| Literature DB >> 34967263 |
Abstract
Postmenopausal osteoporosis is characterized by inadequate bone formation of osteoblasts and excessive bone resorption of osteoclasts. Bone marrow mesenchymal stem cells (BMSCs), with the potential of osteogenic differentiation, have been widely used in the bone tissues engineering for the treatment of bone diseases, including postmenopausal osteoporosis. Methyl-CpG-binding protein 2 (MECP2) has been reported to be implicated in bone formation during the development of Rett syndrome. However, the influence of MeCP2 on osteogenic differentiation of BMSCs during osteoporosis remains unclear. Firstly, mice model with estrogen deficiency-induced osteoporosis was established through ovariectomy (OVX). MeCP2 was found to be down-regulated in bone tissues and BMSCs of OVX-induced osteoporosis mice. Secondly, over-expression of MeCP2 enhanced the calcium deposition of BMSCs isolated from the OVX-induced osteoporosis mice. Moreover, expression of osteogenic biomarkers including alkaline phosphatase (ALP), runt-related transcription factor 2 (RUNX2), collagen type I alpha 1 (COL1A1), and osteocalcin (OCN) was increased in BMSCs by overexpression of MeCP2. Thirdly, over-expression of MeCP2 reduced protein expression of forkhead box F1 (FOXF1) and adenomatous polyposis coli (APC), while enhanced Wnt5a and β-catenin expression in BMSCs. Over-expression of FOXF1 attenuated MeCP2 over-expression-induced decrease of FOXF1 and APC, as well as increase of Wnt5a and β-catenin. Finally, the increased calcium deposition, protein expression of ALP, RUNX2COL1A1 and OCN induced by concomitant overexpression of MeCP2 were also restored by FOXF1 over-expression. In conclusion, MeCP2 promoted osteogenic differentiation of BMSCs through regulating FOXF1/Wnt/β-Catenin axis to attenuate osteoporosis. MeCP2 over-expression reduced FOXF1 to promote the activation of Wnt5a/β-Catenin and promote osteogenic differentiation of BMSCs during the prevention of postmenopausal osteoporosis.Entities:
Keywords: BMSCs; FOXF1/Wnt/β-Catenin; MeCP2; estrogen deficiency; osteogenic differentiation; osteoporosis
Mesh:
Substances:
Year: 2022 PMID: 34967263 PMCID: PMC8805827 DOI: 10.1080/21655979.2021.2012357
Source DB: PubMed Journal: Bioengineered ISSN: 2165-5979 Impact factor: 3.269
Primer sequences
| ID | Sequence(5’- 3’) |
| ACCACAGTCCATGCCATCAC | |
| TCCACCACCCTGTTGCTGTA | |
| GCCGAGAGCTATGGACAGCA | |
| CCAACCTCAGACAGGTTTCCAG | |
| CCGGCTGGAGATGGACAAAT | |
| CTCATTGCCCTGAGTGGTG | |
| GAGCGTTCAACGGCACAG | |
| GACAGTAGACTCCACGACA | |
| GCAACAGTCGCTTCACCTACA | |
| CAATGTCCAAGGGAGCCACAT | |
| GTCAGACTACAACATCCAGAAG | |
| CGAGTATCTTCCTGTTTGACC |
Figure 1.MeCP2 was down-regulated in OVX-treated mice.
Figure 2.Over-expression of MeCP2 promoted osteogenic differentiation of BMSCs.
Figure 3.Over-expression of MeCP2 promoted osteogenic genes expression.
Figure 4.MeCP2 mediated FOXF1/Wnt/β-Catenin.
Figure 5.MeCP2 promoted osteogenic differentiation of BMSCs through regulation of FOXF1.