Literature DB >> 34965260

High prevalence of plasmid-mediated quinolone resistance (PMQR) among E. coli from aquatic environments in Bangladesh.

Mohammed Badrul Amin1, Sumita Rani Saha1, Md Rayhanul Islam1, S M Arefeen Haider1, Muhammed Iqbal Hossain1, A S M Homaun Kabir Chowdhury1, Emily K Rousham2, Mohammad Aminul Islam1,3.   

Abstract

Fluro(quinolones) is an important class of antibiotic used widely in both human and veterinary medicine. Resistance to fluro(quinolones) can be acquired by either chromosomal point mutations or plasmid-mediated quinolone resistance (PMQR). There is a lack of studies on the prevalence of PMQR in organisms from environmental sources in Bangladesh. In this study, we investigated the occurrence of PMQR genes in E. coli from various water sources and analysed associations between multi-drug resistance (MDR) and resistance to extended spectrum β-lactam antibiotics. We analysed 300 E. coli isolates from wastewaters of urban live-bird markets (n = 74) and rural households (n = 80), rural ponds (n = 71) and river water samples (n = 75) during 2017-2018. We isolated E. coli by filtering 100 ml of water samples through a 0.2μm cellulose membrane and incubating on mTEC agar media followed by identification of isolated colonies using biochemical tests. We selected one isolate per sample for detection of PMQR genes by multiplex PCR and tested for antibiotic susceptibility by disc diffusion. Clonal relatedness of PMQR-positive isolates was evaluated by enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR). About 66% (n = 199) of E. coli isolates harbored PMQR-genes, predominantly qnrS (82%, n = 164) followed by aac(6')-lb-cr (9%, n = 17), oqxAB (7%, n = 13), qnrB (6%, n = 11) and qepA (4%, n = 8). Around 68% (n = 135) of PMQR-positive isolates were MDR and 92% (n = 183) were extended spectrum β-lactamase (ESBL)-producing of which the proportion of positive samples was 87% (n = 159) for blaCTX-M-1' 34% (n = 62) for blaTEM, 9% (n = 16) for blaOXA-1, blaOXA-47 and blaCMY-2, and 2% (n = 4) for blaSHV. Further, 16% (n = 32) of PMQR-positive isolates were resistant to carbapenems of which 20 isolates carried blaNDM-1. Class 1 integron (int1) was found in 36% (n = 72) of PMQR-positive E. coli isolates. PMQR genes were significantly associated with ESBL phenotypes (p≤0.001). The presence of several PMQR genes were positively associated with ESBL and carbapenemase encoding genes such as qnrS with blaCTXM-1 (p<0.001), qnrB with blaTEM (p<0.001) and blaOXA-1 (p = 0.005), oqxAB and aac(6')-lb-cr with blaSHV and blaOXA-1 (p<0.001), qnrB with blaNDM-1 (p<0.001), aac(6')-lb-cr with blaOXA-47 (p<0.001) and blaNDM-1 (p = 0.002). Further, int1 was found to correlate with qnrB (p<0.001) and qepA (p = 0.011). ERIC-PCR profiles allowed identification of 84 of 199 isolates with 85% matching profiles which were further grouped into 33 clusters. Only 5 clusters had isolates (n = 11) with identical ERIC-PCR profiles suggesting that PMQR-positive E. coli isolates are genetically heterogeneous. Overall, PMQR-positive MDR E. coli were widely distributed in aquatic environments of Bangladesh indicating poor wastewater treatment and highlighting the risk of transmission to humans and animals.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34965260      PMCID: PMC8716050          DOI: 10.1371/journal.pone.0261970

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

With 700,000 global deaths annually, bacterial infections caused by antimicrobial-resistant organisms are a major public health concern [1]. Antimicrobial-resistant (AMR) infections increase mortality, treatment duration, recovery time, and health care costs. AMR is a One Health problem and addressing the issues related to human and animal health separately or in combination is not enough if the environmental dimensions of the problem are not addressed. The emergence of multidrug-resistant (MDR) organisms in aquatic environments constitutes a major threat for both humans and livestock. Although E. coli is part of the normal flora in humans and animals, pathogenic strains of E. coli cause severe clinical challenges including gastrointestinal tract infection, central nervous system infection, urinary tract and skin and soft tissue infections [2, 3]. These infections become more severe when caused by MDR pathogens [4]. Several recent investigations reported the emergence of MDR bacteria from different host origins including humans, birds, cattle, and fish that increase the need for antimicrobial susceptibility testing to identify the antibiotic of choice as well as screening for emerging MDR strains [5-11]. Quinolones and fluoroquinolones (FQs) are broad-spectrum antibiotics frequently used in human and veterinary health for treatment of both Gram-positive and Gram-negative bacterial infections [12]. Fluro(quinolones) are the third most commonly prescribed antibiotics in Bangladesh for treating outpatients suffering from common cold and fever, infections, diarrhea, and gonorrhea [13, 14]. In livestock production in Bangladesh, flouroquinolone is one of the most commonly used antibiotics, with an estimated consumption of 100 metric ton per year [15]. Ciprofloxacin is widely used as a single drug or in combination with other drugs and is often sold as feed supplements under many different brand names [15]. Farmers use this antibiotic mostly for prophylactic purposes to avert infections or as an alternative to good agricultural practices and as a growth promoter on farm animals [16, 17]. With increasing use of fluoroquinolones, the prevalence of fluoroquinolone resistance has also been increasing. Although quinolone resistance in Enterobacteriaceae is mainly attributed to point mutations in quinolone resistance-determining regions (QRDRs) of the type II topoisomerase genes (gyrase: gyrA, gyrB; and topoisomerase IV: parC, parE), there are an increasing number of reports of plasmid-mediated quinolone resistance (PMQR) determinants associated with low-level resistance to fluoroquinolones [18-21]. Moreover, bacterial pathogens that are positive for PMQR are also more likely to have chromosomal mutations resulting in high level of resistance to the antibiotics [22, 23]. Co-occurrence of PMQR with extended spectrum β-lactamase (ESBL) genes may limit the treatment options for infections caused by ESBL-producing bacteria [24]. Three categories of PMQR genes have been reported based on their mode of action. Such examples include the qnr alleles (qnrA, qnrB, qnrS, qnrC, and qnrD); efflux pump genes (e.g. oqxAB, qepA); and a variant of aminoglycoside acetyl transferase (aac-(6′)-Ib-cr) [25-28]. qnrA, qnrB genes can be carried by large and usually conjugative plasmids, whereas qnrS can be carried by small, mobilizable, and non-conjugative plasmids [18, 29]. However, both types of plasmid can readily disseminate and transmit antibiotic resistance traits among bacterial communities. Another important mechanism of PMQR gene transmission among the bacterial population is via the integrons (int) particularly int1 in Gram-negative bacteria [30, 31]. Close proximity between antibiotic resistance genes and int1 thus enhances mobility by transposition and allows them to become associated with multiple antibiotic-resistant gene (ARG) cassettes and heavy metal and disinfectant resistant genes [18, 32]. The prevalence of PMQR genes has been investigated in different countries across the world. Previous studies in humans, food-producing animals, wild animals, and wastewater samples showed an overall prevalence of PMQR in E. coli of 25% with the highest reported occurrence (49%) in retail turkey from Czech Republic [33]. In China aquatic environmental samples had a 30% prevalence of PMQR-positive E. coli isolates overall; with a prevalence of 28% in hospital-impacted water samples and 37% in aquaculture-impacted river water samples [34]. Limited information is available on the prevalence of PMQR in Bangladesh. PMQR genes were detected in clinical isolates of E. coli and K. pneumoniae largely from wound and urinary tract infections, and in E. coli from cloacal swabs of poultry [35, 36]. Recently, a novel quinolone resistance gene qepA has been detected in E. coli and K. pneumoniae strains isolated from lake and river water samples in Bangladesh [37]. Although previous studies have shown that aquatic environments in Bangladesh particularly drinking water, wastewater, and surface water bodies such as ponds and rivers are heavily contaminated with various faecal pathogens including multi-drug resistant organisms, no studies have estimated the prevalence of PMQR among isolates [38, 39]. In this study, we aimed to investigate water samples from different aquatic environments including wastewater and surface water from both rural and urban areas of Bangladesh to understand the prevalence and distribution of E. coli carrying PMQR along with their resistance patterns against clinically important antibiotics. A further aim was to investigate the association of PMQR genes with ESBL- and carbapenemase-producing genes in environmental E. coli isolates.

