Co-treatment with miR-21-5p inhibitor and Aurora kinase inhibitor reversine suppresses breast cancer progression by targeting sprouty RTK signaling antagonist 2.

Numerous studies have reported the regulatory effects of miR-21-5p and reversine in human breast cancer (HBC). However, the mechanism of reversine and miR-21-5p has not been fully investigated in HBC. The aim of the current study was to assess the mechanism of action of reversine, with or without miR-21-5p, in HBC progression. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and Western blot results confirmed the upregulation of miR-21-5p and downregulation of sprouty RTK signaling antagonist 2 (SPRY2) in HBC. Bioinformatics analysis and luciferase assay identified the correlation between miR-21-5p and SPRY2. Cell function experiment results indicated a decrease in migration, proliferation, and invasion of HBC cells treated with miR-21-5p inhibitor and reversine; however, an increase in apoptosis was observed in these cells. Apoptotic ability was more enhanced and migration, proliferation, and invasion were more impaired in HBC cells treated with both miR-21-5p inhibitor and reversine than in those treated individually with either inhibitors. SPRY2, downstream of miR-21-5p, participated in HBC progression with reversine. Overall, our study proved that combining the miR-21-5p inhibitor with reversine produced a synergistic effect by regulating SPRY2, thereby limiting HBC progression. This knowledge might offer insights into the clinical therapy of HBC.

Introduction

Human breast cancer (HBC) is prevalent among women and is responsible for the high rate of mortality in women [1]. Previous studies have suggested that HBC exhibits strong invasive and metastatic properties, and statistics has predicted that a vast proportion of patients with early-stage HBC will be diagnosed with metastatic carcinoma in future [2-4]. In recent years, physicians have employed mastectomy, radiotherapy, and chemotherapy to mitigate the symptoms of HBC, and these methods have improved the survival rates of patients with BC [5,6]. Nonetheless, the pathological risk of HBC recurrence – despite undergoing these treatments – remains high, and resistance to the existing drugs further worsens the prognosis of HBC. Therefore, exploration of new methods for HBC therapy is imperative.

Belonging to the serine/threonine kinase family, Aurora kinases facilitate the proliferation of cells; three forms of Aurora kinases (A, B, and C) have been found in mammals. Several studies have demonstrated the mitotic roles of Aurora kinases A and B in cell division [7,8]. In one study, Aurora kinase A was found to regulate cell cycle by modulating the cyclin B/cyclin dependent kinase 1 (CDK1) whereas Aurora kinase B was found to influence chromosomal arrangements by interacting with inner centromere protein (INCENP), survivin, and borealin [9-11]. In another study, testis-specific Aurora kinase C was found to be associated with cell proliferation and differentiation [12]. The three Aurora kinases have also been demonstrated to be involved in the carcinogenesis of multiple types of cancer and are regarded as promising cancer therapeutic targets [13].

Reversine is one of the most effective inhibitors of Aurora kinases and has been explored thoroughly in the recent years. It is a purine derivative that can induce murine myoblasts, thus dedifferentiating them into multipotent myoprogenitor cells [14]. The effect of reversine on pluripotency has previously been investigated and applied to the clinical study of regenerative medicine [15,16]. The inhibitory effect of reversine on cancer progression has also been studied. According to the results of several cancer studies, reversine can suppress the development of cancer [17-20]. In addition, some researchers have reported reversine to elicit cell cycle arrest and cell apoptosis by suppressing the activity of serial kinases, such as Aurora kinase A, Aurora kinase B, Janus kinase 2 (JAK2), and SRC [18]. Recent studies have further confirmed that reversine can influence HBC cells [21,22]. In short, the findings indicate that reversine can serve as a useful agent for HBC therapy.

Furthermore, accumulating evidence has illustrated the critical roles of microRNAs in cancer progression, such as their action as a tumor suppressor or promoter in cells [23-25]. Additionally, microRNAs have been reported as therapeutic targets for cancer in clinical intervention. One of the oncogenic miRNAs, miR-21-5p, is overexpressed in several cancer types and contributes to the growth, migration, and apoptosis of cancer cells [26,27]. Published literature has revealed the effect of miRNAs on HBC tumorigenesis. For instance, miR-21-5p could enhance the spread of HBC by targeting cancer suppressive genes, such as leucine zipper transcription factor like 1 (LZTFL1), programmed cell death 4 (PDCD4), and tropomyosin 1 (TPM1) [28]. This miRNA was also found to have partial suppressive effects on cancer development [29]. Although the anti-tumor capacities of reversine and miR-21-5p inhibitor have been determined separately, only a few studies have applied both the molecules simultaneously to HBC cells.

