Zhen Zhai1, Tianlong Mu1,2, Lina Zhao1, Yiliang Li1, Dongsheng Zhu1, Yanshu Pan3. 1. Breast Department, Dongfang Hospital Beijing University of Chinese Medicine, Beijing, China. 2. Pathology Department, Dongfang Hostipal Beijing University of Chinese Medicine, Beijing, China. 3. Periodical Center, Beijing University of Chinese Medicine, Beijing, China.
Abstract
Dysregulation of microRNAs (miRNAs) is associated with the occurrence and development of breast cancer. In this research, we explored the involvement of miR-181a-5p in the progression of breast cancer and investigated potential molecular mechanisms. Firstly, the miR-181a-5p and N-myc downstream-regulated gene (NDRG) 2 expression was detected by real-time quantitative polymerase chain reaction. Cellular processes were assessed using Cell Counting Kit 8, Bromodeoxyuridine, colony formation and transwell assays. HK2, PKM2 and LDHA activities were assessed by ELISA. The combination between miR-181a-5p was assessed by dual-luciferase reporter assay and RNA pull-down assay. The results indicated that miR-181a-5p levels were upregulated and NDRG2 levels were downregulated in breast cancer, leading to poor prognosis. Silencing of miR-181a-5p inhibited cell proliferation, invasion, glycolysis, and xenograft tumor growth, while enhanced miR-181a-5p got the opposite results. Furthermore, NDRG2 acts as a target of miR-181a-5p. Knockout of NDRG2 facilitated biological behaviors and meanwhile enhanced phosphorylation (p)-PTEN and p-AKT levels. Rescue experiments showed that restoring NDRG2 abolished the effects caused by miR-181a-5p in breast cancer cells. In conclusion, miR-181a-5p facilitated tumor progression through NDRG2-induced activation of PTEN/AKT signaling pathway of breast cancer, suggesting that focusing on miR-181a-5p may provide new insight for breast cancer therapy.Abbreviations Brdu: Bromodeoxyuridine; CCK-8: Cell Counting Kit-8; miRNA: microRNAs; mut: mutant; RT-qPCR: real-time quantitative polymerase chain reaction; UTR: untranslated region; WT: wild-type.
Dysregulation of microRNAs (miRNAs) is associated with the occurrence and development of breast cancer. In this research, we explored the involvement of miR-181a-5p in the progression of breast cancer and investigated potential molecular mechanisms. Firstly, the miR-181a-5p and N-myc downstream-regulated gene (NDRG) 2 expression was detected by real-time quantitative polymerase chain reaction. Cellular processes were assessed using Cell Counting Kit 8, Bromodeoxyuridine, colony formation and transwell assays. HK2, PKM2 and LDHA activities were assessed by ELISA. The combination between miR-181a-5p was assessed by dual-luciferase reporter assay and RNA pull-down assay. The results indicated that miR-181a-5p levels were upregulated and NDRG2 levels were downregulated in breast cancer, leading to poor prognosis. Silencing of miR-181a-5p inhibited cell proliferation, invasion, glycolysis, and xenograft tumor growth, while enhanced miR-181a-5p got the opposite results. Furthermore, NDRG2 acts as a target of miR-181a-5p. Knockout of NDRG2 facilitated biological behaviors and meanwhile enhanced phosphorylation (p)-PTEN and p-AKT levels. Rescue experiments showed that restoring NDRG2 abolished the effects caused by miR-181a-5p in breast cancer cells. In conclusion, miR-181a-5p facilitated tumor progression through NDRG2-induced activation of PTEN/AKT signaling pathway of breast cancer, suggesting that focusing on miR-181a-5p may provide new insight for breast cancer therapy.Abbreviations Brdu: Bromodeoxyuridine; CCK-8: Cell Counting Kit-8; miRNA: microRNAs; mut: mutant; RT-qPCR: real-time quantitative polymerase chain reaction; UTR: untranslated region; WT: wild-type.
