Long non-coding RNA myocardial infarction-associated transcript promotes 1-Methyl-4-phenylpyridinium ion-induced neuronal inflammation and oxidative stress in Parkinson's disease through regulating microRNA-221-3p/ transforming growth factor /nuclear factor E2-related factor 2 axis.

This study attempted to evaluate the role of long non-coding RNA myocardial infarction-associated transcript (LncRNA MIAT) in Parkinson's disease (PD). The mouse model was established through intraperitoneal injection with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), and in vitro model was induced by administrating cell with 1-Methyl-4-phenylpyridinium ion (MPP+). Rotarod test was conducted to evaluate the motor coordination of PD mice. In order to investigate the roles of LncRNA MIAT in neuronal inflammation and oxidative stress, MIAT shRNA (shMIAT) was transfected into MPP+-treated cells, and cell viability, cell apoptosis and oxidative stress response were evaluated. To evaluate the interactions between LncRNA MIAT and microRNA-221-3p (miR-221-3p)/TGF-β1/Nrf2, miR-221-3p mimic, miR-221-3p inhibitor, NC-inhibitor and transforming growth factor-β1 shRNA (shTGF-β1) were subsequently transfected into MPP+-treated cells. Dual-luciferase reporter gene assays were performed to determine the interaction of miR-221-3p with MIAT or TGFB receptor 1 (TGFBR1). The expressions of LncRNA MIAT, miR-221-3p, TGFBR1, transforming growth factor (TGF-β1) and nuclear factor E2-related factor 2 (Nrf2) were measured by quantitative reverse-transcription polymerase chain reaction (RT-qPCR) and immunoblotting. As a result, LncRNA MIAT was abundantly expressed in PD mice and cells, while downregulation of LncRNA MIAT promoted the survival of neurons, inhibited apoptosis and oxidative stress in neurons. LncRNA MIAT bound to miR-221-3p, and there was a negative correlation between miR-221-3p and LncRNA MIAT expression. In addition, miR-221-3p targeted TGFBR1 and suppressed TGF-β1 expression but increased Nrf2 expression. LncRNA MIAT promoted MPP+-induced neuronal injury in PD via regulating TGF-β1/Nrf2 axis through binding with miR-221-3p.

Introduction

Parkinson’s disease (PD) is the second most common progressive neurodegenerative disorder manifested as dopaminergic neurons loss in the substantia nigra pars compacta and depositions of Lewy bodies [1,2]. Its clinical features include static tremor, rigidity, bradykinesia and postural instability followed by non-motor complications, such as mood disorders, orthostatic hypotension and cognitive problems [3]. There has been 6.1 million PD patients in the world [4], and the prevalence was 1.06% in Chinese population over 60 years old and the incidence rates increased sharply every 10 years of age increment [5]. It has been recognized that dysfunction of mitochondria, impaired intracellular trafficking, neuroinflammation and oxidative stress are closely related to the development of PD [3]. In addition, various monogenic forms of PD and mutations in genes have been considered to be implicated in the incidence of PD [6,7]. Unfortunately, the mechanism of PD is not fully understood.

The LncRNAs are RNA molecules comprising more than 200 nucleotides that do not encode proteins [8]. Increasing studies have confirmed that LncRNA is involved in the occurrence and development of different diseases and transcriptional regulation [9,10]. LncRNA played an important regulatory role in central nervous system (CNS) diseases such as neurodegenerative PD [8]. LncRNA HOX transcript antisense RNA enhanced neuronal apoptosis and oxidative stress by regulating miR-874-5P/ATG10 axis, thus promoted? MPP+-induced neuronal damage in PD [11]. LncRNA brain-derived neurotrophic factor anti-sense was proven to provoke autophagy and apoptosis of SH-SY5Y cells, and aggravated MPTP-induced PD process, which was related to the ablation of miR-125b-5p [12]. Besides, LncRNA MIAT, as a member of the lncRNA family, also was involved in regulating central nervous. Inhibition of MIAT attenuated cerebral microvascular endothelial cell injury, promoted angiogenesis, and increased the number of surviving neurons by suppressing miR-204-5p [13]. However, the mechanism of MIAT regulating the progress of PD remains elusive.