The aim of the current study was to explore the synergistic effect and mechanism of action of reversine and miR-21-5p inhibitor in HBC carcinogenesis. By elucidating the mechanisms by which reversine participates in the miR-21-5p-mediated regulation of sprouty RTK signaling antagonist 2 (SPRY2) and the effect of the same on HBC cell viability, proliferation, apoptosis, migration, invasion, and in-vivo growth, we aim to further clarify the anti-tumor function of reversine and miR-21-5p in HBC. Regardless of the outcome of this study, our findings might provide new clues and strategies for the clinical therapy of HBC.

Materials and methods

Clinical sample collection

We recruited 36 patients with HBC, who had undergone tumor excision in our hospital. We collected tumor tissues along with adjacent normal breast tissues from them for further study. Table 1 shows the clinical features of all 36 participants. All donors signed the written consent form, and the procedure was approved by the ethics committee of our hospital.

Table 1.

Clinical characteristics of 36 cases of breast cancer patients

characteristics	Total = 36	Percentage (%)
Age(years)
≤50	16	44.4%
>50	20	55.6%
Menstrual status
Premenopausal	14	38.9%
Postmenopausal	22	61.1%
Cancer site
Left breast	17	47.2%
Right breast	19	52.8%
Tumor diameter(cm)
≤2	21	58.3%
>2	15	41.7%
TNM stage
0-I	6	16.7%
II	10	27.8%
III	18	50.0%
IV	2	5.5%
ER status
Positive	21	58.3%
Negative	15	41.7%
PR status
Positive	17	47.2%
Negative	19	52.8%
HER-2 status
Positive	6	16.7%
Negative	30	83.3%
Ki67 status
Low (<14%)	20	55.6%
High (≥14%)	16	44.4%
Lymph nodes status
Positive	13	36.1%
Negative	23	63.9%

Cell culture

The cell lines purchased from the American Type Culture Collection (USA) included HBC cell lines (SKBr-3, MCF-7, MDA-MB-231, and BT474) and the normal breast cell line (MCF-10A). Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 U/mL penicillin was added to SKBr-3 and MDA-MB-231 cell lines. A mixture containing penicillin (100 U/mL), streptomycin (100 µg/mL), and FBS (10%) was added to Roswell Park Memorial Institute 1640 (RPMI-1640) medium (Gibco, USA) before it was introduced to the MCF-7 and BT474 cell lines. All cells were incubated at 37°C and 5% CO2.

Cell transfection and treatment

For reversine treatment, two breast cancer cell lines (1 × 106 MDA-MB-231 and MCF-7 cells) were added to 6-well plates. They were subsequently cultured and incubated overnight in air containing 5% CO2 at 37°C. The medium containing the culture was then replaced with another medium containing a different reversine concentration. After being primed for 24 or 48 h, the cells were harvested for further assays. The two cell lines, which were previously seeded into 6-well plates for 24 h, were transfected with miR-21-5p inhibitor (100 nM, RiboBio Co., Ltd., China) or a negative control (100 nM, RiboBio Co., Ltd.) using Lipofectamine 2000 Transfection Reagent (Invitrogen, USA). After 6 h, the medium was pipetted out, and fresh medium was added. After a transfection period of 48 h, the transfected cells were harvested and used for subsequent assays [30].

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

TRIzol reagent (Invitrogen, USA) was used to remove all RNA from the cells. This was followed by quantification of the extracted RNA by NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) according to the manufacturer’s instruction. Next, 2 μg of RNA was reverse transcribed to produce cDNA using the PrimeScript RT reagent Kit (Takara, Japan). To evaluate the expression of miR-21-5p and SPRY2, the SYBR Premix Ex Taq II Kit (Takara, Japan) was used. An Applied Biosystems Thermal Cycler was utilized to perform the RT-qPCR reactions. Subsequently, relative expression levels were computed using the 2−ΔΔCT method [31], and small RNA U6 (U6) and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) were used as reference genes. Table 2 lists the primer sequences.

