Literature DB >> 34962918

c-Jun N-terminal kinase (JNK) signaling contributes to cystic burden in polycystic kidney disease.

Abigail O Smith1, Julie A Jonassen2, Kenley M Preval1, Roger J Davis1, Gregory J Pazour1.   

Abstract

Polycystic kidney disease is an inherited degenerative disease in which the uriniferous tubules are replaced by expanding fluid-filled cysts that ultimately destroy organ function. Autosomal dominant polycystic kidney disease (ADPKD) is the most common form, afflicting approximately 1 in 1,000 people. It primarily is caused by mutations in the transmembrane proteins polycystin-1 (Pkd1) and polycystin-2 (Pkd2). The most proximal effects of Pkd mutations leading to cyst formation are not known, but pro-proliferative signaling must be involved for the tubule epithelial cells to increase in number over time. The c-Jun N-terminal kinase (JNK) pathway promotes proliferation and is activated in acute and chronic kidney diseases. Using a mouse model of cystic kidney disease caused by Pkd2 loss, we observe JNK activation in cystic kidneys and observe increased nuclear phospho c-Jun in cystic epithelium. Genetic removal of Jnk1 and Jnk2 suppresses the nuclear accumulation of phospho c-Jun, reduces proliferation and reduces the severity of cystic disease. While Jnk1 and Jnk2 are thought to have largely overlapping functions, we find that Jnk1 loss is nearly as effective as the double loss of Jnk1 and Jnk2. Jnk pathway inhibitors are in development for neurodegeneration, cancer, and fibrotic diseases. Our work suggests that the JNK pathway should be explored as a therapeutic target for ADPKD.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34962918      PMCID: PMC8746764          DOI: 10.1371/journal.pgen.1009711

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   5.917


Introduction

Autosomal dominant polycystic kidney disease (ADPKD) is the most common form of inherited kidney disease, afflicting approximately 1 in 1,000 people in the United States and worldwide. Patients with ADPKD exhibit gradual kidney function decline due to uncontrolled epithelial cell proliferation and secretion that transforms narrow uriniferous tubules into large, fluid-filled cysts. The majority of ADPKD cases are due to mutations in either of two transmembrane proteins, polycystin-1 (Pkd1) and polycystin-2 (Pkd2), that form a heterotetrameric complex in the primary ciliary membranes [1] It is widely believed that perturbing this ciliary complex, either by loss-of-function mutations or disrupting cilia structure triggers the cellular phenotype that leads to cyst formation [2-4] Although the precise mechanism by which the polycystin complex preserves tubule architecture remains obscure, some aspects of pro-cystic signaling have been established. For example, Pkd1 or Pkd2 loss leads to reduced intracellular calcium and, subsequently, an abnormal cellular response to cyclic adenosine monophosphate (cAMP) levels [5-7] In mutant epithelial cells, elevated cAMP promotes increased fluid secretion and epithelial cell proliferation [8] cAMP reduction via vasopressin 2 receptor antagonism is the mechanism of action of tolvaptan, the single FDA-approved drug for patients with ADPKD [9,10] Unfortunately, tolvaptan slows but does not halt disease progression and is not appropriate for all ADPKD patients due to side effects [11] To improve treatments for ADPKD, we must search for alternative pro-cystic signaling pathways. Prior studies showed that the c-Jun N-terminal kinase (JNK) signaling pathway is activated in cells overexpressing exogenous Pkd1 [12,13] or Pkd2 [14] constructs. A later study found the opposite, that Pkd1 loss activated JNK signaling, while Pkd1 overexpression repressed JNK activity [15] Reports of JNK activity in cystic tissues are also conflicting [16,17], and no follow-up studies established JNK’s role in cyst formation. JNK is a member of the MAP kinase family, which also includes Erk1/2, p38, and Erk5. JNK pathway activators include extracellular stimuli such as UV irradiation, osmotic stress, and cytokines that initiate an intracellular phosphorylation cascade through upstream MAP kinase kinase kinases (MAP3K). Jnk-associated MAP3Ks converge on two MAP kinase kinases (MAP2Ks), Mkk4 and Mkk7. The MAP2Ks phosphorylate MAP kinases including the Jnk paralogs: Jnk1 (Mapk8), Jnk2 (Mapk9), and Jnk3 (Mapk10). Jnk1 and Jnk2 are ubiquitously expressed, while Jnk3 expression is restricted primarily to the central nervous system and testis [18] Although Jnks have a wide array of substrates, the most studied are the activator protein-1 (AP-1) transcription factors, particularly c-Jun, for which the pathway is named. Increased AP-1 levels have been detected in cystic kidneys in humans and mice [16] Furthermore, AP-1 promotes proliferation and cell survival by regulating oncogene transcription [19] including c-Myc, which was recently shown to contribute directly to cystic kidney disease [20,21] JNK activation has been detected in many forms of kidney disease [22] In animal models, JNK inhibition prior to ischemia-reperfusion or tubule obstruction reduces inflammation and fibrosis, and preserves kidney function [23-27] Interestingly, acute kidney injury exacerbates polycystic kidney disease [28-30] In chronic kidney insult, progressive interstitial fibrosis contributes to organ failure. JNK inhibition reduces pro-fibrotic factors in the kidney [26,27] Furthermore, researchers produced severe kidney fibrosis in mice by overexpressing the JNK target c-Jun [31] This study aimed to investigate the role of JNK signaling in ADPKD using in vivo models to genetically perturb the pathway. Here we show that Pkd2 deletion increases JNK activation, which contributes to cystic kidneys in young animals and cystic liver in older animals. Jnk1 is more important to the phenotype development than is Jnk2. Overall, our results encourage further investigation of the JNK pathway as a novel therapeutic candidate for treating ADPKD.

Methods

Ethics statement

These studies were approved by the Institutional Animal Care and Use Committee of the University of Massachusetts Chan Medical School Protocol 201900265 (A-1174).

Mouse studies

The following mouse strains have been described previously: Pkd2 [32], Jnk1 [33], Jnk2 [34], Rosa26-Cre [35], Ask1 [36], Mlk2 [37] and Mlk3 [38]. The Ask1 (B6.129S4-Map3k5) mouse was provided by the RIKEN BRC through the National Bio-Resource Project of MEXT, Japan. Stra8-iCre [39] was used to convert Jnk1 to Jnk1. All mice were C57BL/6J congenics maintained by backcrossing to C57BL/6J purchased from Jackson Laboratory (Bar Harbor Maine, USA). For juvenile onset disease model, mothers were dosed with tamoxifen (200 mg/kg) by oral gavage on postnatal days 2, 3, and 4. The pups remained with nursing mothers until euthanasia at postnatal day 21. For the adult-onset disease model, animals were treated with tamoxifen (50 mg/kg) by intraperitoneal injection on postnatal days 21, 22, and 23. Mice were euthanized 24 weeks after first injection. Both sexes were used in all studies.

Histology

Tissues were fixed by immersion overnight in 10% formalin (Electron Microscopy Sciences) in phosphate-buffered saline and then embedded in paraffin. Sections were deparaffinized and stained with hematoxylin and eosin (H&E) or one-step trichrome. Images of stained sections were obtained with a Zeiss Axio Scan.Z1 slide scanner with brightfield capabilities using the 20X objective. Cystic index was calculated using ImageJ software to outline kidney sections, apply a mask to differentiate cystic from non-cystic regions, and measure the two-dimensional areas. Cystic index = cystic area/total kidney area x 100%. For immunofluorescent staining, sections were deparaffinized, antigens were retrieved by autoclaving for 30 min in 10 mM sodium citrate, pH 6.0 and stained with primary antibodies diluted in TBST (10 mM Tris, pH 7.5, 167 mM NaCl, and 0.05% Tween 20) plus 0.1% cold water fish skin gelatin (Sigma-Aldrich). Alexa Fluor–labeled secondary antibodies (Invitrogen) were used to detect the primary antibodies. Primary antibodies used included aquaporin 2 (1:100; Sigma # 5200110), phospho S63 c-Jun (1:1000, Cell Signaling Technology), phospho S10 histone H3 (1:250; Millipore # 06570), SMA (1:50,000, Sigma # A5228), collagen (1:250 Abcam ab260043). FITC-conjugated lectins were added with secondary antibodies: Lotus tetragonolobus agglutinin (LTA, 1:50, Vector Labs) and Dolichos biflorus agglutinin (DBA, 1:20, Vector Labs). Nuclei were labeled with 4′,6-diamidino-2-phenylindole (DAPI). Fluorescent images were obtained with a Zeiss LSM900+ Airyscan microscope. Fluorescent slide scans were obtained using Zeiss Axio Scan.Z1 slide scanner.