Methods and materials

Ethical approval

This research protocol was approved by the Institutional Review Board of the International Centre for Diarrhoeal Disease Research, Bangladesh (icddr,b) (protocol number PR-16071).

Study overview

The present study is part of a larger study that simultaneously examined the dynamics of AMR transmission from contaminated outdoor environments such as poultry, soil, surface water, solid waste, and wastewater from urban and rural Bangladesh [40]. Here, we investigated the E. coli isolates collected from wastewater of rural poultry farms and households, and urban live-bird markets, as well as pond water and river water samples from rural areas to determine the presence of PMQR genes and analyse their distribution according to sample types.

Sample collection

A total of 300 water samples including urban wastewater (n = 74), rural wastewater (n = 80) from poultry farms and households, river (n = 75) and pond (n = 71) water samples were collected during 2017–18 following previously described procedures [40]. Briefly, water samples were collected using a sterile plastic bottle filled by plunging downwards about 30 cm below the water surface. Sample bottles were placed in a cool box (4–8°C) and transported to the laboratory within 8 hours of collection for culture.

Isolation and identification of E. coli

About 100 mL of water sample was passed through a 0.2 μm cellulose nitrate filter (Sartorius Stedim Biotech GmbH, Goettingen, Germany) and then the filter was placed in an upright position on modified mTEC agar media (BD Difco, New Jersey, USA). The culture plate was incubated at 37°C for 2 hours and then at 44°C overnight to allow growth of thermotolerant E. coli. mTEC medium contains a chromogen (5-bromo-6-chloro-3-indolyl-β-D-glucuronide), which is catabolized by E. coli producing β-D-glucuronidase to glucuronic acid and produces a red- or magenta-coloured compound. Two E. coli isolates were selected from each water sample and sub-cultured on MacConkey agar (BD Difco, New Jersey, USA) and incubated at 37°C for overnight. The presumptive colonies were identified according to their colony characters, microscopical examination using Gram staining, motility test, and biochemical reactions (oxidase, catalase, indole, lactose fermentation, methyl-red, citrate-utilization, H2S, Voges-Proskauer, and urease tests) as described previously [41]. All E. coli isolates were stored in Tryptone soya broth (Oxoid Limited, Hampshire, England) with 30% glycerol (Sigma-Aldrich, Darmstadt, Germany) and kept at -80°C for future use.

Screening of PMQR-positive isolates by PCR

All E. coli isolates from water samples were investigated for plasmid-mediated quinolone resistance genes (qnrS, qnrB, oqxAB, qepA, aac(6’)-lb-cr, qnrA, qnrC & qnrD) by multiplex-PCR as described previously [42]. The primers and PCR cycling are listed in Table 1.
Table 1

List of primer sequences used in multiplex PCR for the determination of PMQR determinants.

Target genePrimer sequencesAmplicon size (bp)Amplification (30 cycles)References
DenaturationAnnealingExtension
qnrA F CAGCAAGAGGATTTCTCACG 63094°C for 30 seconds63°C for 90 seconds72°C for 90 secondsCiesielczuk et al., 2013 [42]
qnrA R AATCCGGCAGCACTATTACTC
qnrD F CGAGATCAATTTACGGGGAATA 581
qnrD R AACAAGCTGAAGCGCCTG
qnrB F GGCTGTCAGTTCTATGATCG 488
qnrB R GAGCAACGATGCCTGGTAG
qnrS F GCAAGTTCATTGAACAGGGT 428
qnrS R TCTAAACCGTCGAGTTCGGCG
oqxAB F CCGCACCGATAAATTAGTCC 313
oqxAB R GGCGAGGTTTTGATAGTGGA
aac(6’)-lb-cr F TTGGAAGCGGGGACGGAM 260
aac(6’)-lb-cr R ACACGGCTGGACCATA
qepA F GCAGGTCCAGCAGCGGGTAG 218
qepA R CTTCCTGCCCGAGTATCGTG
qnrC F GCAGAATTCAGGGGTGTGAT 118
qnrC R AACTGCTCCAAAAGCTGCTC

Confirmation of amplified fragments of PMQR genes by sequencing

The PCR amplified fragment of each PMQR gene found in this study was sequenced using ABI PRISM BigDye Terminator Cycle Sequencing Reaction kit (Applied Biosystems; CA, USA) and ABI PRISM 310 automated sequencer (Applied Biosystems; CA, USA). Before that, PCR products were purified using the PCR Purification kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. BioEdit software was used to analyse the raw sequence reads and for determining the homology with deduced sequence size. All the PMQR gene sequences were searched and confirmed by Basic Local Alignment Search Tool (BLAST). Finally, the sequences were submitted to GeneBank under five accession numbers: qnrS (OL439745), qnrB (OL439744), oqxAB (OK668389), qepA (OK668390) and aac(6’)-lb-cr (OL439743).