Table 2.

The primer sequences for RT-qPCR

GENE	Primer sequences (5ʹ-3ʹ)
miR-21-5p	Forward: ACACTCCAGCTGGGTAGCTTATCAGACTGA
	Reverse: TGGTGCGTGGAGTCG
U6	Forward: CTCGCTTCGGCAGCACA
	Reverse: AACGCTTCACGAATTTGCGT
SPRY2	Forward: GATTGCTCGGAAGTTGGTCTReverse: GGTCACTCCAGCAGGCTTAG
GAPDH	Forward: ATCAAGAAGGTGGTGAAGCAGGReverse: GTCATACCAGGAAATGAGC

Cell counting kit-8 (CCK-8) assay

CCK-8, an assay kit produced by GLPBIO (United States), was used to perform cell viability examinations based on the manufacturer’s guidelines. Cells were first treated with the miR-21-5p suppressor and/or reversine. They were then seeded into 96-well plates at a density of 3 × 103 cells/well. After incubating the cells for different durations (24, 48, and 72 h) in an atmosphere containing 5% CO2 at 37°C, the CCK-8 reagent was added to the 96-well plate and incubated for another 2 h. A microplate reader (Bio-Rad, USA) was used to read the absorbance of the sample at 450 nm.

Bromodeoxyuridine (BrdU) assay

The proliferation capacity of MCF-7 and MDA-MB-231 cells was assessed using the CytoSelect BrdU Cell Proliferation ELISA Kit (Abcam, USA), according to the manufacturer’s instructions. The treated cells (2 × 105) were added to 96-well plates, followed by the addition of 20 μL of diluted 1X BrdU labeling solution to each cell well. After a 2-h incubation period, the culture medium was changed and replaced with 200 μL of the fixing solution. The mixture was then incubated at 20–22°C for 30 min. The plates were cleaned before the cells were incubated with diluted anti-BrdU monoclonal antibody solution (100 μL) for 1 h and with diluted peroxidase goat anti-mouse IgG conjugate (100 μL) at 20–22°C for 30 min. Thereafter, 100 μL of tetramethylbenzidine (TMB) substrate solution was added, and the cells were incubated at 20–22°C for another 30 min. Absorbance was measured at 450 nm [32].

Flow cytometry assay

Annexin V-FITC Apoptosis Detection kit (Abcam, UK) was used to analyze the apoptosis of MCF-7 and MDA-MB-231 cells according to the manufacturer’s instructions. Briefly, 1 × 106 cells/mL were collected in 500 μL binding buffer, and stained using 10 μL of Annexin V-fluorescein isothiocyanate (FITC) and 10 μL of propidium iodide (PI) at 25°C for 15 min. Cell apoptosis rate was immediately detected using a FACSCalibur flow cytometer (BD Biosciences, USA) [33].

Wound healing assay

After seeding them into 12-well plates, the cells were incubated till they reached 90% confluence. Next, the cell monolayer was scratched using a sterile pipette tip, and floating dead cells were removed with PBS. The cells were then cultured in serum-free medium in air containing 5% CO2 at 37°C. Images at 0 h and 24 h were captured using an inverted microscope [34].

Transwell invasion assay

Matrigel (Corning, USA) was thawed and diluted to 0.4 mg/mL in RPMI-1640 medium. It was then added to the top chamber of the transwell plates (30 μL/chamber) and incubated for 3 h at 37°C. Next, the treated cells were digested and resuspended in a medium containing 1% fetal bovine serum. Cell density was adjusted to 200 × 103 cells/mL. The suspended cells (200 μL) were subsequently removed and added to the top chamber of each well. Next, 10% serum-supplemented medium (600 μL) was used as a chemoattractant and added to the 24-well bottom chamber. After 48 h, the non-invading cells at the top of the membrane were removed, and the cells attached to the underside were fixed in 2.5% glutaraldehyde at 20–22°C for approximately 10 min. They were eventually stained with crystal violet solution (0.1%) for 15 min. Images of invading cells were obtained using an inverted microscope [35].