Gene expression

Kidneys were stored at -80C in RNAlater (Qiagen) until RNA was isolated. For total RNA isolation, tissues were homogenized using TissueLyser II (Qiagen) and RNA isolated using the RNeasy Mini Kit (Qiagen). cDNA was synthesized using SuperScript II Reverse Transcription (Invitrogen). Real time quantitative PCR was performed with KAPA SYBR FAST Universal reagent (Roche) using an Eppendorf Realplex2 cycler. All qPCR reactions were performed in triplicate and melting curves verified that a single product was amplified. Standard curves were generated by 5-fold serial dilutions of a pool of untreated mouse kidney cDNA, and for each gene, the threshold cycle was related to log cDNA dilution by linear regression analysis. Gene expression data were normalized to glyceraldehyde-3-phosphate dehydrogenase expression. The following primers were used: Pkd2 forward CGAGGAGGAGGATGACGAAGAC; Pkd2 reverse TGGAAACGATGCTGCCAATGGA; Gapdh forward GCAATGCATCCTGCACCACCA; Gapdh reverse TTCCAGAGGGGCCATCCACA.

Immunoblotting

For Fig 1 only, kidneys stored in RNAlater were homogenized in Buffer RLT (RNeasy MiniKit, Qiagen). Protein was precipitated from the supernatant by adding 9 volumes of 100% methanol, collected by centrifugation at 3,000xg for 10 min at 4C followed by three washes in 90% methanol. Protein pellets were reconstituted in 2X SDS-PAGE loading buffer. In all other experiments, frozen kidneys were homogenized in ice-cold RIPA buffer (150 mM NaCl, 1% Triton X-100, 0.05% sodium deoxycholate, 0.01% SDS, 50 mM Tris-HCl, pH 7.5) supplemented with Complete Mini EDTA-free Protease Inhibitor cocktail tablets (Roche), sodium orthovanadate (0.5 mM), sodium fluoride (10 mM), and phenylmethylsulfonyl fluoride (1 mM). Equal amounts of protein were loaded and separated in 12% SDS-PAGE gels and transferred to Immobilon-FL PVDF membranes (Millipore). Membranes were blocked for 1 hour at room temperature with Intercept (TBS) Blocking Buffer (Li-Cor) or 5% non-fat dry milk in TBST followed by incubation with primary antibodies overnight at 4C.
Fig 1

Postnatal deletion of Pkd2 activates JNK signaling in juvenile mouse kidneys.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl). (A) Kidney sections were probed for tubule epithelial markers LTA (proximal tubules) and aquaporin-2 (collecting ducts). Nuclei were marked by DAPI. Images are slide scans obtained on Zeiss Axio Scan.Z1 with 20X objective. Scale bar is 500 microns. (B) Whole kidney protein samples were immunoblotted for total Jnk, phospho T183/Y185 Jnk, total c-Jun, phospho S63 c-Jun, and loading control Gapdh. (C-F) Quantification of immunoblots described in (B). N is 7 (Con), 6 (Pkd2). ****, P < 0.0001; **, P < 0.01; ns, not significant by unpaired two-tailed t-test. Error bars indicate SD.

Postnatal deletion of Pkd2 activates JNK signaling in juvenile mouse kidneys.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl). (A) Kidney sections were probed for tubule epithelial markers LTA (proximal tubules) and aquaporin-2 (collecting ducts). Nuclei were marked by DAPI. Images are slide scans obtained on Zeiss Axio Scan.Z1 with 20X objective. Scale bar is 500 microns. (B) Whole kidney protein samples were immunoblotted for total Jnk, phospho T183/Y185 Jnk, total c-Jun, phospho S63 c-Jun, and loading control Gapdh. (C-F) Quantification of immunoblots described in (B). N is 7 (Con), 6 (Pkd2). ****, P < 0.0001; **, P < 0.01; ns, not significant by unpaired two-tailed t-test. Error bars indicate SD. The following antibodies were used: JNK1/2 (1:1000, BD Pharmingen # 554285), c-Jun (1:200, Santa Cruz Biotechnology # 74543), phospho T183/Y185 SAPK/JNK (1:1000, Cell Signaling Technology # 9251), phospho S63 c-Jun (1:1000, Cell Signaling Technology # 9261), glyceraldehyde-3-phosphate dehydrogenase (1:10,000, Proteintech, 60004-1-Ig), SMA (1:1,000, Sigma # A5228), glyceraldehyde-3-phosphate dehydrogenase (1:1,000, Cell Signaling Technology # 3683S), phospho T180/Y182 p38, (Cell Signaling Technology # 9211). Primary antibodies were detected using near infrared secondary antibodies (Li-Cor) and blots were imaged on Odyssey Li-Cor imager. Quantification was performed using Image Studio Lite software.

Results

Postnatal deletion of Pkd2 activates JNK signaling in juvenile mouse kidneys

To assess JNK signaling in an in vivo ADPKD model, we induced Pkd2 deletion in postnatal mice by the tamoxifen inducible RosaCreERT2 driver. This widely expressed Cre causes gene deletion in most cells, including kidney tubule epithelium as well as immune and other cells of the kidney [40,41] We administered tamoxifen via maternal oral gavage on postnatal (P) days 2–4 and harvested on P21. Treating Pkd2 flox (fl) homozygotes (Rosa26-Cre; Pkd2) resulted in extensive kidney cysts. In contrast, heterozygous mice (Rosa26-Cre; Pkd2) similarly treated, exhibited no cysts and thus served as controls (Fig 1A). Total Jnk protein in Pkd2 mutant kidneys was unchanged compared to controls but phosphorylated Jnk was significantly increased (Fig 1B–1D). These antibodies recognize both Jnk1 and Jnk2, each of which is alternatively spliced to generate 54 kDa and 46 kDa products (S3A Fig). Pkd2 loss did not significantly alter total c-Jun levels, but did elevate phosphorylated c-Jun (Fig 1B, 1E and 1F). Our findings indicate that Pkd2 deletion activates JNK signaling and could drive cyst formation.

JNK inhibition reduces severity of cystic phenotype in juvenile Pkd2 mutant mice

Our finding that the loss of Pkd2 activates JNK signaling could indicate that JNK activation drives cyst formation, or cyst formation could activate JNK signaling. To distinguish these possibilities, we tested how JNK inhibition affects cyst formation driven by Pkd2 loss. Mice express three Jnk paralogs. Jnk1 and Jnk2 are widely expressed including in kidney, while Jnk3 is limited to brain and testis [18] Thus, we focused on Jnk1 and Jnk2. Losing both genes causes embryonic lethality. To circumvent lethality, we intercrossed parents carrying germline Jnk2 deletions and floxed Jnk1 alleles with Pkd2; Rosa26-Cre alleles used previously. Offspring, carrying assorted alleles, were treated with tamoxifen by maternal transfer on P2-4, harvested on P21, and genotyped (Fig 2). Pkd2 heterozygotes carrying any number of wild-type Jnk alleles had normal kidney to body weight and no evidence of structural abnormalities or cysts. Kidneys lacking Pkd2 but carrying at least one wild-type allele of Jnk1 and Jnk2 showed severe cystic disease similar to Pkd2 deletion alone. Kidneys lacking Pkd2 and all functional Jnk alleles had a 23% reduction in two-kidney to body weight and a 16% reduction in cystic index (Fig 2B and 2C). Hematoxylin and eosin (H&E) stained mid-sagittal sections revealed large cysts at the cortical-medullary boundary and smaller cysts in the cortex and medulla in Pkd2 mutants with intact JNK activity. Jnk deletion reduced cysts in the cortex and medulla. Cysts remained at the cortical-medullary boundary but were less extensive (Fig 2A). Importantly, Jnk inactivation had no significant effect on kidney architecture, two-kidney to body weight or cystic index of Pkd2 heterozygotes in the time period we examined (Fig 2A–2C). Our observation that Jnk deletion reduces disease severity supports the hypothesis that JNK activation contributes to cystic disease.
Fig 2