Antibiotic susceptibility testing of PMQR-positive E. coli

All PMQR-positive E. coli isolates were tested for antibiotic susceptibility against 16 clinically important antibiotic agents under nine antibiotic classes by disc diffusion method [43]. Commercially available antibiotic discs (Oxoid Limited, Hampshire, England) used for the test were: ampicillin (10 μg), cefotaxime (30 μg), ceftriaxone (30 μg), ceftazidime (30 μg), cefixime (5 μg), cefepime (30 μg),cefoxitin (30 μg), ciprofloxacin (5 μg), nalidixic acid (30 μg), sulfamethoxazole/trimethoprim (25 μg), gentamycin (10 μg), nitrofurantoin(300 μg), imipenem (10 μg), meropenem (10 μg), ertapenem (10 μg) and piperacillin-Tazobactam (10 μg). Results were interpreted as sensitive and resistant, and isolates showing resistance against at least one agent of more than three classes of antibiotics were classified as MDR. Where there was resistance against at least one agent in all classes except two or fewer antibiotic classes were considered as extensively drug-resistant (XDR) [43, 44]. Extended spectrum β-lactamase (ESBL) production was determined by using the combination disk test where a β-lactam inhibitor, clavulanic acid (30/10 μg) with cefotaxime (30 μg) and ceftazidime (30 μg) were used [43].

Detection of ESBL, carbapenemase and integrase encoding genes

All ESBL-producing isolates were screened for blaCTX-M-1, blaCMY-2, blaTEM, blaSHV, blaOXA-1, and blaOXA-47 genes by PCR [45]. All carbapenem resistant isolates were tested for carbapenem resistance genes, blaNDM-1 and blaOXA-48 according to the procedure described earlier [46]. Class 1 integrons were detected by PCR for int1 gene using the primer sequences and PCR conditions as described earlier [47].

Statistical analysis

Data were entered and analysed using Stata (Version 13.0, StataCorp LLC, College Station, TX, USA). Univariate analyses were performed to examine the presence of PMQR genes in different aquatic sources including wastewater, pond water and river water. In bivariate analyses, the prevalence of PMQR genes in different categories of antibiotic resistant E. coli isolates such as MDR, ESBL- and carbapenemase-producers was compared using Chi-square or Fisher’s exact test with Bonferroni correction [48]. Correlations for binary variables were calculated using the ‘cor’ function and using ‘cor.test’ function in R software (version 4.0.2; https://www.r-project.org/). Significant correlations were visualized utilizing the ‘corrplot’ function from the ‘corrplot’ R package [49]. For all analyses, statistical significance was considered as p<0.05.

Phylogenetic analysis using ERIC-PCR

PMQR-positive E. coli isolates were analysed for clonal diversity using enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR). Two primers, ERIC1 (5ʹ-ATGTAAGCTCCTGGGGATTCAC-3ʹ) and ERIC2 (5ʹ-AAGTAAGTGACTGGGGTGAGCG-3ʹ) were used following previously reported procedures [50]. ERIC-PCR amplified products were then separated in 1.5% agarose gel, normalised using the 100 bp DNA ladder as an external reference standard, stained with Midori Green, and visualized by FastGene Blue/Green LED Gel Illuminator (Nippon Genetics, Tokyo, Japan). The TIF formatted image was analyseed with BioNumerics version 4.5 (Applied Maths, Kortrijk, Belgium) to determine phylogenetic similarity among the isolates. Dendrogram clusters based on dice and clustering correlation coefficient showing 85% similarity in banding patterns between E. coli isolates were considered as phylogenetically related [51].

Results

Phenotypic characteristics of E. coli isolated from water samples

Isolates were identified as E. coli based on their morphology and biochemical characteristics. Microscopically, the bacteria appeared as Gram-negative moderate size, motile, and non-sporulated rods. The bacteria grew well on mTEC agar and appeared as red/magenta colour colonies due to β-D-glucuronidase activity which is highly specific for E. coli. On MacConkey agar, bacteria produced characteristic pink colonies due to lactose fermentation. Biochemically, all isolates were positive for catalase, lactose fermentation, indole and methyl-red, tests. Simultaneously, they were negative for cytochrome oxidase, Voges-Proskauer, citrate-utilization, H2S production, and urease tests. All 300 water samples were positive for E. coli.

PMQR genes are highly prevalent in E. coli from water sources

Of 300 E. coli isolates from water samples, 66% (n = 199) were positive for PMQR genes (Table 2). Of these, the majority of isolates were positive for qnrS (82%, n = 164) followed by aac(6’)-lb-cr (9% n = 17), oqxAB (7%, n = 13) qnrB (6%, n = 11) and qepA (4%, n = 8). None of the isolates was positive for qnrA, qnrC & qnrD. qnrS was predominantly detected in rural pond water (90%, n = 45) whereas aac(6’)-lb-cr was found in river water (24%, n = 11). Ten E. coli isolates carried more than one PMQR gene in the following combinations: qnrS+oqxAB (n = 2), qnrS+qnrB+oqxAB (n = 2), qnrB+oqxAB+aac(6)’-lb-cr (n = 1), qnrS+qnrB+aac(6)’-lb-cr (n = 1), qnrS+qepA+oqxAB (n = 1), qnrS+qnrB (n = 1), qnrS+oqxAB (n = 1) and qnrB+oqxAB (n = 1).
Table 2

Prevalence of PMQR genes in E. coli isolates obtained from different aquatic environments.

Sampling siteSample TypeSample number (n)PMQR positive n (%)No. (%) of isolates positive for PMQR genes
qnrS n (%)qnrB n (%)oqxAB n (%)qepA n (%)aac(6’)-lb-cr n (%)
UrbanWastewater7445 (61)52 (65)3 (4)4 (5)02 (3)
RuralWastewater8058 (72)37 (50)4 (5)3 (4)3 (4)4 (5)
pond water7150 (70)45 (90)2 (4)3 (6)2 (4)0
river water7546 (61)30 (65)2 (4)3 (7)3 (7)11 (24)
Total300199 (66)164 (82)11 (6)13 (7)8 (4)17 (9)

*R, resistance; n, number.

*R, resistance; n, number.

PMQR-positive E. coli are predominantly multi-drug resistant

All PMQR-positive isolates (n = 199) were resistant to penicillin followed by 96% resistant to cephamycins and extended spectrum cephalosporins, 48% to fluro(quinolones), 32% to folate pathway inhibitors, 26% to nitrofuran, 23% to β-lactamase inhibitors, 21% to aminoglycoside and 16% resistant to carbapenem (Table 3). Further, the distribution of antibiotic resistance patterns of PMQR positive isolates was analysed according to their sources. Of 199 PMQR positive E. coli isolates, 68% (n = 135) and 14% (n = 27) were MDR and XDR respectively, of which urban wastewater and rural river water showed high abundance. Aminoglycosides, fluoroquinolones, nitrofuran and folate pathway inhibitor drug resistant isolates had significant relationship with their sources (p<0.05) (Table 3).
Table 3

Occurrence of clinically important antibiotic resistance among PMQR-positive E. coli isolates from aquatic environments in Bangladesh.