Entities:
Keywords:
Breast cancer; NDRG2; glycolysis; invasion; miR-181-5p; proliferation
Breast cancer is the most usual public healthy obstacle to women globally. The incidence and mortality rate of breast cancer is still increasing in developing countries [1]. Patients with breast cancer at an early stage, locally at an advanced stage, and with local recurrence can be cured [2]. However, because of the lack of early screening, a large number of patients are still diagnosed at the advanced stage [3]. There are several therapy options for breast cancer, including surgery, radiotherapy, neoadjuvant and adjuvant therapy [4]. But breast cancer is still incurable. Thus, it is necessary to identify more effective treatment strategies.Accumulating evidence has shown that microRNAs (miRNAs) are commonly abnormally expressed in human cancers. MiRNAs usually act as oncomiRs and tumor suppressors [5]. Moreover, miRNAs are involved in cellular processes, including proliferation, apoptosis, metastasis, and receptor-driven pathway [6]. MiR-181a is a member of the miR-181 family, which is transcribed from two isolated gene loci [7]. As members of the miR-181 family, miR-181a-5p and its passenger strand miR-181a-3p are organized into three clusters as miR-181a/b-1, miR-181a/b-2, and miR-181 c/d [8,9]. According to the miRNA profile, miR-181a-5p expression is upregulated in breast cancer tissues [10]. However, its function roles have not been studied.N-myc downstream-regulated gene (NDRG) 2 is a key member of the NDRG family, located at chromosome 14q11.2, performs as a differentiation-associated and stress-related molecular [11,12]. As a tumor suppressor, NDRG2 levels have been proved to be downregulated in numerous types of human cancers, including breast cancer [13]. However, whether NDRG2 is related to miR-181a-5p to participate in the progression of breast cancer was unknown. In the current study, we aimed to investigate the levels of miR-181a-5p and NDRG2, and meanwhile explore their role in breast cancer. MiR-181a-5p targeted NDRG2 to promote the proliferation, invasion and glycolysis of breast cancer cells via regulating the PTEN/AKT pathway. The study suggested that miR-181a-5p has the potential to be a target for breast cancer therapy.
Materials and methods
Tissue samples
Paired tumor tissues and adjacent normal tissues were obtained from 120 patients with breast cancer in Dongfang Hospital Beijing University of Chinese Medicine from January to March 2017. All tissue samples were kept at −80°C after the collection. Written informed consent was provided by each patient. The study was approved by the Ethics Committee of Dongfang Hospital Beijing University of Chinese Medicine. The clinical characteristics of patients were shown in Table 1.
Table 1.
Correlation between miR-181a-5p expression and clinicopathological characteristics in breast cancer patients
Characteristics
n
miR-181a-5p expression
P value
Low
High
Age (Years)
0.751
≤60
45
29
16
>60
75
30
45
Tumor size (mm)
0.045
≥ 30
73
29
44
<30
47
30
17
TNM stage
0.012
I–II
35
27
8
III–IV
85
32
53
Lymph node metastasis
0.005
Positive
68
22
46
Negative
52
37
15
Distant metastasis
0.035
Positive
48
16
32
Negative
72
42
29
Correlation between miR-181a-5p expression and clinicopathological characteristics in breast cancer patients
Cell source and culture
All breast cancer cell lines and normal breast epithelial MCF-10A cells were acquired from the Chinese Academy of Science (Shanghai, China). Roswell Park Memorial Institute (RPMI)-1640 medium (Solarbio, Beijing, China) that supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and 1% penicillin and streptomycin was used to culture the cells. The cells were maintained at 37°C with 5% CO2.
Cell transfection
MDA-MA-231, SK-BR-3, HCC2157, BT474, HCC1569, and T-47D cells at logarithmic phase were seeded into six-well plates and incubated at 37°C until the cell fusion exceeded 70%. MDA-MA-231 and SK-BR-3 cells were transfected with anti-miR-ctrl and anti-miR-181a-5p employing Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific) based on the manufacturer’s protocol. Similarly, HCC2157, BT474, HCC1569, and T-47D cells were transfected with miR-ctrl and miR-181a-5p by Lipofectamine 2000 reagent. After 6 h, the medium was replaced to a complete medium. Then, the cells were incubated at 37°C for 48 h.
Cell proliferation analysis
A total of 2 × 103 breast tumor cell lines were plated on 96-well plates and cultured for 0, 2, 4, and 6 d, respectively. After adding Cell Counting Kit 8 (CCK-8) reagent (10 µl; Abcam, Cambridge, MA, USA) into plates, the cells were cultured for another 2 h. Then, the absorbance was measured by a microplate reader (Bio-Tek, Biotek Winooski, Vermont, USA) at 450 nm.
Bromodeoxyuridine (BrdU) assay
MDA-MA-231, SK-BR-3, and HCC2157 cells were seeded into six-well plates. BrdU reagent (10 µmol/L) was added and incubated with cells. After incubating with BrdU Mouse mAb (Cell signaling technology, Danvers, MA, USA) at room temperature, Alexa Fluor 488-conjugated anti-mouse IgG (Cell signaling technology) and DAPI (Sigma-Aldrich, St. Louis, MO, USA) were added to the cells and incubated at 4°C overnight. Fluorescent signals were visualized under a microscope.