JNK inhibition reduces kidney cysts in juvenile Pkd2 mutant mice.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Jnk (Rosa26-CreERT2; Pkd2fl/+; Jnk1fl/fl; Jnk2null/null), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), and Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections from P21 mice were stained with H&E to show the extent of disrupted organ architecture. Scale bar is 500 microns and applies to all images in the panel. (B) Cystic burden was quantified using the ratio of 2-kidney weight / body weight x 100%. N is 42 (Con), 12 (Jnk), 88 (Pkd2), 39 (Pkd2-Jnk). ****, P < 0.0001 by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (C) Cystic index (cystic area / total kidney area x 100%) was calculated for mid-sagittal H&E-stained kidney sections. N is 16 (Con), 8 (Jnk), 27 (Pkd2), 30 (Pkd2-Jnk). ****, P < 0.0001 by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

JNK inhibition reduces kidney cysts in juvenile Pkd2 mutant mice.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Jnk (Rosa26-CreERT2; Pkd2fl/+; Jnk1fl/fl; Jnk2null/null), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), and Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections from P21 mice were stained with H&E to show the extent of disrupted organ architecture. Scale bar is 500 microns and applies to all images in the panel. (B) Cystic burden was quantified using the ratio of 2-kidney weight / body weight x 100%. N is 42 (Con), 12 (Jnk), 88 (Pkd2), 39 (Pkd2-Jnk). ****, P < 0.0001 by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (C) Cystic index (cystic area / total kidney area x 100%) was calculated for mid-sagittal H&E-stained kidney sections. N is 16 (Con), 8 (Jnk), 27 (Pkd2), 30 (Pkd2-Jnk). ****, P < 0.0001 by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. We observed variability in kidney to body weight in Pkd2 mutants (Fig 2B). We hypothesized that this was due to variation in Pkd2 levels after Cre-mediated deletion. To test our hypothesis, we measured Pkd2 mRNA levels by RT-qPCR and normalized to Gapdh. Non-cystic controls (Rosa26-Cre; Pkd2) used throughout this study, are expected to have about one half as much Pkd2 message as Cre-negative animals and this was observed (S1A Fig). Cystic groups (Rosa26-Cre; Pkd2) with or without JNK activity showed reduced Pkd2 mRNA levels compared to non-cystic controls but the reduction did not reach significance due to variation between animals. Importantly, we found similar variation and no difference in mean Pkd2 mRNA levels in Pkd2 mutants with and without Jnk alleles. This finding indicates that the difference in cystic burden between Pkd2 mutants with and without JNK activity is not due to systematic differences in Pkd2 levels. Plotting cystic burden vs. Pkd2 mRNA levels for individual kidney samples shows that for a given Pkd2 level, Jnk-deleted mutants tend to have a lower cystic burden than mutants with intact Jnk signaling (S1B Fig). However, this relationship did not reach statistical significance given the variation in Pkd2 levels in both groups. Multiple upstream MAP3Ks activate JNK. Identifying and inhibiting relevant MAP3Ks in the context of cystic kidney disease could be therapeutically beneficial. To this end, we selected three MAP3K genes, Ask1 (Map3k5), Mlk2 (Map3k10), and Mlk3 (Map3k11), with connections to kidney disease for further analysis. Ask1 inhibition reduces kidney and liver fibrosis [42] Cdc42 and Rac1 mediate JNK activation in the context of polycystin overexpression in cells [12,14] and activate Mlk2 and Mlk3 [37,43,44] However, in our model, Ask1 deletion (S2A Fig) or double deletion of Mlk2 and Mlk3 (S2B Fig) did not reduce cystic burden in Pkd2 mutants. Thus, identifying relevant MAP3Ks will require further investigation.

Pkd2 deletion activates the transcription factor c-Jun in kidney tubule epithelial cells

The c-Jun subunit of the AP-1 transcription factor complex is dually phosphorylated by Jnk on serines 63 and 73 [45] To detect nuclear-localized phosphorylated c-Jun, indicating JNK activation, we probed kidney sections for phospho S63 c-Jun. In control kidneys, we found no positive nuclei in proximal tubule cells (defined by LTA staining) or collecting duct cells (defined by DBA staining) (Fig 3). Cystic kidneys due to Pkd2 loss exhibited extensive phospho S63 c-Jun nuclear staining in both proximal tubules and collecting ducts. Consistent with most cysts in this model deriving from collecting ducts, we observed more phospho S63 c-Jun positive cells in DBA-positive tubules compared to LTA-positive tubules. Jnk deletion reduced phospho S63 c-Jun positive cells nearly to control levels (Fig 3). Our findings confirm that JNK activation occurs in the tubule epithelium and correlates positively with regions of increased cyst formation.
Fig 3

Pkd2 deletion activates c-Jun in kidney tubule epithelial cells.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), and Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections were probed for phospho S63 c-Jun and tubule epithelial markers LTA (proximal tubules) or DBA (collecting ducts). Examples of non-cystic and cystic collecting ducts are shown. Nuclei were marked by DAPI. Images are maximum projection of z-stacks (20 slices at 0.5um intervals) obtained on Zeiss LSM 900 Airyscan microscope with 40X objective. Scale bar is 20 microns and applies to all images in the panel. (B-C) Quantification of the proportion of tubule epithelial cells with nuclei positive for phospho S63 c-Jun. (B) Proximal tubules (LTA+) and (C) collecting ducts (DBA+) were quantified separately. N is 5 animals per group, 1000–2000 cells per animal. ****, P < 0.0001; ***, P< 0.001; *, P < 0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

Pkd2 deletion activates c-Jun in kidney tubule epithelial cells.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), and Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections were probed for phospho S63 c-Jun and tubule epithelial markers LTA (proximal tubules) or DBA (collecting ducts). Examples of non-cystic and cystic collecting ducts are shown. Nuclei were marked by DAPI. Images are maximum projection of z-stacks (20 slices at 0.5um intervals) obtained on Zeiss LSM 900 Airyscan microscope with 40X objective. Scale bar is 20 microns and applies to all images in the panel. (B-C) Quantification of the proportion of tubule epithelial cells with nuclei positive for phospho S63 c-Jun. (B) Proximal tubules (LTA+) and (C) collecting ducts (DBA+) were quantified separately. N is 5 animals per group, 1000–2000 cells per animal. ****, P < 0.0001; ***, P< 0.001; *, P < 0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

JNK inhibition reduces tubule epithelial cell proliferation in juvenile Pkd2 mutant mice

Cyst growth depends on tubule epithelial cell proliferation, and a recent study found differential expression of cell cycle genes in Pkd2 mutant mouse kidneys [46] To determine whether Jnk deletion reduces tubule cell proliferation in Pkd2 mutant kidneys, we probed tissue sections for the mitotic marker phospho S10 histone H3 (Fig 4). As expected, Pkd2 mutant kidneys showed markedly increased proliferation compared to controls. Proximal tubule cell proliferation nearly doubled from 2.3% in control kidneys to 4.3% in Pkd2 kidneys. Jnk deletion returned the rate to control levels (Fig 4B). In collecting ducts, proliferation was nearly ten times higher in Pkd2 mutants compared to controls and Jnk deletion reduced proliferation by 43% (Fig 4C). These findings suggest that JNK inhibition reduces cyst formation by inhibiting tubule epithelial cell proliferation.
Fig 4

JNK inhibition reduces tubule cell proliferation in juvenile Pkd2 mutant mice.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), and Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections from P21 mice were probed for the mitotic marker phospho S10 histone H3 along with tubule epithelial markers LTA (proximal tubules) and DBA (collecting ducts). Nuclei were marked with DAPI. Images are maximum projection of z-stacks (10 slices at 0.5um intervals) obtained on Zeiss LSM 900 Airyscan microscope with 20X objective. Scale bar is 50 microns and applies to all images in the panel. (B-C) Quantification of the proportion of tubule cells with nuclei positive for phospho S10 histone H3. (B) Proximal tubule cells (LTA+) and (C) collecting duct cells (DBA+) were quantified separately. N is 5 animals per group, 1000–2000 cells per animal. ****, P < 0.0001; ***, P< 0.001; *, P < 0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

JNK inhibition reduces tubule cell proliferation in juvenile Pkd2 mutant mice.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), and Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections from P21 mice were probed for the mitotic marker phospho S10 histone H3 along with tubule epithelial markers LTA (proximal tubules) and DBA (collecting ducts). Nuclei were marked with DAPI. Images are maximum projection of z-stacks (10 slices at 0.5um intervals) obtained on Zeiss LSM 900 Airyscan microscope with 20X objective. Scale bar is 50 microns and applies to all images in the panel. (B-C) Quantification of the proportion of tubule cells with nuclei positive for phospho S10 histone H3. (B) Proximal tubule cells (LTA+) and (C) collecting duct cells (DBA+) were quantified separately. N is 5 animals per group, 1000–2000 cells per animal. ****, P < 0.0001; ***, P< 0.001; *, P < 0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