Establishment of tumor xenografts in mice

All animal care and handling procedures were performed in accordance with the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Review Board of our hospital. BALB/c mice were purchased from the Hubei Province Experimental Animal Center (China) and subcutaneously injected with MDA-MB-231 cells (1 × 107). Next, 100 nmol/kg miR-21-5p antagomiR (antagomiR) and negative control (antagomiR-NC) were administered through the tail vein. Normal mice or mice treated with anti-miR-21-5p were orally fed with 1.0 mg/kg reversine every 7 days, the process being repeated thrice in a row (days 8, 15, and 22). The length and width of the tumor were measured with a digital caliper every 7 days, and its volume was calculated accordingly. The mice were sacrificed 28 days later, and the tumors harvested from them were weighed [36].

Luciferase assay

The wild-type (WT) SPRY2 3ʹ-untranslated region (3ʹ-UTR) with the binding sites of miR-21-5p (SPRY2-WT) and the mutant (MUT) SPRY2 3ʹ-UTR without the binding sites of miR-21-5p (SPRY2-MUT) were cloned into pGL3-control vectors (Promega, USA) by RiboBio Co., Ltd. (China). SPRY2-WT or SPRY2-MUT was co-transfected with miR-21-5p mimic or mimic-NC into MAD-MB-231 and MCF-7 cells using Lipofectamine 2000 Transfection Reagent. After 48 h of co-transfection, the luciferase activities of firefly and renilla were determined using the dual-luciferase reporter assay (Promega, USA) [37].

Western blotting

Total protein from cells was isolated using radioimmunoprecipitation assay (RIPA) buffer containing a protease inhibitor (Beyotime, China). After estimating the protein concentrations using the bicinchoninic acid (BCA) assay kit (Beyotime), 20 µg/lane proteins were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% skimmed milk and incubated with primary antibodies, including anti-SPRY2 (ab180527, Abcam, USA) and anti-GAPDH (ab9485, Abcam) overnight at 4°C. After washing the membranes thrice with TBST, the membranes were incubated with horseradish peroxidase (HRP) anti-rabbit IgG antibody (ab270144, Abcam). Finally, the protein bands were detected using the BeyoECL Plus kit (P0018M, Beyotime) [38].

Statistical analyses

Each experiment was performed thrice, and the data are presented as mean ± standard deviation. The collected data were statistically analyzed using a software application known as GraphPad Prism 8.0 (GraphPad Prism Inc., USA). Student’s t-test and one-way analysis of variance (ANOVA) were employed to analyze the differences between two groups and across multiple groups, respectively. Statistical significance was set at P < 0.05.

Results

We hypothesized that combination therapy using miR-21-5p inhibitor and reversine could inhibit HBC progression by targeting SPRY2. In this study, through CCK-8 assay, BrdU assay, wound healing, transwell, and xenograft tumor experiments, we demonstrated that miR-21-5p inhibitor or reversine could inhibit the viability, proliferation, migration, invasion, and tumor growth of HBC cells. In addition, miR-21-5p was found to target SPRY2, as identified by bioinformatics analysis and a dual luciferase reporter assay.

Reversine inhibited HBC cell proliferation, migration, and invasion and facilitated HBC cell apoptosis

Two HBC cell lines (MDA-MB-231 and MCF-7) were used to investigate the effect of reversine on HBC progression. First, we performed the CCK8 assay to determine the viability of HBC cells treated with reversine after 24 and 48 h. This experiment could determine the optimum concentration and time for treatment. The half‑maximal inhibitory concentration (IC50) of reversine at 48 and 24 h was 0.25 and 0.22 μM in MCF-7 cells and 0.36 and 0.19 μM in MDA-MB-231 cells (Figure 1a), respectively; however, it was not observed in the normal breast cell line MCF-10A (Supplementary Figure S1). Based on this finding, we next observed the change in viability of MDA-MB-231 and MCF-7 cells treated with 0, 0.15, and 0.3 μM reversine for 24, 48, and 72 h. The outcomes in both cell lines revealed that reversine could reduce HBC cell viability in a dose- and time-dependent manner, indicating that it could suppress the growth of HBC cells (Figure 1b). The BrdU assay further confirmed these results. As shown in Figure 1c, DNA synthesis in both MCF-7 and MDA-MB-231 cells treated with reversine was reduced. Next, caspase-3 activity was evaluated to understand the effect of reversine on apoptosis of HBC cells. As illustrated in Figure 1d, an increase in apoptosis rate was observed in both the HBC cells treated with 0.15 μM reversine. Treatment of the cells with 0.3 μM reversine further aggravated the apoptosis rate. Next, the 24 h wound healing data demonstrated a greater decrease in migration rate of both the cell lines treated with 0.3 μM and 0.15 μM reversine than in those treated with 0 μM reversine (Figure 1e). The number of invaded cells was further reduced based on the amount of reversine added to the cells (Figure 1f). Collectively, these results indicate that reversine represses HBC cell migration, growth, and invasion while boosting HBC cell apoptosis in a dose-dependent manner.