Antibiotic classesAntibiotics testedNo. (%) of E. coli resistantp value
Urban Wastewater (n = 45)Rural Wastewater (n = 58)Rural pond water (n = 50)Rural river water (n = 46)
AminoglycosideGentamycin18 (40)7 (12)2 (4)15 (33)p<0.05
Antipseudomonal penicillins plus β-lactamase inhibitorsPiperacillin-Tazobactam10 (22)8 (14)6 (12)21 (46)p<0.001
CephamycinsCefoxitin44 (98)56 (97)47 (94)44 (96)0.654
Extended-spectrum cephalosporinsCefotaxime44 (98)56 (97)45 (90)44 (96)0.165
Ceftriaxone44 (98)56 (97)45 (90)44 (96)0.165
Ceftazidime39 (87)47 (81)38 (76)43 (98)0.065
Cefixime43 (96)56 (97)47 (94)44 (96)0.838
Cefepime44 (98)55 (95)45 (90)44 (96)0.277
CarbapenemErtapenem9 (20)5 (9)6 (12)10 (22)0.343
Meropenem10 (22)6 (10)7 (14)9 (19)0.363
Imipenem11 (24)8 (14)6 (12)7 (15)0.209
Fluro(quinolone)Nalidixic acid34 (76)23 (40)19 (38)27 (59)0.074
Ciprofloxacin34 (76)20 (34)14 (28)26 (57)p<0.05
Folate pathway inhibitorsSulfamethoxazole/trimethoprim27 (60)15 (26)11 (22)11 (24)p<0.05
NitrofuranNitrofurantoin9 (20)8 (14)15 (30)20 (43)p<0.05
PenicillinAmpicillin45 (100)58 (100)50 (100)46 (100)NA
MDR (≥3 Ab classes)39 (87)32 (55)29 (58)35 (76)0.157
XDR (All antibiotic classes except two or fewer classes)8 (18)4 (7)2 (4)13 (28)p<0.05

A significant proportion of PMQR-positive E. coli were positive for ESBL genes

About 92% (n = 183) of PMQR-positive E. coli were ESBL-producers. Screening of ESBL encoding genes showed that 87% (n = 159) of isolates were positive for blaCTX-M-1, 34% (n = 62) for blaTEM, 9% (n = 17) for blaOXA-1, blaOXA-47 and blaCMY-2 each, and 2% (n = 4) for blaSHV. Among carbapenem resistance, only blaNDM-1 was detected in 10% (n = 20) of the PMQR-positive isolates. None of the isolates were positive for blaOXA-48. Further, the class 1 integron encoding gene, int1, was detected in 37% (n = 73) of the isolates. Presence of PMQR genes was significantly associated with the ESBL phenotype (p<0.001) of the isolates. At the gene level, blaCTX-M-1 (p<0.001) and blaTEM (p<0.05) were significantly more common in PMQR-positive versus negative isolates (Table 4). A correlation matrix analysis between presence of PMQR genes and presence of ESBL, carbapenemase and class 1 integron encoding genes was conducted (Fig 1). The presence of qnrS was positively associated with blaCTXM-1 (p<0.001) while qnrB was positively associated with blaTEM (p<0.001), blaOXA-1 (p = 0.005) and blaNDM-1 (p<0.001). Detection of PMQR genes oqxAB and aac(6’)-lb-cr in isolates was positively associated with ESBL genes blaSHV and blaOXA-1 (p<0.001 for both). Isolates positive for the PMQR efflux gene, qepA, were predominantly positive for AmpC β-lactamase gene blaCMY (p = 0.016). Isolates carrying aac(6’)-lb-cr gene were more likely to be positive for carbapenem resistance genes blaOXA-47 (p<0.001) and blaNDM-1 (p = 0.002). Unlike antibiotic resistance genes, the presence of Class 1 integron gene Int1 was associated with a diverse group of PMQR genes including qnrB (p<0.001) and qepA (p = 0.011).
Table 4

Association of PMQR genes with ESBL, carbapenemase, integrase genes, and MDR and XDR phenotypes in E. coli isolates.

CharacteristicsNo. (%) of E. colip value*
PMQR positive (n = 199)PMQR negative (n = 101)
ESBL183 (92)74 (73)p<0.001
    blaCTXM-1165 (83)51 (50)p<0.001
    blaSHV5 (3)1 (1)0.668
    blaTEM63 (32)46 (46)p<0.05
    blaOXA-117 (9)12 (12)0.355
    blaOXA-4716 (8)13 (13)0.181
Carbapenemase32 (16)17 (17)0.70
    blaNDM-120 (10)16 (16)0.145
    blaCMY-216 (8)8 (8)0.971
    blaOXA-4800NA
Class 1 integron (int1)72 (36)40 (40)0.562
MDR135(68)74 (73)0.334
XDR27 (14)20 (20)0.160

*p values were determined using Chi-square or Fisher’s exact test.

Fig 1

Correlation matrix of the presence of PMQR genes with ESBL and carbapenemase and integron (int1) encoding genes in E. coli.

White spaces are not significantly correlated. Blue circles indicated significant positive correlation and red showed significant negative correlation. The size and strength of colour represent the numerical value of the Phi correlation coefficient.

Correlation matrix of the presence of PMQR genes with ESBL and carbapenemase and integron (int1) encoding genes in E. coli.

White spaces are not significantly correlated. Blue circles indicated significant positive correlation and red showed significant negative correlation. The size and strength of colour represent the numerical value of the Phi correlation coefficient. *p values were determined using Chi-square or Fisher’s exact test.

ERIC-PCR analysis

According to the 85% cut-off for similarity in ERIC-PCR banding patterns, 84 of 199 (42%) PMQR-positive E. coli isolates were grouped into 33 clusters (C1-C33) and the isolates in different clusters were randomly distributed irrespective of the sources of isolation (Fig 2). Among these 84 E. coli isolates, only 11 in five clusters, C3, C8, C19, C31 and C33, had identical banding patterns indicating clonal relationships. E. coli isolates from wastewater samples from different locations in urban areas belonged to the same clusters (C8 and C33) whereas isolates from pond and river water samples in rural areas belonged to the same clusters (C3). Further, isolates from pond and river water were grouped in clusters C27 and C46, respectively with isolates from wastewater samples in rural areas.
Fig 2

Dendrogram generated by BioNumerics software, showing distances calculated by the Dice similarity index of ERIC-PCR banding patterns of E. coli strains isolated from various aquatic samples.

The degree of similarity (%) is shown on the scale. The isolates were considered as phylogenetically related based on 85% similarity in ERIC-PCR banding patterns.

Dendrogram generated by BioNumerics software, showing distances calculated by the Dice similarity index of ERIC-PCR banding patterns of E. coli strains isolated from various aquatic samples.

The degree of similarity (%) is shown on the scale. The isolates were considered as phylogenetically related based on 85% similarity in ERIC-PCR banding patterns.