JNK inhibition reduces fibrosis in juvenile Pkd2 mutant mice

JNK signaling promotes interstitial fibrosis in non-cystic kidney disease models [25,26] As fibrosis also contributes to advanced cystic kidney disease [47], we hypothesized that Jnk deletion may reduce fibrosis in Pkd2 mutants. To measure fibrosis, we stained kidney sections for alpha-smooth muscle actin (SMA), a marker of active myofibroblasts (Fig 5). As expected, SMA staining was restricted to perivascular regions in control kidneys. In contrast, Pkd2 mutants exhibited significant SMA expression surrounding cystic and non-cystic tubules while Pkd2 mutants lacking JNK activity showed reduced SMA staining (Fig 5A) and SMA protein levels (Fig 5C and 5D). It is possible that fibrosis is reduced in Jnk-deleted mutants secondary to their reduction in cystic burden. To better understand this, we plotted cystic index vs. SMA intensity (Fig 5B). As expected, SMA intensity correlated positively with cystic index. However, the slope of the relationship was diminished in Pkd2 mutants that lacked JNK activity. While the difference between the two slopes did not reach statistical significance (P = 0.055), the trend suggests that JNK inhibition affects myofibroblast activation independently from cystic burden.
Fig 5

JNK inhibition reduces fibrosis in juvenile Pkd2 mutant mice.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), and Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections from P21 mice were probed for SMA, a marker of active fibroblasts. Nuclei were stained with DAPI. Images were obtained on Zeiss Axio Scan.Z1 with 20X objective. Scale bar is 100 microns. (B) SMA intensity was compared to cystic index for 10 animals per group. SMA mean intensity was measured using ImageJ software and divided by non-cystic area (mean intensity / non-cystic area x 100,000). Cystic index (cystic area / total area x 100%) was determined for DAPI staining using Image J software. Linear regression analysis shows that the difference between slopes for Pkd2 (y = 0.07x-2) and Pkd2-Jnk (y = 0.01x+0.5) approaches but does not reach significance (P = 0.055). (C) Whole kidney protein samples from P21 mice were immunoblotted for SMA and loading control Gapdh. (D) Quantification of immunoblots described in (C). N is 3 animals per groups. ****, P < 0.0001 by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

JNK inhibition reduces fibrosis in juvenile Pkd2 mutant mice.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), and Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections from P21 mice were probed for SMA, a marker of active fibroblasts. Nuclei were stained with DAPI. Images were obtained on Zeiss Axio Scan.Z1 with 20X objective. Scale bar is 100 microns. (B) SMA intensity was compared to cystic index for 10 animals per group. SMA mean intensity was measured using ImageJ software and divided by non-cystic area (mean intensity / non-cystic area x 100,000). Cystic index (cystic area / total area x 100%) was determined for DAPI staining using Image J software. Linear regression analysis shows that the difference between slopes for Pkd2 (y = 0.07x-2) and Pkd2-Jnk (y = 0.01x+0.5) approaches but does not reach significance (P = 0.055). (C) Whole kidney protein samples from P21 mice were immunoblotted for SMA and loading control Gapdh. (D) Quantification of immunoblots described in (C). N is 3 animals per groups. ****, P < 0.0001 by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

Jnk1 is primarily responsible for reducing cystic disease in juvenile Pkd2 mutant kidneys

Jnk1 and Jnk2 are largely redundant in development but their roles diverge in adult tissues in a complex manner that is incompletely understood, yet critical for developing JNK inhibitor therapies [48,49] To determine how each Jnk gene contributes to cysts, we crossed parents carrying Pkd2; Rosa26-Cre alleles and germline Jnk2 or Jnk1 alleles. We treated mice as in Fig 2. Collagen staining with trichrome and anti-collagen 1A revealed that Pkd2 heterozygotes were non-cystic with normal collagen deposition (Fig 6A). In contrast, Pkd2 mutants contained large cysts at the cortical-medullary boundary and smaller cysts throughout. Collagen deposits were notable at the outer medulla and cyst boundaries. As shown in Fig 2, complete JNK deletion reduced cortical-medullary cysts. Collagen staining was visible but reduced. Pkd2 mutants lacking only Jnk1 exhibited fewer cysts and less fibrosis than Pkd2 mutants with intact JNK. In contrast, Pkd2 mutants lacking only Jnk2 resembled cystic Pkd2 mutants with JNK signaling intact. Kidney to body weight ratios and cystic indices support the histological evidence that Jnk1 deletion reduces cysts more than Jnk2 deletion (Fig 6B and 6C).
Fig 6

Jnk1 deletion rather than Jnk2 is primarily responsible for reducing cystic disease in juvenile Pkd2 mutant kidneys.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Pkd2-Jnk1 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1null/null; Jnk2+/+); Pkd2-Jnk2 (Rosa26-CreERT2; Pkd2fl/fl; JNK1+/+; Jnk2null/null). We compared the results from these animals to the groups described previously: Con (Rosa26-CreERT2; Pkd2fl/+, JNK1+/+; Jnk2+/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; JNK1+/+; Jnk2+/+), Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections were stained with one-step trichrome which marks collagen fibers pale green, cytoplasm red, and nuclei dark blue. Scale bar for full size kidney scans is 500 microns. Trichrome insets show detail from inner medulla. Scale bar is 100 microns and applies to all images in the row. Additional kidney sections were probed using anti-collagen 1 antibody. Nuclei were marked by DAPI. Fluorescent images are maximum projection of z-stacks (6 slices at 0.5um intervals) obtained on Zeiss LSM 900 Airyscan microscope with 10X objective. Scale bar is 100 microns and applies to all images in the row. (B) Cystic burden was quantified using the ratio of 2-kidney weight / body weight x 100%. Con and Pkd2-Jnk data is the same as shown in Fig 2B. Pkd2 data overlaps with Fig 2B, but only includes animals with four wild-type alleles of Jnk. N is 42 (Con), 17 (Pkd2), 39 (Pkd2-Jnk), 8 (Pkd2-Jnk1), 16 (Pkd2-Jnk2). ****, P < 0.0001; ***, P< 0.001; **, P < 0.01; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (C) Cystic index (cystic area / total kidney area * 100%) was calculated for mid-sagittal trichrome-stained kidney sections. N is 5 animals per group. ***, P< 0.001; *, P < 0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (D) Whole kidney protein lysates were immunoblotted for total c-Jun, phospho S63 c-Jun and loading control Gapdh. (E) Quantification of immunoblots described in (D). N is 3 animals per group. ****, P < 0.0001; ***, P< 0.001; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

Jnk1 deletion rather than Jnk2 is primarily responsible for reducing cystic disease in juvenile Pkd2 mutant kidneys.