Figure 1.

Reversine suppressed breast cancer cells proliferation, migration and invasion while exacerbated their apoptosis in a dose-dependent manner. (a) The human breast cancer cell lines MDA-MB-231 and MCF-7 were treated with various dosages of reversine for 24 h and 48 h, and the CCK-8 assay was used to evaluate cell viability. (b) The cell viability of MDA-MB-231 and MCF-7 cell lines under the treatment of 0 μM, 0.15 μM and 0.3 μM reversine for 24 h, 48 h and 72 h was determined by CCK-8 assay. (c) BrdU assay indicated the cell proliferation of MDA-MB-231 and MCF-7 treated with 0 μM, 0.15 μM and 0.3 μM reversine for 48 h. (d) Apoptosis rate was examined in MDA-MB-231 and MCF-7 treated with 0 μM, 0.15 μM and 0.3 μM reversine for 48 h. (e) Wound healing assay showed cell migration ability of MDA-MB-231 and MCF-7 treated with 0 μM, 0.15 μM and 0.3 μM reversine for 48 h. (f) Transwell assay indicated cell invasion capacity of MDA-MB-231 and MCF-7 treated with 0 μM, 0.15 μM and 0.3 μM reversine for 48 h. * P < 0.05, ** P < 0.001 compared to 0 μM group.

Effects of miR-21-5p on HBC cells and tissues

miR-21-5p expression in HBC and adjacent normal tissues was quantified using RT-qPCR. The findings revealed that miR-21-5p was more highly expressed in HBC tissues than in adjacent normal tissues (Figure 2a). miR-21-5p expression level in MDA-MB-231, SKBr-3, MCF-7, and BT474 cells was increased by approximately 5-, 3-, 4, and 2 times, respectively, compared with that in MCF-10A (Figure 2b). Hence, MDA-MB-231 and MCF-7 cells were selected for subsequent experiments, considering the high expression level of miR-21-5p in these cells. To confirm the effect of reversine on miR-21-5p expression, the level of miR-21-5p in MDA-MB-231 and MCF-7 cells treated with gradient reversine concentrations was assessed. The level of miR-21-5p was found to be negatively correlated with the concentration of reversine (Figure 2c). Furthermore, we examined the influence of miR-21-5p inhibitor, with or without reversine, on the expression level of miR-21-5p. The findings suggest that miR-21-5p inhibitor downregulates miR-21-5p expression and that this repressive effect is enhanced when the suppressor is co-treated with reversine (Figure 2d). Overall, the results indicate the synergetic effects of miR-21-5p inhibitor and reversine on HBC progression.

Figure 2.

MiR-21-5p was significantly upregulated in breast cancer cells and tissues. (a) Relative miR-21-5p expression was detected by RT-qPCR in breast cancer tissues and adjacent normal tissues. (b) Relative miR-21-5p expression was detected by RT-qPCR in breast cancer cell lines (MDA-MB-231, SKBr-3, MCF-7 and BT474) and normal breast cell line (MCF-10A). (c) RT-qPCR analysis of miR-21-5p expression in MDA-MB-231 and MCF-7 cell lines treated with 0 μM, 0.15 μM and 0.3 μM reversine for 48 h. (d) RT-qPCR analysis of miR-21-5p expression in MDA-MB-231 and MCF-7 cell lines treated with negative control (NC), miR-21-5p inhibitor (miR-inhibitor) or miR-21-5p inhibitor together with 0.3 μM reversine for 48 h. Blank indicated untreated group. * P < 0.05, ** P < 0.001 compared to MCF-10A or 0 μM group or Blank group.