Previous evidences supported that neuroinflammatory processes were essential during the development of PD, and inflammatory cytokines in cerebrospinal fluid might be potential biomarkers for diagnosing PD [14]. It was reported that TGFβ1 and TGFβ2 levels were increased in ventricular cerebrospinal fluid of PD [15], while upregulation of TGFβ1 was associated with dyskinesia caused by long-term L-dopa therapy [16]. In addition, Nrf2 is a redox-sensitive transcription factor in the cytoplasm that facilitates cells to adapt to oxidative stress and inflammation [17]. Recently, activation of Nrf2 signaling was proposed to alleviate the progression of neurodegeneration in PD [18]. The ability of Nrf2 to inhibit oxidative stress and neuroinflammation contributes to the prevention and treatment of PD [17].

MiR-221-3p is a member of miRNAs that are a class of non-coding RNAs post-transcriptionally regulating the expression of target genes. It has been reported that the aberrant miR-221-3p was considered as a biomarker of early PD [19]. Previous research has demonstrated that the HOX transcript antisense intergenic RNA (HOTAIR) lncRNA provoked autophagy of midbrain dopaminergic neurons in the substantia nigra compacta of PD patients through activation of neuronal pentraxin II via targeting miR-221-3p [20]. Besides, a study has confirmed that miR-221-3p may provide a novel and valid target for regulating neuroinflammation [21]. However, few studies have reported the relationship between miR-221-3p and TGF-β1/Nrf2 signaling in PD.

Herein, we hypothesized that LncRNA MIAT could promote neuronal inflammation and oxidative stress in PD by regulating TGF-β1/Nrf2 axis. Therefore, this study evaluated the effect of LncRNA MIAT on MPP+-induced neuronal inflammation and oxidative stress in PD, and further uncovered the underlying mechanism.

Methods

Animals and induction of PD mouse models

Twelve male C57BL/6 mice (25–30 g, aged 7 weeks) were bought from Nanjing Biomedical Research Institute of Nanjing University (Nanjing, China), and kept at 23 ± 2°C and 60% humidity with free food and drinking water. The experimental protocols were approved by the Guide for Animal Research Ethics Committee of The Second Hospital of Dalian Medical University and conformed to Guide to the Care and Use of Laboratory Animals [22].

Mice were equally assigned to two groups (n = 6 in each group) including PD group and sham group. The PD model was established by intraperitoneal injection of 30 mg/kg MPTP (CAS No. 28289–54-5, Haorui Chemicals, Shanghai, China) once a day for 7 days [20]. Mice in the sham group were intraperitoneally injected with equal amount of normal saline. After injection, behavior performance was assessed via rotarod test. Animals were then anesthetized by intraperitoneal injection of chloral hydrate (400 mg/kg) and excised brain was immediately stored in liquid nitrogen.

Rotarod test

The motor coordination of PD mice was measured by the Rotarod test [23]. Mice were acclimatized to the rotarod before experimental testing and were subjected to the rotarod with a diameter of 30 mm at a speed from 5 to 10 r/min in 300 s prior to MPTP treatment. After administration, the rotarod test was performed at 5–30 r/min within 300 s. Mice were subjected to 3 consecutive tests every day, and the longest time spent by each mouse on the rod was recorded.

Cell culture and induction of PD cell models

The MN9D dopaminergic neuronal cells were purchased from the Cell Bank of the Chinese Academy of Science (Shanghai, China). Cells were maintained in high-glucose DMEM medium (Gibco, USA) containing 10% fetal bovine serum (FBS, Cibco, USA), 100 U/mL of penicillin (Invitrogen, USA) and 100 μg/mL of streptomycin (Invitrogen, USA) at 37°C with 5% CO2. The PD cell model was established by stimulating MN9D cells with 100 μM MPP+ (Sigma, USA) for 24 h [20].

Cell transfection

To inhibit the expression of LncRNA MIAT, shMIAT was transfected into MPP+-treated cells and a shNC served as a negative control. The pcDNA3.1 plasmid (YouBio, China) was obtained and used for miR-221-3p overexpression. MPP+-treated cells were subsequently transfected with miR-221-3p-inhibitor, NC-inhibitor and shTGF-β1 using Lipofectamine 2000 (Invitrogen, USA) as recommended by the manufactures’ instruction. After 48 h posttransfection, cells were collected for further assessments [24].