Mice with the following genotypes were treated with tamoxifen by maternal transfer at P2-4 and collected at P21: Pkd2-Jnk1 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1null/null; Jnk2+/+); Pkd2-Jnk2 (Rosa26-CreERT2; Pkd2fl/fl; JNK1+/+; Jnk2null/null). We compared the results from these animals to the groups described previously: Con (Rosa26-CreERT2; Pkd2fl/+, JNK1+/+; Jnk2+/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; JNK1+/+; Jnk2+/+), Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Kidney sections were stained with one-step trichrome which marks collagen fibers pale green, cytoplasm red, and nuclei dark blue. Scale bar for full size kidney scans is 500 microns. Trichrome insets show detail from inner medulla. Scale bar is 100 microns and applies to all images in the row. Additional kidney sections were probed using anti-collagen 1 antibody. Nuclei were marked by DAPI. Fluorescent images are maximum projection of z-stacks (6 slices at 0.5um intervals) obtained on Zeiss LSM 900 Airyscan microscope with 10X objective. Scale bar is 100 microns and applies to all images in the row. (B) Cystic burden was quantified using the ratio of 2-kidney weight / body weight x 100%. Con and Pkd2-Jnk data is the same as shown in Fig 2B. Pkd2 data overlaps with Fig 2B, but only includes animals with four wild-type alleles of Jnk. N is 42 (Con), 17 (Pkd2), 39 (Pkd2-Jnk), 8 (Pkd2-Jnk1), 16 (Pkd2-Jnk2). ****, P < 0.0001; ***, P< 0.001; **, P < 0.01; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (C) Cystic index (cystic area / total kidney area * 100%) was calculated for mid-sagittal trichrome-stained kidney sections. N is 5 animals per group. ***, P< 0.001; *, P < 0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (D) Whole kidney protein lysates were immunoblotted for total c-Jun, phospho S63 c-Jun and loading control Gapdh. (E) Quantification of immunoblots described in (D). N is 3 animals per group. ****, P < 0.0001; ***, P< 0.001; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. Immunoblots revealed increased c-Jun phosphorylation in Pkd2 mutants (Fig 6D and 6E). Combined Jnk1 and Jnk2 deletion reduced phospho S63 c-Jun to near control levels. Jnk1 deletion also reduced phospho S63 c-Jun to near control levels while Jnk2 deletion did not. Our findings complement a recent study in which Jnk1 deletion, but not Jnk2 deletion, limited ischemia-reperfusion injury in mouse kidneys [23] To measure Jnk isoform expression and phosphorylation, we probed immunoblots with antibodies against total and phosphorylated Jnk (S3A Fig). Two independent splicing events generate four isoforms each from Jnk1 and Jnk2. One site regulates inclusion of mutually exclusive exon 7a/7b, however these forms are not distinguishable by immunoblot. The other dictates choice of a C-terminal coding exon yielding long (p54) and short (p46) isoforms of both Jnk1 and Jnk2, which can be distinguished by immunoblot (S3A Fig). Dual phosphorylation at Thr-Pro-Tyr activates all Jnk isoforms [50,51], and we detected increased phosphorylation of p54 and p46 in Pkd2 mutant kidneys (S3A and S3C Fig). Jnk2 deletion alone reduced p54 and phospho-p54 as effectively as total Jnk deletion. However, Jnk1 deletion had no effect, suggesting p54 derives mostly from Jnk2. Total p46 was reduced by the double loss of both Jnk isoforms and by the single loss of Jnk2 but was not greatly affected by the loss of Jnk1. In contrast, phospho-p46 was reduced by the double loss and by the loss of Jnk1 suggesting that most of the phosphorylated form of p46 derives from Jnk1 even though Jnk2 produces most of this isoform. We detected a third band (p45), whose phosphorylation was elevated in all Pkd2 mutants including those lacking Jnk1 or Jnk2. The observation that p45 remains in both Jnk1 and Jnk2 mutants suggests that it can be generated from either gene perhaps through a yet undescribed splicing event or a post translational modification. Alternatively, p45 could arise from antibody cross-reactivity with a different protein. Possibly, MAP kinase p38, as p38’s phosphorylation pattern matches p45 (S3D Fig) however, p38 migrates faster than p45 making this unlikely. Our results show that Pkd2 loss induces phosphorylation of long and short isoforms of Jnk1 and Jnk2 with the loss of phospho-Jnk1 p46 correlating best with disease protection.

JNK deletion reduces severity of cystic liver disease in adult Pkd2 mutant mice

Inhibiting JNK signaling reduced cystic kidney disease in a rapidly progressing model of ADPKD. However, humans with ADPKD accumulate cysts over decades. Thus, we wanted to evaluate JNK signaling in a slowly progressing disease model. In mice, timing of cystic gene deletion determines rate of disease progression. Pkd1 loss prior to P13 causes cyst accumulation within weeks, while deletion after P14 delays cysts for 5–6 months [52,53] For our slow-progressing model, we delivered tamoxifen at P21-23. Pkd2 mutants aged 6 months showed no signs of kidney cysts in histological sections or by 2-kidney to body weight ratios (S4 Fig). Segregation by sex revealed no differences between Pkd2 mutants with or without Jnk (S5 Fig). We expect that Pkd2 mutants would develop kidney cysts at older ages based on evidence from Pkd1 models [52], but severe liver findings (Fig 7) precluded further aging.
Fig 7

JNK inhibition reduces cysts in in adult Pkd2 mutant livers.

Mice with the following genotypes were treated with tamoxifen at P21-23 and collected 24 weeks later: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Liver sections were stained with one-step trichrome to mark collagen fibers pale green, cytoplasm red, and nuclei dark blue. Black boxes indicate magnified regions. Scale bar is 1000 microns for full size liver scans, 100 microns for insets. (B) Gross morphology of cystic livers. Centimeter ruler is shown. (C) Cystic burden in the liver was quantified using the ratio of liver weight / body weight x 100%. N is 8 (Con), 31 (Pkd2), 38 (Pkd2-Jnk). ****, P < 0.0001; ***, P < 0.001 by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD.

JNK inhibition reduces cysts in in adult Pkd2 mutant livers.

Mice with the following genotypes were treated with tamoxifen at P21-23 and collected 24 weeks later: Con (Rosa26-CreERT2; Pkd2fl/+), Pkd2 (Rosa26-CreERT2; Pkd2fl/fl; Jnk1+/+, fl/+; Jnk2+/+, +/-), Pkd2-Jnk (Rosa26-CreERT2; Pkd2fl/fl; Jnk1fl/fl; Jnk2null/null). (A) Liver sections were stained with one-step trichrome to mark collagen fibers pale green, cytoplasm red, and nuclei dark blue. Black boxes indicate magnified regions. Scale bar is 1000 microns for full size liver scans, 100 microns for insets. (B) Gross morphology of cystic livers. Centimeter ruler is shown. (C) Cystic burden in the liver was quantified using the ratio of liver weight / body weight x 100%. N is 8 (Con), 31 (Pkd2), 38 (Pkd2-Jnk). ****, P < 0.0001; ***, P < 0.001 by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. Polycystic liver disease is the most common extrarenal ADPKD symptom [54] Interestingly, despite lacking kidney cysts, adult Pkd2 mutants contained numerous biliary liver cysts. Livers were enlarged and indurated, with visible fluid-filled cysts causing a yellowish hue (Fig 7B). Trichrome staining showed extensive cystic and fibrotic changes throughout, with rare areas of healthy tissue. We observed numerous small and occasional large cysts, frequently surrounded by collagen (Fig 7A). JNK inhibition significantly improved liver cysts, reducing liver to body weight ratio by 38% (Fig 7C). Polycystic liver disease is more prevalent in females than males [55], but all mice in our study developed liver cysts after Pkd2 deletion with no difference between males and females (S5 Fig). JNK-deleted cystic livers were smaller and remained indurated and pale (Fig 7B) with reduced cysts and fibrosis (Fig 7A). In addition to driving cyst progression in juvenile Pkd2 mutant kidneys, JNK signaling also contributes to cyst progression in adult Pkd2 mutant livers.