Colony formation analysis
Post-transfection, MDA-MA-231, SK-BR-3, and HCC2157 cells were digested with 0.25% trypsin to a single-cell suspension. A total of 1.5 ml and 0.6% agar solution was mixed with RPMI-1640 medium and added to the bottom of the plates. A total of 2 × 104 transfected cells, mixed with RPMI-1640 medium and 10% FBS, were plated on the bottom layer of agar. After incubation at 37°C for two weeks, the colonies were visualized under a microscope.
Transwell assay
Biocoat Matrigel Invasion Chambers (24-well plates, 8.0 µm PET membrane) were obtained from BD Biosciences (San Jose, CA, USA). Serum-free medium (200 µl) containing 5 × 104 cells/ml MDA-MB-231, SK-BR-3, and HCC2157 cells were added to the upper layer. Then, 600 µl complete medium was added into lower chambers. These chambers were incubated in the humidified incubator for 24 h. The invasive cells under the membrane were fixed with 4% paraformaldehyde for 10 min. After washing with PBS, the cells were stained with 0.1% crystal violet for 15 min. For observation, the amount of invaded cells was counted under a microscope at 5 random fields.
Total RNA was isolated employing TRIzol reagent (Invitrogen) from tissue samples and cells. For miR-181a-5p expression, qPCR was conducted using miRcute miRNA qPCR detection kit (TIANGEN Biotech, Beijing, China) after reverse transcription utilized miScript II RT kit (Qiagen, Hilden, Germany). For NDRG2 expression, cDNA first-strand was synthesized by iScriptcDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Subsequently, qPCR was conducted using SuperReal Premix Plus (SYBR green) (TIANGEN Biotech). The instrument for qPCR was ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) with the following conditions: for miR-181a-5p: 94°C for 2 min, followed by 94°C for 20 s and 60°C for 30 s (40 cycles); for NDRG2: 95°C for 15 min, followed by 40 cycles of 95°C for 10s and 60°C for 32s. The expression was calculated by the 2−ΔΔCq method. U6 and GAPDH were assessed as the housekeeping control for miR-181a-5p and NDRG2, respectively. Primer sequences were as follows: miR-181a-5p F: 5ʹ-GAACATTCAACGCTGTCGGTG-3ʹ, miR-181a-5p R: 5ʹ-ATCCAGTGCAGGGTCCGAGGTA-3ʹ; NDRG2 F: 5ʹ-CGATCCTTACCTACCACGATGTG-3ʹ, NDRG2 R: 5ʹ-GCATGTCCTCGAACTGAAACAGT-3ʹ; U6 F: 5ʹ-CTCGCTTCGGCAGCACA-3ʹ, U6 R: 5ʹ-AACGCTTCACGAATTTGCGT-3ʹ; GAPDH F: 5ʹ-TTGGTATCGTGGAAGGACTCA-3ʹ, GAPDH R: 5ʹ-TGTCATCATATTTGGCAGGTT-3ʹ.
Western blot
The cells were lysed in pre-cooling RIPA buffer to extract total protein, and Bicinchoninic Acid Kit (Sigma-Aldrich) was used to determine the protein concentration. Equal protein (30 µg) was separated by SDS-PAGE. PVDF membranes containing transferred protein were incubated with 5% skim milk for 1 h. Then, these membranes were incubated with primary antibodies at 4°C overnight and subsequently incubated with secondary antibody at room temperature for 2 h. Each band signal was visualized by ECL-Plus Western blotting Reag (GE Healthcare, Little Chalfont, Buckinghamshire, UK) on ImageQuant 300/400/RT ECL system. Gray analysis was performed using Image Master 2D Platinum software (version 6.0) following the manufacturer’s instrument.Primary antibodies used here include: anti-NDRG2 (ab174850, 1:1,000), anti-HK2 (ab104836, 1:1,000), anti-PKM2 (ab85555, 1:200), and LDHA (ab101562, 1:1,000), anti-p-PTEN (#9554, 1:1,000), anti-PTEN (ab31392, 1:1,000), anti-p-AKT (ab81283, 1:5,000), anti-AKT (ab8805, 1:500), and anti-GAPDH (ab9485, 1:2,500). Secondary antibody used here was Donkey anti-rabbit IgG H&L (HRP) (ab6802, 1:1,000). All these antibodies were purchased form Abcam, except that p-PTEN was acquired from Cell Signaling Technology.