Discussion

In Bangladesh, fluro(quinolones) is one of the most frequently used antibiotic classes in both human and veterinary medicine although the major usage is in animal husbandry where it is applied as a feed supplement for prophylaxis and growth promotion [13-16]. A recent report indicates that few farmers use ciprofloxacin for bacterial disease prevention in aquaculture in Bangladesh [52]. Aquatic environments are more likely, therefore, to be contaminated with residual fluro(quinolones) via effluents from both human and animal wastes which may be contributing to the high prevalence of fluoroquinolone resistance in bacterial organisms. In particular, PMQR genes along with ESBL and carbapenemase encoding genes are likely to be carried by the same plasmids that can be shared with other organisms in aquatic environments by horizontal transmission. Except for one investigation of 12 E. coli isolates from water samples reporting 4 positives for qnrS, no other study has characterised environmental isolates for PMQR in Bangladesh [37]. In this study, we found that a significant proportion (66%) of water samples were positive for E. coli carrying PMQR genes, predominantly qnrS. This percentage would have been greater if more than one isolate per sample had been selected. Interestingly, previous studies reported a higher prevalence of qnrS in E. coli isolates from patients with extraintestinal infections, and from poultry cloacal samples in Bangladesh [35, 36]. It is likely that bacterial isolates harboring qnrS from both clinical and poultry sources might be released to the water bodies through human or animal waste due to lack of proper wastewater treatment facilities in Bangladesh [53]. In contrast to our study, studies in other countries such as China, Switzerland, and Poland showed that aac(6’)-lb-cr was the predominant PMQR gene in E. coli isolates from aquatic samples [34, 54–56]. Further investigations of the isolates using a comparative genomic approach will provide more insights into the characteristics of isolates driving this discriminate distribution of PMQR genes. In the present study, more than 65% of the PMQR positive isolates were resistant to multiple antibiotics including penicillin, cephalosporins, fluro(quinolones), sulfonamides aminoglycosides and carbapenems. A high prevalence of MDR could be associated with the wide range of antibiotics used in the poultry and aquaculture sectors which increase selection pressures for AMR in water bodies. Different mechanisms can be involved in the emergence of MDR E. coli strains such as: 1) shared resistance mechanisms that occur for the antimicrobial agents in the same category, e.g., mutations in penicillin-binding protein and presence of the ß-lactamases. This can also occur for antibiotics in different classes due to the presence of efflux pumps acting on different antibiotics; 2) exposure to multiple antibiotics via routine use of combination therapy and repeated treatment failure and 3) the presence of plasmids that carry resistance genes to multiple antibiotics. We found that the presence of PMQR genes, particularly qnr, in E. coli isolates was associated with the ESBL phenotype (p<0.001) and various β-lactamase encoding genes including blaCMY, blaCTX-M-1, blaCMY, blaTEM and blaOXA-1. This can be explained by carriage of both qnr and ESBL/AmpC genes in the same plasmids as reported by previous studies [57-59]. Apart from qnr, other PMQR genes such as oqxAB were found to associate significantly with blaSHV whereas aac(6’)-lb-cr was associated with blaOXA-1 and blaOXA-47. This finding concurs with earlier reports that indicated the co-occurrence of oqxAB with blaSHV and aac(6’)-lb-cr with blaOXA-1 and blaOXA-47 [59, 60]. The presence of both PMQR and ESBL genes in the same bacterial isolates could be due to the co-selection of isolates in the environment with either of fluoroquinolone or cephalosporins which accentuate further confirmation. Extensive use of quinolones therefore may lead to the emergence of resistance against β-lactams which are important clinically used antibiotics. Integrons are important mobile genetic elements that carry different antibiotic resistance gene cassettes and play a crucial role in AMR transmission via horizontal gene transfer between different bacterial species [61]. Class 1 integron (int1) is most studied and reported ubiquitously in different enterobacterial species including E. coli [62]. In our study, qnrB and qepA were associated with the presence of int1 (Fig 1) indicating that these genes might be in the gene cassette carried by the integrons. Previous study reported that int1 in E. coli carried gene cassettes encoding resistance to multiple antibiotics including β-lactams (blaOXA-30), trimethoprim (dfrA1, dfrA5, dfrA7, dfrA12, dfrA17), aminoglycosides (aadA1, aadA2, aadA5), chloramphenicol (cmlA) and erythromycin (ereA2) [63]. Findings from our study highlight the need for further investigation to identify whether PMQR genes are located in the class 1 integron of the isolates using whole genome sequencing. In this work, ERIC-PCR analysis revealed that the PMQR-positive isolates were mostly heterogeneous although a small number of isolates from different sources of water or locations had identical banding patterns indicating their clonal relationship. It could be that certain clonal groups of PMQR-positive ESBL-producing E. coli were predominantly present in the waterbodies, however, further characterization of these clones using next generation sequencing would be useful. Further, comparison of these isolates with clinical isolates could be done to understand the contribution of these widely circulating clones on the burden of antimicrobial resistant infections in the community.