Discussion

Improving ADPKD treatment requires understanding signaling downstream of the polycystins. We investigated JNK’s role in promoting cysts due to Pkd2 loss and found that disrupting JNK signaling reduced kidney cysts in juvenile mice and liver cysts in adult mice. Our findings invite further exploration of JNK as a therapeutic target for ADPKD. JNK inhibitors have successfully treated liver and kidney disease in animals [24-26,56-58]. Unfortunately, toxic effects ended multiple human clinical trials [59] suggesting that JNK inhibition would not be appropriate in chronic conditions like ADPKD. However, it is expected that the loss of Pkd2 would activate a MAP3K upstream of JNK. MAP3K inhibitors are in development as clinical reagents, and these do not show the toxic effects of Jnk inhibitors [60-64] making them more appropriate for ADPKD. Of course, identification of the relevant MAP3K is required. Mouse and human genomes encode 24 MAP3Ks, with at least 14 known to phosphorylate Mkk4 or Mkk7 upstream of Jnks [18,65] Our studies suggest that Ask1, Mlk2 and Mlk3 are not relevant, leaving the critical MAP3K still to be identified. Understanding how the polycystin complex regulates JNK activity is an important question. MAPK signaling is typically activated by receptor tyrosine kinases, G-protein coupled receptors (GPCRs) and other membrane proteins detecting stress, cytokines, growth factors and other agonists. Polycystins can function as atypical GPCRs to activate heterotrimeric G proteins [13,15,66]. AP-1 and JNK activity are increased in HEK-293T cells upon transfection with membrane-targeted PKD1 constructs. Expression of dominant negative heterotrimeric G proteins abrogated the activation, while wild type G protein expression augmented it supporting a role for GPCRs and heterotrimeric G-proteins in JNK activation [13]. Alternatively, less direct mechanisms such as altered calcium signaling could be involved as calcium levels regulate JNK activity [67]. Polycystin-1 activates calcium influx after binding Wnt ligands [68] and polycystin mutations are known to reduce cellular calcium levels [5]. Signals are often propagated from the receptor to the MAP3Ks by the action of Rac1 and Cdc42, but other mechanisms are also used. For example, Ask1 is inhibited by binding thioredoxin, which disrupted by oxidative stress [69]. Work from Arnould et al. in cultured cells, showed that overexpression of Pkd2 or the C-terminal tail of Pkd1 can activate JNK and this was blocked by dominant negative mutations of Rac1 and Cdc42 [12,14] suggesting that signaling by small G proteins transmits the signal from the polycystins to Jnk. However, these experiments utilized over expression of the polycystins to activate JNK, while cystic disease is thought to be driven by reduced polycystin activity. Overexpression of the polycystins causes cyst formation, but it is not certain that the same mechanism drives cystic growth in both cases [70,71]. Gene expression profiles of cystic kidneys extensively overlap with kidney injury profiles [72]. In animal models, kidney injury activates JNK in the tubule epithelium and JNK inhibition prior to kidney injury reduces inflammation and fibrosis, and preserves kidney function [23-27]. Importantly, kidney injury exacerbates polycystic kidney disease [28-30]. Our data showing reduced cystic burden with JNK loss suggests that JNK is in the pathway that leads to cyst initiation or expansion. It is possible that JNK activation is a response to the kidney injury caused by cyst growth. Injury-induced JNK activation may exacerbate or perpetuate tubule cell proliferation in a “feed-forward” mechanism. Further investigation of this theory would include kidney injury in Pkd knockout mice. Supporting evidence would consist of attenuation of accelerated cyst growth in JNK-inhibited animals. Regardless, the observation that JNK loss/inhibition reduces the severity of disease caused by loss of polycystin-2 or kidney injury indicates that JNK is important to the pathology of cystic disease. The protective effect of JNK inhibition on cystic disease is driven by Jnk1. Jnk1 and Jnk2 are structurally similar [50] and have overlapping functions. However, evidence suggests distinct and even opposing roles for Jnks in tissue homeostasis and cancer [73,74]. Functional differences between Jnk1 and Jnk2 may be due to alternative processing of their transcripts. Two independent splicing events produce four distinct isoforms of both genes. One event alters the open reading frame at the C-terminus [50] and has unknown consequences to protein function. Another event dictates inclusion of mutually exclusive exons 7a/7b within the kinase domain and appears to affect kinase activity [75]. Jnk splicing in mouse kidney is uncharacterized, but the Jnk1 and Jnk2 produced in kidney may contain different versions of exon 6, which could influence isoform activity or substrate specificity. 94% of ADPKD patients develop hepatic cysts by their fourth decade, but most remain asymptomatic [76] Rarely, severe liver involvement requires surgery to reduce liver volume [55,77] In our adult model of Pkd2 deletion, we found extensive liver cysts after six months, without detectable kidney cysts. Similarly, liver cysts were detected earlier than kidney cysts in an adult mouse model of Cre-mediated Pkd1 deletion [52] In our model, Jnk deletion suppressed hepatic cysts. An important caveat to our results is that we did not test the effect of chronic Jnk inhibition in adult animals with functional Pkd2. A previous study demonstrated a requirement of Jnk for hepatic cyst formation in models of mitochondrial redox stress-induced cholangiocarcinoma [78] However, this role of JNK to promote cystogenesis appears to be dependent on physiological context because Jnk deletion alone was sufficient to cause hepatic cyst formation in another study of aged mice [79-81] JNK signaling may have tissue-specific roles in ADPKD that will be important to evaluate for therapeutic development. Our work demonstrates that Pkd2 loss activates JNK and genetic removal of Jnk reduces cystic burden in mice with Pkd2 mutations. Further studies will elucidate the pathway by which polycystin loss leads to JNK dysregulation, but our work suggests that JNK pathway inhibitors should be explored as treatment for ADPKD.

Variation in Pkd2 mRNA levels is similar in Pkd2 mutants with or without Jnk.

(A) Total RNA was extracted from P21 kidneys. Pkd2 mRNA levels were determined by RT-qPCR and normalized to Gapdh. All animals were treated with tamoxifen by maternal oral gavage on P2-4. The groups consist of Cre-negative animals (N = 8), Pkd2 heterozygotes with any number of Jnk alleles (Rosa26-Cre; Pkd2) (N = 5), Pkd2 mutants with at least one wild type allele of Jnk1 and Jnk2 (Rosa26-Cre; Pkd2) (N = 15), and Pkd2 mutants with no functional Jnk alleles (Rosa26-Cre; Pkd2; Jnk1; Jnk2) (N = 12). ****, P < 0.0001; ***, P < 0.001; *, <0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (B) Data from A replotted against 2-kidney to body weight. Pkd2 mRNA levels were plotted against 2-kidney to body weight for individual Pkd2 mutants with at least one wild type allele of Jnk1 and Jnk2 (PKD2, N = 15) or lacking all functional Jnk alleles (PKD2-JNK, N = 12). Each group was analyzed by simple linear regression. For a given reduction in Pkd2 mRNA, mutants lacking Jnk tend to have a lower cystic burden. However, the slopes of the two lines were not statistically significantly different. PKD2: Y = -0.1212*X + 1.240, PKD2-JNK: Y = -0.1593*X + 1.312. (TIF) Click here for additional data file.

Deletion of MAP3 Kinases Ask1, Mlk2 and Mlk3 is not sufficient to reduce kidney cysts in juvenile Pkd2 mutant mice.

Mice with the following genotypes were treated with tamoxifen at P2-4 and collected at P21: Con (Rosa26-Cre; Pkd2), Pkd2 (Rosa26-Cre; Pkd2), Pkd2-Ask1 (Rosa26-Cre; Pkd2; Ask1) and Pkd2-Mlk2/3 (Rosa26-Cre; Pkd2; Mlk2; Mlk3). (A) Cystic burden was quantified using the ratio of 2-kidney weight / body weight x 100%. N is 17 (Con), 25 (Pkd2), 23 (Pkd2-Ask1). ****, P < 0.0001; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (B) Cystic burden was quantified using the ratio of 2-kidney weight / bodyweight x 100%. N is 12 (Con), 23 (Pkd2), 11 (Pkd2-Mlk2/3). ****, P < 0.0001; ***, P < 0.001; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (TIF) Click here for additional data file.

Pkd2 loss induces phosphorylation of long and short isoforms of Jnk1 and Jnk2.

Mice described in Fig 2: Con (Rosa26-Cre; Pkd2), Pkd2 (Rosa26-Cre; Pkd2; JNK1; Jnk2), Pkd2-Jnk (Rosa26-Cre; Pkd2; Jnk1; Jnk2) Mice described in Fig 6: Pkd2-Jnk1 (Rosa26-Cre; Pkd2; Jnk1; Jnk2); Pkd2-Jnk2 (Rosa26-Cre; Pkd2; JNK1; Jnk2). (A) Whole kidney protein lysates were immunoblotted for total Jnk, phospho T183/Y185 Jnk, and loading control Gapdh. The diagram (left) depicts the primary known isoforms of Jnk1 and Jnk2, as well as a putative isoform of Jnk1. Both Jnk1 and Jnk2 can be alternatively spliced to form four variants. Incorporation of the mutually exclusive exon pair 7a/7b in the kinase domain does not affect size of the protein, but alternative splicing at the C-terminus can produce either long (p54) or short (p46) forms that can be distinguished by immunoblot. Colored arrows indicate corresponding isoforms on the blot. These represent our predictions of which isoforms are present in each band. The black arrows correspond to a band of unknown identity (p45) which we quantified separately. (B-C) Quantification of immunoblots described in (A). N is 3 animals per group. Due to low sample number, differences in total Jnk isoform levels did not reach statistical significance in most cases and are not displayed. For phosphorylated Jnk isoforms, we indicate the significance of each group compared to Pkd2 mutants. Phospho-p45 nearly reached significance with p = 0.058. **, P < 0.01; *, P < 0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (D) The kidney lysates described in (A) were immunoblotted for phospho T180/Y182 p38 and loading control Gapdh. (TIF) Click here for additional data file.

Kidney cysts do not develop within 6 months of adult Pkd2 deletion.

Mice with the following genotypes were treated with tamoxifen at P21-23 and collected 24 weeks later: Con (Rosa26-Cre; Pkd2), Pkd2 (Rosa26-Cre; Pkd2; Jnk1; Jnk2), Pkd2-Jnk (Rosa26-Cre; Pkd2; Jnk1; Jnk2). (A) Kidney sections were stained with one-step trichrome to mark collagen fibers pale green, cytoplasm red, and nuclei dark blue. Scale bar is 1000 microns for full size kidney scans, 100 microns for insets. (B) Cystic burden in the kidney was quantified using the ratio of 2-kidney / body weight x 100%. N is 8 (Con), 31 (Pkd2), 38 (Pkd2-Jnk). ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (TIF) Click here for additional data file.