Cell viability

The cell viability was detected by MTT assay in MPP+-treated cells or shMIAT transfected cells. Cells (1 × 104 cells/mL) were settled in 96-well plates at 37°C for 24 h. Afterward, 10 μL of 5 mg/mL MTT solution (Biolaibo Technology Co., LTD, Beijing, China) was added to each well and incubated for 2 h, followed by adding 100 μL of DMSO [24]. The absorbance at 595 nm was measured.

Cell apoptosis

Cell apoptosis was assessed by use of an Annexin V-FITC/propidium iodide (PI) kit (Zoman Biotechnology Co., Ltd, China) following the protocols [25]. Cells (3 × 105 cells/well) were settled in 6-well plates and treated with MPP+ for 48 h. Next, cells were rinsed twice with PBS at 4°C, followed by incubation with 5 µL Annexin V-FITC and 5 µL PI for 15 min at 23°C in the dark. Apoptotic cells were quantified using a CytoFlex flow cytometer (Beckman Coulter) equipped with CytExpert 2.0 software.

Enzyme-Linked Immunosorbent Assay (ELISA)

MPP+-treated cells were collected, washed twice by cold PBS, and centrifuged for 10 min at 1000 r/min at 4°C. After lysis for 5 min, the supernatant was collected and the levels of superoxide dismutase (SOD), glutathione (GSH) and malondialdehyde (MDA) were measured using ELISA kit recommended by the protocols. After color development, the absorbance at 450 nm was measured.

LDH assessment

MPP+-treated cells (5 × 103 cells/well) were placed in 96-well plates, followed by transfection with shMIAT. Then, supernatants were collected, and the LDH activity was assessed by use of a LDH-Cytotoxicity Assay Kit (Abnova, China) recommended by the protocols. The absorbance was read on a microplate reader (Thermo Fisher), which was calculated as a ratio of 490/680 nm and normalized to the controls [26].

ROS assessment

MPP+-treated cells (5 × 103 cells/well) were placed in 96-well plates, followed by transfection with shMIAT. Subsequently, ROS activity was measured by a ROS Activity Assay Kit (Abnova, China) as recommended by the manufacturers. The fluorescence was assessed on a microplate reader at 520 nm and normalized to the controls [26].

Dual-luciferase reporter gene assay

MN9D cells (1 × 105 cells/well) were settled in 96-well plates a day prior to transfection. A luciferase reporter plasmid containing wild-type (WT) and mutant (MUT) 3ʹ UTRs of MIAT or TGFBR1 were constructed basing on the binding sites of miR-221-3p, which were co-transfected with miR-221-3p-mimic or NC-mimic by Lipofectamine 2000. At 24 h posttransfection, a DLR assay system was used to detect luciferase activity following the manufacturer’s protocols [27].

RT-qPCR

Total RNA was obtained using TRAzol (Topsun Science and Technology Co., Ltd, China) as recommended by the manufacturers. The TaqMan miRNA reverse transcription kit (Applied Biosystems) was employed for synthesis of cDNA from 5 ng of total RNA. The expression of miR-221-3p was determined by a miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems) [28]. The non-miRNA genes were assessed using SYBR Green master mix (Applied Biosystems, Foster City, CA) and ABI 7500 sequence detection system as recommended by the manufactures [29]. Real-time PCR was conducted, followed by the thermal profile at 95°C for 10 min, 40 cycles of 95°C for 15 s, 61°C for 40 s and 72°C for 40 s. Final extension step was at 72°C for 5 min. The expression of miRNA was normalized to U6 expression and β-actin served as an internal control for gene expression. The expression of genes and miRNA was quantified using 2−ΔΔCt method [30]. The primer sequences for PCR were listed in Table 1.

Table 1.

