1 cells with miR-216a-3p inhibitor; (b), The protein expression of PDK1 in shHCP5 KYSE30 and TE-1 cells; (c), The cell viability was detected by CCK-8 assay in KYSE30 and TE-1 cells; (d); The colony formation was examined in KYSE30 and TE-1 cells; (e), The apoptosis was examined in KYSE30 and TE-1 cells; (f), The activation AKT signaling in KYSE30 and TE-1 cells was examined by Western blot. Data are presented as mean ± SD, n = 5. * compared to the group of shNC + inhibitor NC; *P < 0.05, **P < 0.01; # compared to other group of shHCP5 + inhibitor NC; #P < 0.05.
Discussion
Our study first proposed that lncRNA HCP5 is associated with the radiosensitivity of esophageal carcinoma and affected the esophageal cancer radiotherapy curative effect. Mechanistically, HCP5 restrains miR-216a-3p expression and miR-216a-3p inhibits the expression of PDK1. Furthermore, knockdown of HCP5 decreased the p-AKT level by miR-216a-3p/PDK1 axis to increase the radiosensitivity of esophageal cancer cells. In addition, the rescue experiments also indicated miR-216a-3p inhibitor weakened the inhibition effect of knockdown HCP5 on cells treated with radiotherapy. In all, our results concluded that HCP5 is involved in esophageal carcinoma radiotherapy and knockdown HCP5 enhances the radiosensitivity of esophageal carcinoma by modulating AKT signaling activation.Esophagectomy with radical lymphadenectomy is preferred for esophageal cancer treatment, notwithstanding, still a number of patients medically are inoperable to undergo surgery [1,22]. Due to the complication of dysphagia occurs with high-frequency in the advanced esophageal cancer patients, radiotherapy is the most appropriate for these patients [1,23]. It is beneficial for patients with esophageal cancer that enhance the radiosensitivity of esophageal cancer [23,24]. Therefore, excavating a novel target for elevating the radiotherapy response to esophageal cancer is imminent.To date, there are rare studies linked the HCP5 with cancer therapy. Based on our results, we first revealed that lncRNA HCP5 definitely participates in the response to radiotherapy for esophageal cancer. A series of radiosensitization effects data (such as D0, Dq, N, and SF2) give a shred of strong evidence that knockdown of HCP5 enhances the radiosensitivity of esophageal cancer. Moreover, it is showed that the AKT signaling, which closely associating with cancer radiotherapy, is affected by HCP5. For example, Wang et al. reported that lncRNA TUG1 could regulate the miR-144-3p/MET axis to induce the AKT activation, eventually rise a radiation resistance effect on esophageal cancer [25]. Other studies also indicated that no matter what the genes or lncRNAs involved in AKT signaling activation could influence cancer radiotherapy response [26-28]. Hence, our results are consistent with the common strategy of radiotherapy sensitization. In sum, lncRNA HCP5 is a key regulator of radiotherapy response in esophageal cancer.However, our work only focuses on the role of HCP5 in esophageal radiotherapy. The other cancer treatments, such as chemotherapy and immunotherapy, should be also affected by HCP5 repressed. It is generally known that AKT signaling is closely associated with chemotherapy and immunotherapy [29-31]. Once knockdown of lncRNA HCP5 reduced the phosphorylation level of AKT, the therapeutic effect evaluation of chemotherapy and immunotherapy usually get the difference. Meanwhile, the radiosensitivity of esophageal cancer involved pathway includes DNA damage and repair should also be investigated. The DNA damage level is a key factor in the radiosensitivity of esophageal cancer [32]. This theoretical knowledge inspired us to further investigate the cross-link between HCP5 and cancer treatments.It is possible that HCP5 may regulate the radiotherapy response to esophageal cancer in another way. In addition, the role of miR-216a-3p or PDK1 alone in esophageal cancer radiotherapy response is needed to conduct a study. However, our study has given a complete line of evidence supporting the knockdown of HCP5 enhance esophageal cancer radiosensitivity. Even so, other mechanisms should be also discussed in our next work.
Conclusion
In summary, our results indicate that HCP5 is involved in esophageal carcinoma radiotherapy and knockdown HCP5 enhances the radiosensitivity of esophageal carcinoma by modulating AKT signaling activation.