Xenograft formation study
This animal experiment protocol was approved by the Ethics Committee of Dongfang Hospital Beijing University of Chinese Medicine. Female BALB/c nude mice (6-weeks old; 18–22 g) were divided into 4 groups (anti-miR-ctrl, anti-miR-181a-5p, miR-ctrl, miR-181a-5p, and 5 mice per group). All mice were fed in 14-h light/10-h dark cycles condition for 32 d. Tumor size was measured every 3 d, from 8 d after transfected cells inoculation into mice. Tumor volume was calculated using (length×width2)/2. The tumors were photographed at 32 d and then excised to weigh.
Determination of glycolysis related factors
After transfection, glucose consumption was measured by Glucose Assay Kit (Abcam). Lactate production was tested by Lactate Assay Kit (Biovision, Milpitas, CA, USA). HK2, PKM2, and LDHA activities were detected by Human HK2 ELISA Kit (Biomatik, Cambridge, Ontario, Canada), Human PKM2 ELISA Kit (USCNK Life Science Inc., Wuhan, China), and Human LDHA ELISA Kit (Elabscience Biotechnology Co., Ltd, Wuhan, China).
Verification of target gene
Targeted 3ʹ-untranslated regions (UTR) of NDRG2 (wild-type; wt NDRG25) and its corresponding mutant (mt) NDRG2 fragments were inserted into pMIR-REPORT vectors (Promega, Madison, WI, USA), respectively. HEK293T cells were seeded into 24-well plates for 48 h before the transfection. Then the cells were co-transfected using Lipofectamine 2000 (Invitrogen) with wt NDRG25 or mt NDRG2 and miR-181a-5p or miR-ctrl. After 48 h, luciferase activity was detected by Steady-Glo Luciferase Assay System (Promega), which was quantified by the firefly/Renilla luciferase activity ratio.On the other hand, the targeted relationship was also verified using the RNA pull-down assay. Briefly, biotinylated wt-miR-181a-5p and mut-miR-181a-5p were transfected into cells for 48 h. The cells were lysed followed by incubated with M-280 streptavidin magnetic beads (Sigma) at 4°C for 3 h. After washing with lysis buffer, low salt buffer, and high salt buffer, The expression of NDRG2 was assessed by RT-qPCR.
CRISPR/Cas9 vector constructs
Two CRISPR sequences (sgNDRG2-1: 5ʹ- CCAGCCACTGTTTCAGTTCG −3ʹ and sgNDRG2-2: 5ʹ- ATGTCCTCGAACTGAAACAG −3ʹ) were selected to target the NDRG2 gene by CRISPR Design web tool (http://crispr.mit.edu/). The non-silencing CRISPR/Cas9 random sequence (5ʹ- ACGGAGGCTAAGCGTCGCAA −3ʹ) was served as the negative control (NC). SgNDRG2-1, sgNDRG2-2, and sgNC were constructed into lentiCRISPRv2 vectors (Addgene, Cambridge, MA, USA), and the recombinant plasmids were transfected into HCC2157 cells.
Statistical analysis
GraphPad Prism software 7 (GraphPad Software, La Jolla, CA, USA) was used to analyze the results. All data were presented as mean ± standard deviation (SD). The difference between the two groups was analyzed by student’s t-test. One-way ANOVA was conducted for multiple comparisons. The survival curve was assessed by Kaplan-Meier survival analysis. The correlation was analyzed by Pearson’s correlation coefficient.
Results
We aimed to investigate the role of miR-181a-5p and NDRG2 in breast cancer. We found upregulated miR-181a-5p and downregulated NDRG2 in breast cancer. Furthermore, miR-181a-5p promoted cell proliferation, invasion and glycolysis of breast cancer by targeting NDRG2 via the PTEN/AKT pathway, suggesting that miR-181a-5p may be a potential target for breast cancer therapy.
Upregulated miR-181-5p and downregulated NDRG2 in breast cancer
The data of RT-qPCR indicated that miR-181-5p levels were higher in tumor tissues than in adjacent non-tumor tissues (Figure 1(a)). High levels of miR-181-5p led to poor overall survival (Figure 1(b)). The expression of miR-181-5p was associated with tumor size, TNM stage, lymph node metastasis, and distant metastasis (P < 0.05), but not related to age (P > 0.05; Table 1). MiR-181-5p was increased in several breast cancer cells but reduced in other cells (Figure 1(c)). By contrast, NDRG2 had lower expression in tumor tissues than in adjacent normal tissues (Figure 1(d)). Low NDRG2 was related to poor overall survival (Figure 1(e)). Additionally, NDRG2 levels were decreased in some breast cancer cells but increased in BT-474, HCC1569, HCC2157, and T47D cell lines (Figure 1(f)).