The primer sequences for PCR

	Sequences (5ʹ-3ʹ)
	Forward	Reverse
LncRNA MIAT	ACCAGCAACGGAGTAGTGTG	CACAGCCCGGAATGAAGAGT
miR-221-3p	GTCTGCTGGGTTTCGTCGTA	GTATCCAGTGCGTGTCGTGG
TGFBR1	GAACTGTTTTGATTGGCATC	AAGAAGGGACCTACACTATTT
TGF-β1	GCTTCAGACAGAAACTCACT	GAACACTACTACATGCCATTAT
Nrf2	TGCCCCTCATCAGGCCCAGT	GCTCGGCTGGGACTCGTGTT
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
β-actin	CATCCGTAAAGACCTCTAGCCAAC	ATGGAGCCACCGATCCACA

Western blot analysis

The Western blot analysis was performed as previously reported work [31]. Total proteins were isolated from brain tissues and cells with RIPA lysis buffer, and protein concentration was measured using a BCA protein assay kit. Subsequently, 40 µg of protein was separated by 10% SDS-PAGE, transferred to polyvinylidene difluoride membranes and blocked with 5% nonfat milk, followed by incubation with primary antibodies against Cleaved Caspase-3 (ab32351, 1:5000), Bax (ab32503, 1:2000), Bcl-2 (ab182858, 1:2000), TGFBR1 (ab121024, 1:1000), TGF-β1 (ab215715, 1:1000), Nrf2 (ab137550, 1:500) purchased from Abcam overnight at 4°C. Next, the membranes were incubated with HRP-conjugated secondary antibody (ab97051, 1:2000) for 2 h at room temperature. The blots were detected with BeyoECL Plus kit (Beyotime, Jiangsu, China), and the protein expression was quantified by Quantity One image analysis software (Bio-Rad Laboratories).

Statistical analysis

Experiments were conducted at least three biologically repeated experiments with three technical replicates per sample. Data analysis were performed using SPSS software (Version 17.0, SPSS Inc., Chicago, USA) and presented as mean ± SD. Pearson R tests or Spearman tests were used to analyze the correlation between LncRNA MIAT and miR-221-3p. Data between two groups were tested using the t-test. Differences among multiple groups were compared using one-way ANOVA followed by Tukey’s post-hoc test. p < 0.05 was considered as statistically significant.

Results

LncRNA MIAT was highly expressed in PD mice and cells

To investigate the motor ability and the expression of LncRNA MIAT in PD, a mouse PD model was established by intraperitoneal injection of 30 mg/kg MPTP. Afterward, the motor ability was assessed, and the expression of LncRNA MIAT in brain tissue of mice was determined using PCR. In PD mice, the rotarod test was implemented to assess motor functions. Figure 1(a) displayed that there was a less time in MPTP treated mice than normal mice (p < 0.001). The relative expression of LncRNA MIAT was visibly elevated by MPTP treatment compared to the sham (p < 0.001) (Figure 1(b)). Furthermore, cell viability in MPP+-treated cells was remarkably inhibited compared to the control (p < 0.001) (Figure 1(c)). Meanwhile, MPP+ treatment induced a significant increase in LncRNA MIAT expression compared with that in control (p < 0.001) (Figure 1(d)). Collectively, LncRNA MIAT was highly expressed in PD mice and cells.

Figure 1.

LncRNA MIAT was highly expressed in PD mice and cells. a, Rota rod test was performed to evaluate motor abilities in MPTP-treated mice. b, The relative expression of LncRNA MIAT was evaluated in PD mice by RT-qPCR. c, Cell viability was measured by MTT assay in MPP+-treated cells. d, The relative expression of LncRNA MIAT was evaluated in MPP+-treated cells by RT-qPCR. Each experiment had 3 replicates. ***p < 0.001, compared to the sham or control.