Reversine combined with miR-21-5p inhibitor weakened HBC cell proliferation, migration, and invasion while enhancing HBC cell apoptosis

We aimed to discover the effect of reversine and miR-21-5p inhibitor co-treatment on HBC cell growth. Both miR-21-5p inhibitor and 0.3 μM reversine were added to HBC cell lines (MCF-7 and MDA-MB-231). As illustrated in Figure 3a, viability of both cell lines declined when they were treated with the miR-21-5p inhibitor or reversine. This reduction was further enhanced when both miR-21-5p inhibitor and reversine were added to the cells, which in turn revealed the ability of both molecules to suppress HBC cell growth (Figure 3a). The BrdU assay results also indicated a decrease in the proliferation ability of HBC cells treated with miR-21-5p inhibitor or reversine compared with that of cells in the blank group (Figure 3b). Both miR-21-5p inhibitor and reversine were discovered to synergistically inhibit HBC cell proliferation. Subsequently, we compared the apoptosis rates of HBC cells in the five treatment groups. As shown in Figure 3c, the apoptosis rate increased in the miR-21-5p inhibitor group and then increased further after the cells were transfected with both miR-21-5p inhibitor and reversine. To demonstrate the role of miR-21-5p inhibitor and reversine in cell migration, we performed a wound healing assay. The results showed a lower migration rate for cells treated with either miR-21-5p inhibitor or reversine than for those in the blank group; however, the HBC cells treated with the combination of miR-21b-5p inhibitor and reversine exhibited the lowest migration rate (Figure 3d). After the transwell assay was conducted, invasion ability of the MDA-MB-231 and MCF-7 cells treated with miR-21-5p inhibitor or reversine was found to be reduced compared with that of cells in the blank group (Figure 3e). The number of invaded cells treated with both miR-21-5p inhibitor and reversine was lesser than that of cells treated with either miR-21-5p inhibitor or reversine (Figure 3e). Overall, our findings confirm not only the repressive effect of miR-21-5p inhibitor and reversine on HBC cell proliferation, invasion, and migration but also the promotive effect of these molecules on HBC cell apoptosis.

Figure 3.

Reversine and miR-21-5p inhibitor co-treatment showed synergistically restrictive effect on the cell proliferation, migration, invasion and enhanced effect on the apoptosis of breast cancer cell. For all the experiments, MDA-MB-231 and MCF-7 cell line were treated with negative control (miR-NC), miR-21-5p inhibitor alone (miR-inhibitor), 0.3 μM reversine alone (0.3 μM) or miR-21-5p inhibitor together with 0.3 μM reversine (0.3 μM + inhibitor group) for 48 h, respectively. Blank indicated untreated group. (a) The cell viability of MDA-MB-231 and MCF-7 cell lines under various treatment were determined by CCK-8 assay. (b) BrdU assay indicated the cell proliferation of MDA-MB-231 and MCF-7 cells under various treatment. (c) Apoptosis rate was examined in MDA-MB-231 and MCF-7 cells under various treatment. (d) Wound healing assay was performed to observe cell migration ability of MDA-MB-231 and MCF-7 cells under various treatment. (e) Transwell assay indicated cell invasion capacity of MDA-MB-231 and MCF-7 cells under various treatment. * P < 0.05, ** P < 0.001 compared to Blank group.

Reversine combined with miR-21-5p inhibitor weakened the tumor growth of HBC in vivo

To extend our observations in cell lines further, we investigated the role of reversine and miR-21-5p in xenograft tumor models. As expected, the tumor grew more slowly and tumor volume was lower in the antagomir group or the 0.1 mg/kg reversine group than that in antagomir-NC group. Importantly, the combination of 0.1 mg/kg reversine and antagomir further reduced the growth rate and volume of the tumor (Figure 4a). In addition, weight of the tumor showed a similar effect, with a significant reduction in tumor weight in the antagomir group and a further reduction after treatment with 0.1 mg/kg reversine or with the combination of 0.1 mg/kg reversine and antagomir (Figure 4b).