Conclusions

Our study shows a high prevalence of PMQR-positive E. coli in urban and rural waters. These plasmid-mediated isolates were mostly MDR, predominantly ESBL-producing and genetically heterogeneous. The high prevalence of plasmid-mediated quinolone resistance poses a risk for horizontal gene transfer and this, in association with ESBL genes, adds to the threat of AMR transmission via the environment. This study highlights the importance of including surface waters and wastewaters in One Health AMR surveillance programs to understand the emergence and transmission dynamics of AMR and for designing environmental intervention strategies. 25 Oct 2021 PONE-D-21-32725Prevalence and characterization of plasmid mediated quinolone resistance (PMQR) in E. coli isolated from aquatic environments of BangladeshPLOS ONE Dear Dr. Amin, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== ACADEMIC EDITOR: Please revise the manuscript according to the reviewer comments.A major revision is required..============================== Please submit your revised manuscript by Dec 09 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Abdelazeem Mohamed Algammal, Prof, Ph.D Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: "This research was funded by the Antimicrobial Resistance Cross Council Initiative supported by the seven research councils in partnership with the Department of Health and Department for Environment Food & Rural Affairs (NERC/ BBSRC/MRC grant number: NE/N019555/1). " We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "This research was funded by the Antimicrobial Resistance Cross Council Initiative supported by the seven research councils in partnership with the Department of Health and Department for Environment Food & Rural Affairs (NERC/ BBSRC/MRC grant number: NE/N019555/1). Dr. Emily Rousham received this grant." Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. Please amend the manuscript submission data (via Edit Submission) to include author Homaun Kabir Chowdhury. 5. Please amend either the abstract on the online submission form (via Edit Submission) or the abstract in the manuscript so that they are identical. 6. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Comments to authors: - The current study is interesting; however, the authors should address the following comments to improve the quality of the manuscript: - The manuscript should be revised for language editing and grammar mistakes. Title: I think the work would benefit from the title that contains the main conclusion of the study (should be derived from the conclusion). Please modify the title. Abstract: - The abstract must illustrate the used methods and the most prevalent results (give more hints about methods and results). Besides, rephrase the main conclusion of your findings. Introduction: (it needs to be more informative) -Give a hint about different infection caused by E. coli, virulence factors, and the mechanism of disease occurrence. - The authors should illustrate the public health importance concerning the emergence of multidrug-resistant (MDR) bacterial pathogens that reflecting the necessity of new potent and safe antimicrobial agents. Several studies proved the widespread MDR- bacterial pathogens; Authors could add the following paragraph: Multidrug resistance has been increased all over the world that is considered a public health threat. Several recent investigations reported the emergence of multidrug-resistant bacterial pathogens from different origins including humans, birds, cattle, and fish that increase the need for routine application of the antimicrobial susceptibility testing to detect the antibiotic of choice as well as the screening of the emerging MDR strains. You should cite the following valuable studies: 1.PMID: 33177849 2.PMID: 32497922 3.PMID:33061472 4.PMID: 33947875 5.PMID: 32472209 6.PMID: 31170450 7.PMID: 33188216 8. Abouelmaatti, R. et al. (2013): Cloning and analysis of Nile tilapia Toll-like receptors type-3 mRNA: Centr. Eur. J. Immunol; 38 (3): 277-282. DOI: https://doi.org/10.5114/ceji.2013.3774020 9.PMID: 30150182 10. PMID: 34445951 -Rephrase the aim of the work to be clear and better sound. Material and methods -Add the following title to the Methods section: Isolation and identification of E. coli: • Discuss in detail the methods of isolation and identification of E. coli. Besides, specific references should be added. •Add the company, city, and country of the used bacterial media and reagents that were used in the biochemical identification of isolates. Also, enumerate all used biochemical reactions. - Illustrate in a new table primers sequences and cycling conditions of PCR based detection of plasmid mediated quinolone resistance genes - Antimicrobial susceptibility testing: •Illustrate the antimicrobial classes of the tested antimicrobial agents. •The authors are advised to classify the tested isolates to MDR or XDR as described by Magiorakos et al. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012; 18:268–81. doi:10.1111/j.1469-0691.2011.03570.x. - Where are the accession numbers of the sequenced PMQR genes???? -Add more data about the used software in the statistical analyses? -Result: -Illustrate the phenotypic characteristics of the recovered -Illustrate the phenotypic characteristics of E. coli. -Illustrate in a new table the occurrence of MDR (Multidrug resistance) among the recovered isolates (illustrate the names of the antimicrobial classes and different antibiotics): No. of strains%Type of resistance R OR MDR OR XDRPhenotypic multidrug resistance (Antimicrobial classes and different antibiotics). The antibiotic -resistance genes - Where are the figures of the phylogenetic analysis?? -Discussion: - The authors are advised to illustrate the real impact of their findings without repetition of results. -Illustrate the different mechanisms of antimicrobial resistance in E. coli. -Conclusion - Should be rephrased to be sounded. A real conclusion should focus on the question or claim you articulated in your study, which resolution has been the main objective of your paper? Reviewer #2: - The current study has a significant impact, but it needs a major revision: - The manuscript should be revised for grammar mistakes. - Please write the scientific names of bacterial pathogens and genes in the correct form all over the manuscript and in the References section (should be italic). -The title is broad, please modify the title. - Add more details about the used methods and most prevalent results in the abstract. -In the introduction: discuss the public health importance of the E. coli and different infections caused by them. -Improve the aim of work. Methods: -Explain the methods of isolation and identification in detail?? -Specific references should be added to all the used methods and techniques. -Add the manufacturing company, city, and country for the used reagents and antimicrobial discs. - Add the accession numbers of the sequenced PMQR genes (necessary). --Results: - Discuss in detail the phenotypic characters of the isolated E. coli strains. - Increase the resolutions of all figures in the main manuscript. -You must support your results with the figures of the phylogenetic analysis. -Discussion: - Please improve (Avoid repetition of results) -Please improve the main conclusion of the manuscript. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 12 Dec 2021 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf Response: We have revised and formatted accordingly now. 2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section Response: We have corrected the funding information and award number in Funding information. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: "This research was funded by the Antimicrobial Resistance Cross Council Initiative supported by the seven research councils in partnership with the Department of Health and Department for Environment Food & Rural Affairs (NERC/ BBSRC/MRC grant number: NE/N019555/1). " We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "This research was funded by the Antimicrobial Resistance Cross Council Initiative supported by the seven research councils in partnership with the Department of Health and Department for Environment Food & Rural Affairs (NERC/ BBSRC/MRC grant number: NE/N019555/1). Dr. Emily Rousham received this grant." Please include your amended statements within your cover letter; we will change the online submission form on your behalf. Response: We have removed the funding information from the manuscript and included the funding statement in the cover letter as follows: This research was funded by the Antimicrobial Resistance Cross Council Initiative supported by the seven research councils in partnership with the Department of Health and Department for Environment Food & Rural Affairs (NERC/ BBSRC/MRC grant number: NE/N019555/1). 4. Please amend the manuscript submission data (via Edit Submission) to include author Homaun Kabir Chowdhury. Response: We have incorporated the author via Edit Submission. 5. Please amend either the abstract on the online submission form (via Edit Submission) or the abstract in the manuscript so that they are identical. Response: We have revised the abstract in the manuscript and amended the abstract via Edit Submission to make them identical. 6. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript. Response: We have moved the ethics statement in the method section of the manuscript. (Line: 118-120) [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes Response: Thank you for your appreciation.________________________________________ 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes Response: Thank you for the comments.________________________________________ 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No Reviewer #2: Yes Response: We have included all the data in the manuscript and also in data availability statement in detail. ________________________________________ 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes Response: We have revised the entire manuscript including data presentation, English correction according to your comments.________________________________________ 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Comments to authors: - The current study is interesting; however, the authors should address the following comments to improve the quality of the manuscript: Response: Thank you for your comment on our manuscript. - The manuscript should be revised for language editing and grammar mistakes. Response: we have revised the entire manuscript for English by our co-author, Dr. Emily Rousham who is a British professor at Loughborough University, UK. Title: I think the work would benefit from the title that contains the main conclusion of the study (should be derived from the conclusion). Please modify the title. Response: We have modified the titles highlighting our main results. (Line:1-3) Abstract: - The abstract must illustrate the used methods and the most prevalent results (give more hints about methods and results). Besides, rephrase the main conclusion of your findings. Response: We have expanded the method section in the abstract and also incorporated more results. Finally, we rephrased the conclusion in abstract. (Line:19-50) Introduction: (it needs to be more informative) -Give a hint about different infection caused by E. coli, virulence factors, and the mechanism of disease occurrence. Response: Thank for your comments. We have included information about diseases caused by E. coli and its severity when E. coli becomes multi-drug resistant in nature. (Line:58-63;) - The authors should illustrate the public health importance concerning the emergence of multidrug-resistant (MDR) bacterial pathogens that reflecting the necessity of new potent and safe antimicrobial agents. Several studies proved the widespread MDR- bacterial pathogens; Authors could add the following paragraph: Multidrug resistance has been increased all over the world that is considered a public