Down-regulation of LncRNA MIAT inhibited apoptosis of neurons

In order to evaluate the inhibitory effect of LncRNA MIAT on neurons, subsequently, shMIAT was transfected into MPP+-treated cells, and apoptosis of neurons was assessed. Figure 2(a) displayed that LncRNA MIAT level was patently up-regulated in MPP+-treated cells (p < 0.001), while LncRNA MIAT was significantly down-regulated by shMIAT compared to MPP+-treated cells (p < 0.001). In addition, MPP+ stimulation remarkably inhibited cell viability compared to the control (p < 0.001), which was visibly reversed by shMIAT transfection (p < 0.001) (Figure 2(b)). There was a significant elevation in apoptotic cells after MPP+ treatment than the control (p < 0.001), which was suppressed by shMIAT (p < 0.01) (Figure 2(c)). Further immunoblotting assay demonstrated MPP+ treatment increased the expression of Cleaved Caspase-3 and Bax/Bcl-2 (p < 0.001), while which was remarkably blocked by transfection with shMIAT (p < 0.05) (Figure 2(d)). Taken together, down-regulation of LncRNA MIAT promoted MPP+ -induced survival and inhibited apoptosis of neurons.

Figure 2.

Down-regulation of LncRNA MIAT promoted MPP+ -induced survival and inhibited apoptosis of neurons. a, The relative expression of LncRNA MIAT was assessed in MPP+ treated cells following shMIAT transfection. b, Cell viability was evaluated in MPP+-treated cells following shMIAT transfection. c, Cell apoptosis was measured in MPP+-treated cells following shMIAT transfection. d, Protein levels of Cleaved Caspase-3, Bax and Bcl-2 were determined by immunoblotting in MPP+-treated cells following shMIAT transfection. Each experiment had 3 replicates. ***p < 0.001, compared to the sham or control. &p < 0.05, &&p < 0.01 and &&&p < 0.001, compared to MPP+ treated cells.

Down-regulation of LncRNA MIAT inhibited MPP+ – induced oxidative stress in neurons

Furthermore, shMIAT was transfected into MPP+-treated cells to evaluate the effect of LncRNA MIAT on oxidative stress in neurons. Figure 3(a) displayed that MPP+ – induced a significant increase in LDH activity in neurons than control (p < 0.001), which was blocked by transfection with shMIAT (p < 0.001). Besides, MPP+ treatment remarkably enhanced ROS generation compared to control (p < 0.001), while shMIAT visibly reversed this effect (p < 0.01) (Figure 3(b)). The production of SOD and GSH was significantly attenuated but the level of MDA was elevated following MPP+ stimuli (p < 0.01 or p < 0.001). Meanwhile, shMIAT transfection promoted the production of SOD and GSH but inhibited MDA in MPP+-treated cells (p < 0.05 or p < 0.01) (Figure 3(c)). Together, the down-regulation of LncRNA MIAT inhibited MPP+ – induced oxidative stress in neurons.

Figure 3.

Downregulation of LncRNA MIAT repressed oxidative stress in MPP+ – treated neurons. a, The activity of LDH was assessed after MPP+ stimuli and shMIAT transfection in neurons. b, The ROS generation was evaluated after MPP+ stimuli and shMIAT transfection in neurons. c, The levels of SOD, GSH and MDA were measured after MPP+ treatment and shMIAT transfection in neurons. Each experiment had 3 replicates. **p < 0.01, ***p < 0.001, compared to the sham or control. &p < 0.05, &&p < 0.01, compared to MPP+ treated neurons.

LncRNA MIAT binded to miR-221-3p

In order to know whether there is an interaction between LncRNA MIAT and miR-221-3p in PD, a dual-luciferase reporter gene assay was conducted. MiR-221-3p level was patently repressed following MPTP or MPP+ challenge in mice (p < 0.001) (Figure 4(a)), and there was a negative correlation between miR-221-3p and LncRNA MIAT (r = −0.666, p = 0.048) (Figure 4(b)). Furthermore, the predicted sequences of binding sites between miR-221-3p and 3ʹ-UTR LncRNA MIAT were UUACAUCG and AAUGUAGC (Figure 4(c)). The luciferase activity was inhibited following co-transfection with miR-221-3p mimic and WT-LncRNA MIAT-3ʹUTR compared to NC mimics (p < 0.01), while no statistical significance in luciferase activity change was visualized after cells were transfected with miR-221-3p mimic and MUT-LncRNA MIAT-3ʹUTR (Figure 4(d)). In addition, miR-221-3p expression was also suppressed by shMIAT compared to shNC (p < 0.01) (Figure 4(e)). Collectively, miR-221-3p targeted LncRNA MIAT.