Sex does not influence severity of cystic phenotype in adult Pkd2 mutant mice.

Mice with the following genotypes were treated with tamoxifen at P21-23 and collected 24 weeks later: Con (Rosa26-Cre; Pkd2), Pkd2 (Rosa26-Cre; Pkd2; Jnk1; Jnk2), Pkd2-Jnk (Rosa26-Cre; Pkd2; Jnk1; Jnk2). (A) Body weight of adult Pkd2 mutant mice, segregated by sex. Females: N is 3 (Con), 15 (Pkd2), 19 (PKD2-JNK). Males: N is 5 (Con), 16 (Pkd2), 19 (Pkd2-Jnk). ****, P < 0.0001; **, P < 0.01; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (B-C) 2-kidney weight and 2-kidney to body weight (%) of adult Pkd2 mutant mice, segregated by sex. Females: N is 3 (Con), 15 (Pkd2), 19 (PKD2-JNK). Males: N is 5 (Con), 16 (Pkd2), 19 (Pkd2-Jnk). ****, P < 0.0001; ***, P < 0.001; **, P < 0.01; *, P < 0.05; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (D-E) Liver weight and liver to body weight (%) of adult Pkd2 mutant mice, segregated by sex. Females: Females: N is 3 (Con), 15 (Pkd2), 19 (PKD2-JNK). Males: N is 5 (Con), 16 (Pkd2), 19 (Pkd2-Jnk). ****, P < 0.0001; **, P < 0.01; ns, not significant by one-way ANOVA followed by Tukey multiple comparison test with multiplicity-adjusted p-values. Error bars indicate SD. (TIF) Click here for additional data file. 24 Aug 2021 Dear Dr Pazour, Thank you very much for submitting your Research Article entitled 'c-Jun N-terminal kinase (JNK) signaling contributes to cystic burden in polycystic kidney disease' to PLOS Genetics. The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers were generally favorable, but raised some concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a revised version. We cannot, of course, promise publication at that time. Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions. Yours sincerely, David R. Beier Associate Editor PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: In this manuscript the authors show convincingly that inactivation of JNK1/2 ameliorates kidney and liver cyst formation in Pkd2 mutants. The genetic data is convincing, with compound genetic inactivation of the JNKs in the Pkd2 mutant background, and the genetic analysis includes sample numbers adequate for interpretation. Positive aspects include the rigor of the genetic analysis and the quantitative metrics used. The major negative is that there is no specific upstream link between JNKs and Pkd2. As described in the discussion, this will be the subject of continued research, and the authors have made a significant effort to exclude 3 upstream kinases through compound genetic analyses. This negative data is not presented and to convincingly exclude these kinases the authors should include a table showing sample numbers analyzed for each. This genetic analysis provides new insight and should be of strong interest in the PKD field. Some specific comments on the data: 1. To look for candidate kinases upstream of JNK, why not use the same approach with the Pkd2 mutant lysates as used for JNK shown in figure 1? 2. Jun phosphorylation looks like it is limited to distended collecting ducts - could the authors investigate if this is the case and propose an explanation? One would expect activation of SAPK in any distended tubules I think, and data presented in the figure questions the causality of Jun phosphorylation in the cyst formation event. 3. The myofibroblast staining is intriguing, but it is not informative to compare terminally damaged Pkd2 mutant tissue with significantly less damaged Pkd2-Jnk tissue if the goal is to ask if JNK specifically affects fibrosis in the Pkd2 mutant. To get at any effect of JNK inactivation on myofibroblast abundance, tissues with the same degree of damage would need to be compared. Perhaps the simplest way to do this would be to show data from 3 or 4 time points P2-P21 and compare tissues with similar cystic indices. 4. The data in Figure 6A is difficult to interpret because the colors are hard to distinguish. 5. The interpretation of the banding pattern of the JNK and pJNK immunoblots is quite important to the results section but the data is not shown in the main figures and the interpretation is not very clear. The conclusion from the genetic analysis is that JNK1 is the predominant actor in cyst formation, and one assumes that the focus of the immunoblot analysis is on finding JNK1-specific molecular mechanisms. Oddly, deletion of JNK1 appears to have a far more modest effect on JNK phosphorylation in the Pkd2 mutant than deletion of JNK2. However, it looks like there are 3 bands above the 38kD marker in the Pkd2 lane and that the middle one is missing in Pkd1-Jnk and Pkd2-Jnk1 but the interpretation of this data needs to be clarified. Reviewer #2: Synopsis; This report demonstrates via genetic means the role of JNK, a terminal kinase in MAPK signaling, in controlling cystic burden in a recessive mouse model of human autosomal dominant polycystic kidney disease. Conditional deletion of the PKD2 gene during early post-natal life (P2-P3) results in a rapid kidney cyst growth and loss of kidney function. Concomitant conditional deletion of JNK1 and JNK2 genes dramatically reduces, but does not eliminate, cystic growth. Moreover, the authors demonstrate that JNK1 is sufficient to elicit this ameliorative phenotype. While JNK inhibitors have not been successfully deployed as a therapeutic strategy, upstream inhibition (MAPKKK) could provide an approach. Notably the authors were unable to identify an upstream kinase that might represent a point for therapeutic intervention. This would require further study. General Comments: The genetic approach is well done and the detailed measurements of genotype and JNK and c-jun phosphorylation provide critical support for a proposed epistatic cascade. The cascade as presented, would leave the reader with a view that JNK signaling is initiated directly downstream of PKD signaling and that abating that signaling cascade results in a reduced proliferative rate and reduced cystic burden. The authors also point out the role of JNK1 in a cuter kidney injury and the role of acute kidney injury in the acceleration of cystic progression. This inter-relationship between PKD signaling, cystic growth and injury and JNK signaling paints a more nuanced picture of the field, one that requires deeper dissection than is developed in this report. The authors can provide more nuanced picture as part of their discussion. One that might outline the complex interplay making it important to understand the the role JNK signaling with respect to PKD vs. cyst-induced injury and potential positive feedback between these cascades. The authors might even propose some directions that could distinguish between the many signaling pathways (e.g. greater temporal resolution in cystic onset and JNK signaling). This report provide critical evidence to support a deeper dissection of the detailed mechanism and providing that more nuanced view brings out the richness and complexity of the underlying questions. Ones that can drive the field forward with greater clarity than simple epistatic relationships. Specific Comments: 1. In discussing treatment of the early post-natal animals via maternal tamoxifen administration, using the term “indirect” or reminding the reader of the maternal transfer is appropriate at each mention of the P2/P3 condition treatment regimen. 2. FIgure 1: The presented immunoblot does not support the idea that the level of JNK is similar in the cystic kidney as the WT kidney. While the level of increase in p-JNK (and p-c-jun) is far greater than the level of JNK increase, an increase in JNK levels could be interesting either due to increased proliferation of tubule cells or even due to inflammatory infiltrates seen in high cystic burden. One remedy would be to provide, as supplementary data, the entire set of immunoblots to understand the variability in JNK levels, or an example with more representative JNK levels. 3. Also worth pointing out that the Rosa-CRE-ER approach does result in systemic deletion and that tubular cell autonomous mechanisms have been proposed, there remains the possibility that other cell types, such as inflammatory or immune cells may play a role. Conditional models with greater tissue specificity would provide a view on this. Reviewer #3: In this study, Smith et al. investigate the role of Jnk signaling in an ADPKD mouse model. ADPKD is a very frequent genetic disease leading to end-stage kidney failure, typically in adults. So far, there is no effective therapy for patients except for the V2R antagonist tolvaptan that comes with massive side effects. Thus, identifying novel targets to interfere with the progression of this genetic disorder is very important. To study JNK in ADPKD, the authors use a genetic mouse model which carries a floxed Pkd2 allele combined with tamoxifen-inducible (ubiquitous) Cre (in R26). They cross this model with a floxed Jnk1 allele and with a conventional Jnk2 knockout. In brief, the authors show that double knockout of Jnk1/2 reduces the severity of the PKD phenotype while inhibiting phospho-c-Jun accumulation in nuclei of tubular epithelial cells and reducing cell proliferation. In addition, they show that loss of Jnk1 alone is almost as efficient as the double knockout, and they also observe an amelioration of the liver phenotype in this Pkd2 model (here with late induction). Taken together, this is an important in vivo study that suggests a novel therapeutic target for a frequent and significant disease. The manuscript is very well written, and I really like the story. However, I have some concerns that should be addressed by the authors. 1. The genetic background of the mouse lines should be described. Is this all pure BL6, SV129, FVB, … or mixed? A mixed background could be critical and responsible for some of the more subtle effects observed. 2. Control animals are always referred to as “Wild Type” or “Wt” in the figures (starting with Fig 1A), but these animals are in fact heterozygous for Pkd2 and perhaps additional alleles. I feel that this should be more accurate, in particular, since ADPKD is an autosomal-dominant disease. Moreover, the genotype of control animals is not always clear to me. 3. Fig.2 describes the effect of Jnk1/2 deficiency on the PKD phenotype. In this figure, the phenotype of the Jnk1/2 double knockout without PKD2 deletion should be shown as an additional control. The same should be added to Fig. 7 (liver; in particular given the paper of Muller et al (Ref 75). While the positive effect of Jnk1/2 deletion on renal cyst development is very promising, this effect could be in part the consequence of less efficient Pkd2 deletion by cre in presence of an additional floxed allele (Jnk1). The authors observe a huge variability both in the kidney-to-bodyweight ratio and in Pkd2 expression levels (Fig S1). It might be helpful to correlate Pkd2 expression with the cystic phenotype on the level of the individual animals. In Fig S1: Please note, that the numbers from the figure legend (N=12 and N=15) do not fit with the number of data points in the graph. Here, either data sets or numbers were interchanged. 4. When investigating the impact of the individual Jnk kinases, jnk1 and Jnk2, the authors use a total body knockout of Jnk1 as an additional model (Fig. 6). Since the three panels on the left and the right panel of the figure refer to the previously used mouse model, it would be more convincing to see the phenotype of “R26-CreErt2; Pkd2fl/fl; Jnk1fl/fl;Jnk2+/+” here. It does not become evident why the authors now switch to the Jnk1-/- line instead. Minor point: 1. I would like to suggest being somewhat more careful at the end of the discussion when suggesting: “JNK pathway inhibitors could be effective treatments for ADPKD”. This conclusion is currently based on one mouse model. Many other treatments for ADPKD do work in mice but not in humans (e.g., rapamycin). In addition, loss of Jnk1/2 has been recently shown to cause liver cysts in mice, indicating that general inhibition of Jnk kinases might not be straightforward. Please remember that ADPKD patients typically know a lot about their disease, and they follow the literature... 2. Fig. 3, Fig. 4 and Fig. 5 could also be combined to one figure. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: No: Was unable to find access to all the datasets (e.g. immunoblots) that supported the graphical representation. Particularly when variation is high, access to all immunoblots, rather than representative can be instructive. Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No 10 Nov 2021 Submitted filename: ResponseToReviewers_11_10_2021.pdf Click here for additional data file. 2 Dec 2021 Dear Dr Pazour, Thank you very much for submitting your Research Article entitled 'c-Jun N-terminal kinase (JNK) signaling contributes to cystic burden in polycystic kidney disease' to PLOS Genetics. The manuscript was fully evaluated at the editorial level and by independent peer reviewers. Reviewer #3 identified a minor concern which we ask you to address. Your response will be assessed editorially; that is, the manuscript will not be sent for further review We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer. In addition we ask that you: 1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. 2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images. We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] Please let us know if you have any questions while making these revisions. Yours sincerely, David R. Beier Associate Editor PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: All questions have been answered. Reviewer #2: Have address key concerns of this reviewer. Look forward to follow-up mechanistic studies and therapeutic implications. Reviewer #3: The authors addressed most of my concerns. I apologize that I did not understand the "making-of" the Jnk1 null/null line correctly. Of course, the authors are right, no problem in using this - based on the very same allele. I am still unhappy with the label "Wt" in several figures refering to heterozygous knockout animals. In addition, Fig. S6 and S7 should be either rearranged or deleted. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No 7 Dec 2021 Submitted filename: ResponseToReviewers_12_05_2021.pdf Click here for additional data file. 11 Dec 2021 Dear Dr Pazour, We are pleased to inform you that your manuscript entitled "c-Jun N-terminal kinase (JNK) signaling contributes to cystic burden in polycystic kidney disease" has been editorially accepted for publication in PLOS Genetics. Congratulations! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Yours sincerely, David R. Beier Associate Editor PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00927R2 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 21 Dec 2021 PGENETICS-D-21-00927R2 c-Jun N-terminal kinase (JNK) signaling contributes to cystic burden in polycystic kidney disease Dear Dr Pazour, We are pleased to inform you that your manuscript entitled "c-Jun N-terminal kinase (JNK) signaling contributes to cystic burden in polycystic kidney disease" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, Zsofia Freund PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  80 in total