health threat. Several recent investigations reported the emergence of multidrug-resistant bacterial pathogens from different origins including humans, birds, cattle, and fish that increase the need for routine application of the antimicrobial susceptibility testing to detect the antibiotic of choice as well as the screening of the emerging MDR strains. You should cite the following valuable studies: 1.PMID: 33177849 2.PMID: 32497922 3.PMID:33061472 4.PMID: 33947875 5.PMID: 32472209 6.PMID: 31170450 7.PMID: 33188216 8. Abouelmaatti, R. et al. (2013): Cloning and analysis of Nile tilapia Toll-like receptors type-3 mRNA: Centr. Eur. J. Immunol; 38 (3): 277-282. DOI: https://doi.org/10.5114/ceji.2013.3774020 9.PMID: 30150182 10. PMID: 34445951 Response: Thank you for the important references. We have cited most of these publications. (Line:63-66) -Rephrase the aim of the work to be clear and better sound. Response: We rephrased the aim of the study according to your suggestion. (Line:111-116) Material and methods -Add the following title to the Methods section: Isolation and identification of E. coli: • Discuss in detail the methods of isolation and identification of E. coli. Besides, specific references should be added. Response: We have added this heading to the method section. (Line:135-149). •Add the company, city, and country of the used bacterial media and reagents that were used in the biochemical identification of isolates. Also, enumerate all used biochemical reactions. Response: Thank you for your comment. We have added company, city and country name for media, reagents and equipment used in this study. (Line:137-138, 143, 148-149, 160-162, 171, 189, 205-206) - Illustrate in a new table primers sequences and cycling conditions of PCR based detection of plasmid mediated quinolone resistance genes Response: A new table entitled “List of Primer sequences used in multiplex PCR for the determination of PMQR determinants” has been inserted. (Line:155) - Antimicrobial susceptibility testing: •Illustrate the antimicrobial classes of the tested antimicrobial agents. •The authors are advised to classify the tested isolates to MDR or XDR as described by Magiorakos et al. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012; 18:268–81. doi:10.1111/j.1469-0691.2011.03570.x. Response: We have classified the tested E. coli isolates according to Magiorakos et al. and described susceptibility patterns against different classes of antibiotics in a new table entitled “Occurrence of clinically important antibiotic resistance among PMQR positive E. coli isolates from aquatic environments in Bangladesh”. (Line:175-179; 235-245) - Where are the accession numbers of the sequenced PMQR genes???? Response: We have submitted the sequences to the GeneBank and received the accession numbers: qnrS (OL439745), qnrB (OL439744), oqxAB (OK668389), qepA (OK668390) and aac(6’)-lb-cr (OL439743). (Line:). However, the numbers are not yet released in the web as it takes time after processing by GeneBank team. (Line:165-167) -Add more data about the used software in the statistical analyses? Response: We have revised the statistical analysis section with more information. (Line:189-197) -Result: -Illustrate the phenotypic characteristics of the recovered -Illustrate the phenotypic characteristics of E. coli. Response: We have described the phenotypic characteristics of E. coli isolates in result section as follows (Line:211-219): Isolates were identified as E. coli based on their morphology and biochemical characteristics. Microscopically, the bacteria appeared as Gram-negative moderate size, motile, and non-sporulated rods. The bacteria grew well on mTEC agar and appeared as red/magenta color colonies due to β-D-glucuronidase activity which is highly specific for E. coli. On MacConkey agar, bacteria produced characteristic pink colonies due to lactose fermentation. Biochemically, all isolates were positive for catalase, lactose fermentation, indole and methyl-red, tests. Simultaneously, they were negative for cytochrome oxidase, Voges-Proskauer, citrate-utilization, H2S production, and urease tests. All 300 water samples were positive for E. coli. -Illustrate in a new table the occurrence of MDR (Multidrug resistance) among the recovered isolates (illustrate the names of the antimicrobial classes and different antibiotics): No. of strains%Type of resistance R OR MDR OR XDR Phenotypic multidrug resistance (Antimicrobial classes and different antibiotics). The antibiotic -resistance genes Response: We have inserted a new table entitled “Occurrence of clinically important antibiotic resistance among PMQR positive E. coli isolates from aquatic environments in Bangladesh” where data on MDR and XDR strains %, resistance % against different antibiotic classes were included according to Magiorakos et al. (Line:235-245) - Where are the figures of the phylogenetic analysis?? Response: We have analysed phylogenetic relatedness of the PMQR positive isolates using ERIC-PCR and generated a dendrogram to determine their clonal relationships. (Line:277-290) -Discussion: - The authors are advised to illustrate the real impact of their findings without repetition of results. Response: We appreciate this comment. We have revised the discussion section substantially according to your comment. (Line:292-355). -Illustrate the different mechanisms of antimicrobial resistance in E. coli. Response: we have briefly described the different resistance mechanisms in E. coli in discussion section. (Line:319-325). -Conclusion - Should be rephrased to be sounded. A real conclusion should focus on the question or claim you articulated in your study, which resolution has been the main objective of your paper? Response: We thank the reviewer for this comment. We revamped the conclusion section to address the reviewers concern (lines:357-363). The new conclusion read as follows: Our study shows a high prevalence of PMQR-positive E. coli in urban and rural waters. These plasmid-mediated isolates were mostly MDR, predominantly ESBL-producing and genetically heterogeneous. The high prevalence of plasmid-mediated quinolone resistance poses a risk for horizontal gene transfer and this, in association with ESBL genes, adds to the threat of AMR transmission via the environment. This study highlights the importance of including surface waters and wastewaters in One Health AMR surveillance programs to understand the emergence and transmission dynamics of AMR and for designing environmental intervention strategies. Reviewer #2: - The current study has a significant impact, but it needs a major revision: - The manuscript should be revised for grammar mistakes. Response: Thank you for your comment. We have revised the entire manuscript and checked English grammar carefully. - Please write the scientific names of bacterial pathogens and genes in the correct form all over the manuscript and in the References section (should be italic). Response: We have correctly written scientific names of all pathogens and genes throughout the manuscript including reference section. -The title is broad, please modify the title. Response: We have modified the title and made it specific. (Line:1-3) - Add more details about the used methods and most prevalent results in the abstract. Response: We have elaborated the methods and most prevalent results in the abstract. (Line:19-50) -In the introduction: discuss the public health importance of the E. coli and different infections caused by them. Response: We have described the public health importance of E. coli and infections caused by this organism. (Line:53-57,59-63) -Improve the aim of work. Response: We have revised the aim of the work. (Line:111-116) Methods: -Explain the methods of isolation and identification in detail?? Response: We have included a separate section on the isolation and identification of E. coli in the method section. (Line:135-149) -Specific references should be added to all the used methods and techniques. Response: We have added references to all the used methods and techniques. (Line:147) -Add the manufacturing company, city, and country for the used reagents and antimicrobial discs. Response: We have provided company, city and country information for all the reagents, media and equipment used in the study. (Line:137-138, 143, 148-149, 160-162, 171, 189, 205-206) - Add the accession numbers of the sequenced PMQR genes (necessary). Response: We have submitted the sequences to the GeneBank and received the accession numbers: qnrS (OL439745), qnrB (OL439744), oqxAB (OK668389), qepA (OK668390) and aac(6’)-lb-cr (OL439743). (Line:). However, the numbers are not yet released in the web as it takes time after processing by GeneBank team. (Line:165-167) --Results: - Discuss in detail the phenotypic characters of the isolated E. coli strains. Response: We have described the phenotypic characteristics of E. coli isolates in result section in Line 211-219 as follows: Isolates were identified as E. coli based on their morphology and biochemical characteristics. Microscopically, the bacteria appeared as Gram-negative moderate size, motile, and non-sporulated rods. The bacteria grew well on mTEC agar and appeared as red/magenta colour colonies due to β-D-glucuronidase activity which is highly specific for E. coli. On MacConkey agar, bacteria produced characteristic pink colonies due to lactose fermentation. Biochemically, all isolates were positive for catalase, lactose fermentation, indole and methyl-red, tests. Simultaneously, they were negative for cytochrome oxidase, Voges-Proskauer, citrate-utilization, H2S production, and urease tests. All 300 water samples were positive for E. coli. - Increase the resolutions of all figures in the main manuscript. Response: we have increased the resolution (300dpi) of all figures used in this study. -You must support your results with the figures of the phylogenetic analysis. Response: We have analysed phylogenetic relatedness of the PMQR positive isolates using ERIC-PCR and generated a dendrogram to determine their clonal relationships. (Line:277-290) -Discussion: - Please improve (Avoid repetition of results) Response: we have revised the discussion section substantially according to your comment. (Line:292-355) -Please improve the main conclusion of the manuscript. Response: We have modified the conclusion of the manuscript in Line:357-363 as follows: Our study shows a high prevalence of PMQR-positive E. coli in urban and rural waters. These plasmid-mediated isolates were mostly MDR, predominantly ESBL-producing and genetically heterogeneous. The high prevalence of plasmid-mediated quinolone resistance poses a risk for horizontal gene transfer and this, in association with ESBL genes, adds to the threat of AMR transmission via the environment. This study highlights the importance of including surface waters and wastewaters in One Health AMR surveillance programs to understand the emergence and transmission dynamics of AMR and for designing environmental intervention strategies. ________________________________________ Submitted filename: Response to Reviewers.docx Click here for additional data file. 15 Dec 2021 High prevalence of plasmid-mediated quinolone resistance (PMQR) among E. coli from aquatic environments in Bangladesh PONE-D-21-32725R1 Dear Dr. Amin, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Abdelazeem Mohamed Algammal, Prof, Ph.D Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors have carried out significant changes to the manuscript. They have addressed all the suggested corrections and comments. Really, it's an interesting study that has a significant impact. Now, the manuscript could be accepted. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No 19 Dec 2021 PONE-D-21-32725R1 High prevalence of plasmid-mediated quinolone resistance (PMQR) among E. coli from aquatic environments in Bangladesh Dear Dr. Amin: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Professor Abdelazeem Mohamed Algammal Academic Editor PLOS ONE
  53 in total