Figure 4.

LncRNA MIAT was a target of miR-221-3p. a, The relative expression of miR-221-3p was evaluated post MPTP or MPP+ challenge. b, Correlation between miR-221-3p expression and LncRNA MIAT expression was identified using Spearman analysis in a mouse model. c, The binding sites of miR-221-3p and LncRNA MIAT were predicted by ENCORI. d, The luciferase activity was determined by dual-luciferase reporter gene assay. E, After transfection with shMIAT, the expression of miR-221-3p in cells was quantified. Each experiment had 3 replicates. **p < 0.01, ***p < 0.001, compared to the sham, NC mimics or shNC.

MiR-221-3p targeted TGFBR1 and regulated TGF-β1/Nrf2 pathway

Afterward, the relationships between miR-221-3p and TGFBR1, as well as TGF-β1/Nrf2 axis were further investigated in this study. The levels of TGFBR1, TGF-β1 and Nrf2 were determined in PD mice or cells, and the results in Figure 5(a) unveiled that MPTP or MPP+ induced significant increases in TGFBR1 and TGF-β1, and a reduction in Nrf2 than the sham (p < 0.001). Immunoblotting showed that MPTP or MPP+ remarkably up-regulated TGFBR1 and TGF-β1 expression but down-regulated Nrf2 expression compared to the sham (p < 0.001) (Figure 5(b)). TGFBR1 was a target of miR-221-3p and the luciferase activity was decreased following co-transfection with miR-221-3p mimic and WT-TGFBR1 3ʹUTR compared to NC mimics (p < 0.05) (Figure 5(c-d)). Furthermore, miR-221-3p inhibitor visibly increased levels of TGFBR1 and TGF-β1, while Nrf2 expression was attenuated compared to NC-inhibitor (p < 0.001 or p < 0.01) (Figure 5(e)). As displayed in Figure 5(f-g), transfection with shTGF-β1 alleviated the effect of miR-221-3p inhibitor on Nrf2 expression (p < 0.05). In addition, shMIAT repressed TGFBR1 and TGF-β1 expression, but increased Nrf2 level (p < 0.001). However, miR-221-3p inhibitor significantly blocked these processes (p < 0.001) (Figure 5(h-i)). These indicated that miR-221-3p targeted TGFBR1 and regulated TGF-β1/Nrf2 pathway.

Figure 5.

MiR-221-3p targeted TGFBR1 and suppressed TGF-β1/ Nrf2 pathway. a, The levels of TGFBR1, TGF-β1 and Nrf2 were measured in PD mice or cells by RT-PCR. b, The expression of TGFBR1, TGF-β1 and Nrf2 were determined in PD mice or cells by Western blot analysis. c, The binding sites of miR-221-3p and TGFBR1 were predicted by ENCORI. d, The luciferase activity was assessed by dual-luciferase reporter assay. e, Protein levels of TGFBR1, TGF-β1 and Nrf2 were quantified in cells post miR-221-3p inhibitor transfection. f-g, The levels of Nrf2 in cells were quantified by RT-PCR and Western blotting following transfection with miR-221-3p inhibitor and shTGF-β1. h-i, The levels of TGFBR1, TGF-β1 and Nrf2 were quantified by RT-PCR and Western blotting after transfecting cells with miR-221-3p inhibitor and shMIAT. Each experiment had 3 replicates. *p < 0.05, **p < 0.01, ***p < 0.001, compared to the sham, NC mimics, NC inhibitor, or NC inhibitor + shNC. &p < 0.05, &&&p < 0.001, compared to NC inhibitor + shTGF-β1 or NC inhibitor + shMIAT.

Discussion

Parkinson’s disease is a complex neurodegenerative disorder affecting the physical and mental health of patients. PD can be simulated by administration of MPTP and MPP+ to mice and neuronal cells, respectively [32,33]. Therefore, MPTP and MPP+ were used to construct PD models in this study. Subsequently, inhibition of LncRNA MIAT was performed by transfection of shMIAT into MPP+ -treated cells to evaluate the effects of LncRNA MIAT on survival or oxidative stress in neurons. LncRNA MIAT and TGFBR1 were predicted to be target genes of miR-221-3p. Followingly, TGF-β1 and Nrf2 expressions were evaluated.