Figure 4.

Reversine combined with miR-21-5p inhibitor weakens the tumor growth of HBC in vivo (a) Tumor growth curves in xenograft formation assay, and the representative images of xenograft tumors dissected from the nude mice. (b) The tumor weight of xenograft tumors dissected from the nude mice. ** P < 0.001 compared to antagomiR-NC group. ## P < 0.001 compared to 1.0 mg/kg+antagomiR group.

SPRY2 was regulated by the combination of reversine and miR-21-5p inhibitor

To explore the downstream mechanism of reversine combined with the miR-21-5p inhibitor, starBase was used to predict the target genes of miR-21-5p and GSE124646 was used to screen the downregulated genes in HBC samples with adjusted P < 0.05 and logFC < −1. The results showed that 105 downregulated genes could be targeted by miR-21-5p (Figure 5a). After GO enrichment by STRING, transforming growth factor beta receptor 2 (TGFBR2), annexin A1 (ANXA1), SPRY2, cysteine-rich angiogenic inducer 61 (CYR61), fibulin 1 (FBLN1), fibroblast growth factor 1 (FGF1), and DLC1 Rho GTPase activating protein (DLC1) were found to be associated with cell proliferation and cell migration (Figure 5b). Among the seven genes mentioned above, SPRY2 expression was negatively correlated with miR-21-5p expression in HBC samples as per starBase analysis (Figure 5c). Therefore, SPRY2 was identified as a gene of interest. The binding sites between SPRY2 3ʹ-UTR and miR-21-5p were predicted using starBase (Figure 5d). Luciferase assay confirmed that luciferase activity was reduced only in the SPRY2-WT and miR-21-5p mimic groups (Figure 5e), hence indicating that miR-21-5p could target SPRY2. In our collected tissue samples, SPRY2 expression was reduced in tumor samples than in adjacent normal samples (Figure 5f), and its expression was negatively correlated with miR-21-5p expression (Figure 5g). SPRY2 expression in MDA-MB-231 and MCF-7 cells was positively associated with the concentration of reversine (Figure 5h). Western blot assay showed that both miR-21-5p inhibitor and 0.3 μM reversine enhanced SPRY2 expression; the upregulation of SPRY2 was promoted when the HBC cells were co-treated with reversine and miR-21-5p inhibitor (Figure 5i). Our data revealed SPRY2 as the target of miR-21-5p and that it can participate in the regulatory effects of co-treatment with reversine and miR-21-5p inhibitor in HBC cells.

Figure 5.

The anti-tumor effect of co-treatment of reversine and miR-21-5p inhibitor on HBC cells by targeting SPRY2. (a) 105 common genes were overlapped from starBase and GSE124646. starBase, a tool for predicting the targets of miR-21-5p. GSE124646, a mRNA microarray for screening the downregulated genes in HBC samples. (b) Seven genes were identified to be related to cell proliferation and cell migration by STRING analysis. (c) The negative correlation between SPRY2 and miR-21-5p in BRCA samples by starBase analysis. BRCA, breast invasive carcinoma. (d) starBase predicted the binding sites between SPRY2 3ʹUTR and miR-21-5p. (e) Luciferase assay identified the target relationship between SPRY2 3ʹUTR and miR-21-5p. (f) SPRY2 expression reduced in tumor samples compared with adjacent normal samples. (g) The negative correlation between SPRY2 and miR-21-5p in tumor samples by Pearson’s correlation analysis. (h) The upregulation of SPRY2 in HBC cells treated with reversine. ** P < 0.001 compared to 0 μM group. (i) The upregulation of SPRY2 in HBC cells treated with reversine and miR-21-5p inhibitor. ** P < 0.001 compared to Blank group.

Discussion

The oncogenic role of Aurora kinases has been observed in many types of cancer. Several studies have reported their ability to influence cell proliferation, and this property has been found to be useful in cancer prognosis and treatment [13,39,40]. Reversine, an Aurora kinase inhibitor, has been reported to suppress many types of cancer cells and regulate cell proliferation, migration, and apoptosis [21,22]. Similar to reversine, miR-21-5p also has oncogenic functions, and can target specific genes to suppress or promote tumorigenesis of different types of cells [29,41]. Research on HBC has shown that both reversine and miR-21-5p exhibit inhibitory effects on HBC cell proliferation and metastasis [21,28,42]. However, whether the two molecules can synergistically influence HBC progression remains unclear.