Review 1.  The JNK signal transduction pathway.

Authors:  Claire R Weston; Roger J Davis
Journal:  Curr Opin Cell Biol       Date:  2007-02-15       Impact factor: 8.382

2.  Cellular activation triggered by the autosomal dominant polycystic kidney disease gene product PKD2.

Authors:  T Arnould; L Sellin; T Benzing; L Tsiokas; H T Cohen; E Kim; G Walz
Journal:  Mol Cell Biol       Date:  1999-05       Impact factor: 4.272

3.  JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain.

Authors:  B Dérijard; M Hibi; I H Wu; T Barrett; B Su; T Deng; M Karin; R J Davis
Journal:  Cell       Date:  1994-03-25       Impact factor: 41.582

4.  ASK1 is required for sustained activations of JNK/p38 MAP kinases and apoptosis.

Authors:  K Tobiume; A Matsuzawa; T Takahashi; H Nishitoh; K Morita ; K Takeda; O Minowa; K Miyazono; T Noda; H Ichijo
Journal:  EMBO Rep       Date:  2001-03       Impact factor: 8.807

5.  Evaluation of JNK blockade as an early intervention treatment for type 1 diabetic nephropathy in hypertensive rats.

Authors:  Andy K H Lim; Frank Y Ma; David J Nikolic-Paterson; Elyce Ozols; Morag J Young; Brydon L Bennett; Glenn C Friedman; Gregory H Tesch
Journal:  Am J Nephrol       Date:  2011-08-26       Impact factor: 3.754

6.  Overexpression of PKD1 causes polycystic kidney disease.

Authors:  Caroline Thivierge; Almira Kurbegovic; Martin Couillard; Richard Guillaume; Olivier Coté; Marie Trudel
Journal:  Mol Cell Biol       Date:  2006-02       Impact factor: 4.272

7.  c-Jun N-terminal kinase mediates hepatic injury after rat liver transplantation.

Authors:  Tetsuya Uehara; Xing Xi Peng; Brydon Bennett; Yoshi Satoh; Glenn Friedman; Robert Currin; David A Brenner; John Lemasters
Journal:  Transplantation       Date:  2004-08-15       Impact factor: 4.939

8.  Toxic tubular injury in kidneys from Pkd1-deletion mice accelerates cystogenesis accompanied by dysregulated planar cell polarity and canonical Wnt signaling pathways.

Authors:  Hester Happé; Wouter N Leonhard; Annemieke van der Wal; Bob van de Water; Irma S Lantinga-van Leeuwen; Martijn H Breuning; Emile de Heer; Dorien J M Peters
Journal:  Hum Mol Genet       Date:  2009-04-28       Impact factor: 6.150

9.  Loss of cilia suppresses cyst growth in genetic models of autosomal dominant polycystic kidney disease.

Authors:  Ming Ma; Xin Tian; Peter Igarashi; Gregory J Pazour; Stefan Somlo
Journal:  Nat Genet       Date:  2013-07-28       Impact factor: 38.330

10.  The polycystin complex mediates Wnt/Ca(2+) signalling.

Authors:  Seokho Kim; Hongguang Nie; Vasyl Nesin; Uyen Tran; Patricia Outeda; Chang-Xi Bai; Jacob Keeling; Dipak Maskey; Terry Watnick; Oliver Wessely; Leonidas Tsiokas
Journal:  Nat Cell Biol       Date:  2016-05-23       Impact factor: 28.824

View more
  1 in total

1.  c-JUN n-Terminal Kinase (JNK) Signaling in Autosomal Dominant Polycystic Kidney Disease.

Authors:  Abigail O Smith; Julie A Jonassen; Kenley M Preval; Roger J Davis; Gregory J Pazour
Journal:  J Cell Signal       Date:  2022
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.