Extensive studies have demonstrated that LncRNA MIAT was abundant in diverse diseases including breast cancer, melanoma and non‑small cell lung cancer, while silencing LncRNA MIAT suppressed cancer cell proliferation, migration and invasion [34-36]. It has been identified that the overexpression of MIAT significantly promoted cell apoptosis through regulating miRNA-379 and contributed to the diabetic nerve injury [37]. LncRNA MIAT was proven to promote oxidative stress in hypoxic pulmonary hypertension or cardiac injury, but inhibition of LncRNA MIAT attenuated oxidative stress [38,39]. LncRNA-MIAT was abnormally expressed in ischemic stroke and induced more neural cell autophagy and cell apoptosis [40]. Furthermore, a recent study investigated the role of LncRNA-MIAT in PD using SHSY5Y cells and a mouse model, and the results revealed that LncRNA-MIAT was implicated in the regulation of neural function during the progression of PD [41]. Consistently, this study displayed that lncRNA MIAT was aberrantly expressed in MPTP-induced PD mice. Meanwhile, inhibition of LncRNA MIAT promoted MPP+ -induced survival, suppressed apoptosis and oxidative stress in neurons.

A meta-analysis revealed that miR-221-3p was differentially expressed in PD patients and might provide a biomarker for PD diagnosis [42]. The expression of LncRNA GAS5 was elevated in hypoxia cell after middle cerebral artery occlusion, but miR-221 was downregulated, and LncRNA GAS5-induced neurons death by inhibiting miRNA-221 to promote apoptosis and increasing expression of p53-upregulated apoptosis modulator [43]. Previous investigation showed miR-221 level is decreased in the brain of PD mice, whereas excessive miR-221 exerted a protective effect against MPP+-induced dopaminergic cell death [44]. Recently, a study demonstrated that miR-221-3p was distinctly decreased in MPTP treated mice or MPP+-treated cells, while miR-221-3 targeted the HOX transcript antisense intergenic RNA (HOTAIR) and downregulated its expression, which repressed dopaminergic neurons autophagy and protected dopaminergic neurons in PD mice [20]. In current study, miR-221-3p expression was inhibited following MPTP challenge in mice, and a genitive correlation between miR-221-3p and LncRNA MIAT was observed. In addition, inhibition of LncRNA MIAT upregulated miR-221-3p level, indicating that LncRNA MIAT promoted MPP+-induced neuronal injury in PD by sponging miR-221-3p.

It was reported that increased inflammatory response was implicated in neurodegenerative disorders, including Alzheimer’s disease, PD and amyotrophic lateral sclerosis, and a meta-analysis demonstrated that the expression of IL-1β, IL-6, and TGF-β were upregulated in PD [45]. Transcriptional network and upstream regulatory factor analysis indicated that TGFβ1 pathway was essential to the pathogenic mechanism of long-term L-Dopa therapy caused dyskinesia in PD patients [16]. There was evidence supporting that TGFβ1 was a key factor involved in the activation of microglia, which led to PD [46]. Besides, a study has revealed that the levels of Nrf2, polo-like kinase 2 and phosphorylated glycogen synthase kinase 3β were enhanced by administration of protocatechuic aldehyde in PD, which protected neurons from apoptosis and injury [47]. Moreover, activation of Nrf2 pathway was proposed to be considered as a promising therapeutic strategy for alleviating neurodegeneration progression of PD [18]. This study unveiled that the levels of TGFBR1 and TGF-β1 were upregulated but Nrf2 was downregulated in PD mice model. Inhibition of LncRNA MIAT suppressed the expression of TGFBR1 and TGF-β1 but increased Nrf2 expression, which was reversed by inhibiting miR-221-3p. These findings indicated that LncRNA MIAT aggravated neuronal injury in PD via targeting miR-221-3p/TGF-β1/Nrf2 axis.

Conclusion

In summary, this study demonstrated that downregulation of LncRNA MIAT alleviated neuronal inflammation and oxidative stress in PD via targeting miR-221-3p/TGF-β1/Nrf2 axis and providing a potential target for PD treatment.