| Literature DB >> 34957084 |
Tina Vida Plavec1, Tim Ključevšek1,2, Aleš Berlec1,2.
Abstract
Genetic modification of lactic acid bacteria is an evolving and highly relevant field of research that allows the engineered bacteria to be equipped with the desired functions through the controlled expression of the recombinant protein. Novel genetic engineering techniques offer the advantage of being faster, easier and more efficient in incorporating modifications to the original bacterial strain. Here, we have developed a modified BglBrick system, originally introduced in Escherichia coli and optimized it for the lactic acid bacterium Lactococcus lactis. Six different expression cassettes, encoding model proteins, were assembled in different order as parts of a modified BglBrick system in a novel plasmid pNBBX. All cassettes included nisin promoter, protein encoding gene and transcription terminator. We demonstrated successful intracellular expression of the two fluorescent proteins and display of the four protein binders on the bacterial surface. These were expressed either alone or concomitantly, in combinations of three model proteins. Thus, a modified BglBrick system developed herein enables simple and modular construction of multigene plasmids and controlled simultaneous expression of three proteins in L. lactis.Entities:
Keywords: BglBrick; Lactococcus lactis; expression system; genetic engineering; multifunctional bacteria
Year: 2021 PMID: 34957084 PMCID: PMC8703077 DOI: 10.3389/fbioe.2021.797521
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Primers and plasmids used in this study.
| Strain, plasmid, primer or gene | Relevant features or sequence | References |
|---|---|---|
| Primers | ||
| BX-R-TT | AAAAAACTCGAGATATTGATCAAACGATTATGCCGATAACTAAAC | This work |
| NB-F-PnisA | AAAAAAGCTAGCATATAGATCTAGTCTTATAACTATACTGAC | This work |
| Xho-F-8148 | TTAAAACTCGAGAAAACAGGCGTTATCGTAG | This work |
| Nhe-R-8148 | TAATAAGCTAGCCTGTAATATAAAAACCTTCTTCAAC | This work |
| Plasmids | ||
| pNZ8148 | pSH71 derivative, P
|
|
| pSD-fHER2 | pNZ8148 containing gene fusion of |
|
| pSD-AffEpCAM | pNZ8148 containing gene fusion of |
|
| pSD-mycEva | pNZ8148 containing gene fusion of | Zahirović et al., manuscript in preparation |
| pSD-ZIL | pNZ8148 containing gene fusion of | Zahirović et al., manuscript in preparation |
| pNZ-IRFP | pNZ8148 containing |
|
| pNZ-mCh | pNZ8048 containing | Dr. Jorge G. Gomez-Gutierrez, ( |
| pNBBX | pNZ8148 containing NheI, BglII, BclI and XhoI restriction sites | This work |
| pNBBX-fHER2 | pNBBX containing HER cassette | This work |
| pNBBX-AffEpCAM | pNBBX containing EpC cassette | This work |
| pNBBX-mycEva | pNBBX containing Eva cassette | This work |
| pNBBX-ZIL | pNBBX containing ZIL cassette | This work |
| pNBBX-IRFP | pNBBX containing IRFP cassette | This work |
| pNBBX-mCh | pNBBX containing mCh cassette | This work |
| p-fHER2-mycEva | pNBBX containing HER and Eva cassettes | This work |
| p-mycEva-fHER2 | pNBBX containing Eva and HER cassettes | This work |
| p-fHER2-ZIL | pNBBX containing HER and ZIL cassettes | This work |
| p-ZIL-fHER2 | pNBBX containing ZIL and HER cassettes | This work |
| p-EpCAM-mycEva | pNBBX containing EpC and Eva cassettes | This work |
| p-mycEva-EpCAM | pNBBX containing Eva and EpC cassettes | This work |
| p-EpCAM-ZIL | pNBBX containing EpC and ZIL cassettes | This work |
| p-ZIL-EpCAM | pNBBX containing ZIL and EpC cassettes | This work |
| p-fHER2-mycEva-IRFP | pNBBX containing HER, Eva and IRFP cassettes | This work |
| p-mycEva-fHER2-IRFP | pNBBX containing Eva, HER and IRFP cassettes | This work |
| p-fHER2-ZIL-IRFP | pNBBX containing HER, ZIL and IRFP cassettes | This work |
| p-ZIL-fHER2-IRFP | pNBBX containing ZIL, HER and IRFP cassettes | This work |
| p-EpCAM-mycEva-IRFP | pNBBX containing EpC, Eva and IRFP cassettes | This work |
| p-mycEva-EpCAM-IRFP | pNBBX containing Eva, EpC and IRFP cassettes | This work |
| p-EpCAM-ZIL-IRFP | pNBBX containing EpC, ZIL and IRFP cassettes | This work |
| p-ZIL-EpCAM-IRFP | pNBBX containing ZIL, EpC and IRFP cassettes | This work |
| p-fHER2-mycEva-mCh | pNBBX containing HER, Eva and mCh cassettes | This work |
| p-mycEva-fHER2-mCh | pNBBX containing Eva, HER and mCh cassettes | This work |
| p-fHER2-ZIL-mCh | pNBBX containing HER, ZIL and mCh cassettes | This work |
| p-ZIL-fHER2-mCh | pNBBX containing ZIL, HER and mCh cassettes | This work |
| p-EpCAM-mycEva-mCh | pNBBX containing EpC, Eva and mCh cassettes | This work |
| p-mycEva-EpCAM-mCh | pNBBX containing Eva, EpC and mCh cassettes | This work |
FIGURE 1Preparation of BglBrick plasmid pNBBX by insertion of NheI/BglII and BclI/XhoI sites into pNZ8148 (A). Example of upstream BglBrick cloning of a gene cassette using NheI/BglII for the backbone and NheI/BclI for the insert and exploiting BglII/BclI complementarity resulting in a scar (B). GOI, gene of interest; PnisA, nisin promoter; TT, transcription terminator; MCS, multiple cloning site.
FIGURE 2Schematic representation of components of gene cassettes for model recombinant protein expression and surface display (A) and an evolutionary tree of successive assembly of multiple gene cassettes in pNBBX plasmids depicted in 5′ to 3′ direction (B). PnisA, nisin promoter; USP, secretion signal; AffEpCAM, EpCAM-targeting affitin; ZHER2, HER2-targeting affibody; Evasin, CXCL-8-binding evasin 3; ZIL6, IL-6-binding affibody; IRFP, infrared fluorescent protein; mCherry, red fluorescent protein; cA, cAcmA anchoring domain; flag, FLAG-tag; myc, MYC-tag; TT, transcription terminator.
FIGURE 3Surface display of individual protein binders (cassettes HER, EpC, Eva and ZIL) assessed by flow cytometry (mean fluorescence intensity, MFI), and expression of fluorescent protein IRFP (cassette IRFP) assessed by measuring fluorescence (fluorescence intensity, FI) in L. lactis containing pNBBX with up to three gene cassettes (denoted in 5′-3′ direction). *p < 0.01, **p < 0.001, ***p < 0.0001.
FIGURE 4Surface display of selected individual protein binders (cassettes HER and Eva), evaluated by flow cytometry (mean fluorescence intensity, MFI), and expression of fluorescent protein mCherry (cassette mCh); assessed by measuring fluorescence (fluorescence intensity, FI) in L. lactis containing pNBBX derivatives with up to three gene cassettes (denoted in 5′-3′ direction). **p < 0.001, ***p < 0.0001.