In this study, we performed CCK8, BrdU, caspase-3 activity, transwell, and wound healing assays to evaluate and compare the effects of reversine, combined with or without miR-21-5p inhibitor, on HBC cells. Similar to the study by Zhang et al. [43] regarding the promotion of proliferation, migration, and invasion by miR-21 in non-small cell lung cancer, our experimental investigations indicated that miR-21-5p inhibitor could restrain the proliferation, migration, and invasion abilities of HBC cells, but facilitate HBC cell apoptosis. In addition, reversine treatment had a more significant effect on the progression of HBC. We first primed the MDA-MB-231 and MCF-7 cell lines with gradient reversine concentrations for different time intervals to determine the optimal treatment dosage for HBC cells. Our results showed a time-dependent and dose-dependent repressive effect of reversine on cell viability. Moreover, reversine limited cell migration and invasion but facilitated cell apoptosis in a dose-dependent manner. These findings are consistent with those of previous studies [21,30], which confirmed the anti-tumor activity of reversine. Although we did not study the molecular mechanism underlying the regulation of HBC progression by reversine, the inhibitory functions of reversine in HBC cells suggested that reversine might play a tumor-suppressive role by repressing the activity of Aurora kinases; the importance of Aurora kinases in the carcinogenesis of HBC would need further investigation.

Furthermore, we investigated the function of miR-21-5p in HBC cells and tissues and found miR-21-5p to be aberrantly expressed in HBC cells. Similar results were documented in previous studies as well [44,45], which indicated that miR-21-5p regulates tumorigenesis in HBC. We assessed the levels of miR-21-5p in MDA-MB-231 and MCF-7 cells treated with reversine and/or an miR-21-5p inhibitor. The results showed a concentration-dependent restriction of reversine and miR-21-5p expression in the two HBC cell lines. More specifically, we found reversine combined with an miR-21-5p inhibitor to synergistically affect the function of HBC cells. Consistent with our predictions, results of the assays proved that reversine together with miR-21-5p inhibitor produced a combined effect greater than their individual effects, thereby suppressing HBC cell proliferation, migration, and invasion, and promoting apoptosis. This finding could provide more insights into the function of reversine and miR-21-5p in human breast carcinogenesis, especially for developing better treatment strategies against HBC and other cancer types.

SPRY2, a member of the sprout family, can suppress the activity of receptor tyrosine kinase signaling [46]. Previous studies had reported that SRPY2 could play an anti-tumor role in multiple cancers, including ovarian cancer [47], gastric cancer [48], and pancreatic cancer [49]. However, the effect of SPRY2 on HBC has not been explored yet. In this study, we found SPRY2 expression to be reduced in HBC, and SPRY2 to be the target of miR-21-5p, which could promote HBC progression. Co-treatment with miR-21-5p and reversine effectively inhibited the malignancy of HBC cells by downregulating SPRY2 expression, thereby suggesting that SPRY2 is an anti-tumor gene in HBC. Our study is the first to reveal that SPRY2 targeted by miR-21-5p could play an anti-tumor role in HBC cells, hence providing a novel target for HBC therapy.

Although we found reversine and miR-21-5p inhibitor to synergistically act on HBC cells by regulating SPRY2, it has some limitations. Evidence has shown that reversine can regulate several biological processes by inhibiting miRNAs. For example, reversine was found to promote browning of white adipocytes by downregulating miR-133a [50]. The role of reversine in the multipotency acquisition of myoblasts was also achieved through miR-133a silencing [51]. These studies suggest that miR-21-5p acts as a mediator in the suppression of HBC cells; therefore, the mechanism of reversine needs to be further explored in HBC. In addition, the mechanism underlying the synergistic effects of miR-21-5p inhibitor and reversine needs to be identified in vivo.

Conclusion

Our study revealed that reversine and the selected miR-21-5p inhibitor synergistically exert tumor-suppressive effects on HBC cells by targeting SPRY2. This knowledge could be useful in identifying novel strategies for HBC therapy.

Click here for additional data file.