Review 1.  Gene flow, mobile genetic elements and the recruitment of antibiotic resistance genes into Gram-negative pathogens.

Authors:  Hatch W Stokes; Michael R Gillings
Journal:  FEMS Microbiol Rev       Date:  2011-05-20       Impact factor: 16.408

2.  Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase.

Authors:  Ari Robicsek; Jacob Strahilevitz; George A Jacoby; Mark Macielag; Darren Abbanat; Chi Hye Park; Karen Bush; David C Hooper
Journal:  Nat Med       Date:  2005-12-20       Impact factor: 53.440

3.  Occurrence and genetic characteristics of mcr-1-positive colistin-resistant E. coli from poultry environments in Bangladesh.

Authors:  Mohammed Badrul Amin; Ajrin Sultana Sraboni; Muhammed Iqbal Hossain; Subarna Roy; Tim Amin Uddin Mozmader; Leanne Unicomb; Emily K Rousham; Mohammad Aminul Islam
Journal:  J Glob Antimicrob Resist       Date:  2020-04-25       Impact factor: 4.035

4.  qnrB, another plasmid-mediated gene for quinolone resistance.

Authors:  George A Jacoby; Kelley E Walsh; Debra M Mills; Victoria J Walker; Herin Oh; Ari Robicsek; David C Hooper
Journal:  Antimicrob Agents Chemother       Date:  2006-04       Impact factor: 5.191

Review 5.  Integrons.

Authors:  Guillaume Cambray; Anne-Marie Guerout; Didier Mazel
Journal:  Annu Rev Genet       Date:  2010       Impact factor: 16.830

6.  Direct comparison of four bacterial source tracking methods and use of composite data sets.

Authors:  E A Casarez; S D Pillai; J B Mott; M Vargas; K E Dean; G D Di Giovanni
Journal:  J Appl Microbiol       Date:  2007-08       Impact factor: 3.772

7.  New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate.

Authors:  Kunikazu Yamane; Jun-Ichi Wachino; Satowa Suzuki; Kouji Kimura; Naohiro Shibata; Haru Kato; Keigo Shibayama; Toshifumi Konda; Yoshichika Arakawa
Journal:  Antimicrob Agents Chemother       Date:  2007-06-04       Impact factor: 5.191

8.  Quinolone resistance mechanisms among extended-spectrum beta-lactamase (ESBL) producing Escherichia coli isolated from rivers and lakes in Switzerland.

Authors:  Katrin Zurfluh; Helga Abgottspon; Herbert Hächler; Magdalena Nüesch-Inderbinen; Roger Stephan
Journal:  PLoS One       Date:  2014-04-22       Impact factor: 3.240

9.  PMQR genes oqxAB and aac(6')Ib-cr accelerate the development of fluoroquinolone resistance in Salmonella typhimurium.

Authors:  Marcus H Wong; Edward W Chan; Li Z Liu; Sheng Chen
Journal:  Front Microbiol       Date:  2014-10-02       Impact factor: 5.640

10.  Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China.

Authors:  Lei Yan; Dan Liu; Xin-Hua Wang; Yunkun Wang; Bo Zhang; Mingyu Wang; Hai Xu
Journal:  Sci Rep       Date:  2017-01-17       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.