Figure 1.
Upregulated miR-181a-5p and downregulated NDRG2 in breast cancer. (a) MiR-181-5p levels were measured using RT-qPCR in a total of 120 pairs of tumor tissues and adjacent non-tumor tissues. (b) The overall survival rate of patients with breast cancer was assessed by Kaplan-Meier survival analysis based on the miR-181a-5p levels. (c) MiR-181a-5p levels in breast cancer cells and MCF-10A cells were detected using RT-qPCR. (d) NDRG2 expression was tested by RT-qPCR in tumor tissues and non-tumor tissues (n = 120). (e) The survival curve was assessed by Kaplan-Meier survival analysis according to the NDRG2 levels. (f) NDRG2 levels in breast cancer cells and MCF-10A cells were detected using RT-qPCR. *P < 0.05 and **P < 0.01 compared with the normal group
Upregulated miR-181a-5p and downregulated NDRG2 in breast cancer. (a) MiR-181-5p levels were measured using RT-qPCR in a total of 120 pairs of tumor tissues and adjacent non-tumor tissues. (b) The overall survival rate of patients with breast cancer was assessed by Kaplan-Meier survival analysis based on the miR-181a-5p levels. (c) MiR-181a-5p levels in breast cancer cells and MCF-10A cells were detected using RT-qPCR. (d) NDRG2 expression was tested by RT-qPCR in tumor tissues and non-tumor tissues (n = 120). (e) The survival curve was assessed by Kaplan-Meier survival analysis according to the NDRG2 levels. (f) NDRG2 levels in breast cancer cells and MCF-10A cells were detected using RT-qPCR. *P < 0.05 and **P < 0.01 compared with the normal group
Silencing of miR-181-5p inhibited breast cancer cell proliferation, invasion, and xenograft formation
To evaluate the impacts of miR-181-5p on breast cancer cells, the expression of miR-181a-5p was significantly decreased in the anti-miR-181a-5p group, compared with the control and the anti-miR-ctrl group of MDA-MB-231and SK-BR-3 cell lines after transfection (Figure 2(a)). As illustrated in Figure 2(b-f), silencing of miR-181a-5p inhibited breast cancer cell proliferation, compared with the anti-miR-ctrl group. In addition, the inhibition of miR-181a-5p suppressed cell invasion (Figure 2(g,h)). Furthermore, anti-miR-181a-5p reduced tumor size, tumor weight, and protein levels of p-AKT in vivo (Figure 2(i-l)).
Figure 2.
The inhibition of miR-181a-5p induced the suppression of proliferation, invasion, and xenograft formation. (a) Transfection efficiency in MDA-MB-231 and SK-BR-3 cells in the control, anti-miR-ctrl and anti-miR-181a-5p groups was measured by RT-qPCR. (b) Cell proliferation was assessed by CCK-8 assay when anti-miR-ctrl and anti-miR-181a-5p transfected for 0, 2, 4, 6 d. (c) BrdU assay was performed post-transfection. (d) Relative BrdU positive cells were quantified. (e) Colony formation was conducted post-transfection. (f) Colonies were counted. (g) Transwell invasion assay was performed after the transfection. (h) Invaded cells number was quantified. (i) Tumor size, (j) tumor images, and (k) tumor weight were examined in mice of anti-miR-ctrl and anti-miR-181a-5p groups. (l) The protein expression of AKT and p-AKT (Ser473) was detected using western blot. *P < 0.05 and **P < 0.01 compared with the anti-miR-ctrl group
The inhibition of miR-181a-5p induced the suppression of proliferation, invasion, and xenograft formation. (a) Transfection efficiency in MDA-MB-231 and SK-BR-3 cells in the control, anti-miR-ctrl and anti-miR-181a-5p groups was measured by RT-qPCR. (b) Cell proliferation was assessed by CCK-8 assay when anti-miR-ctrl and anti-miR-181a-5p transfected for 0, 2, 4, 6 d. (c) BrdU assay was performed post-transfection. (d) Relative BrdU positive cells were quantified. (e) Colony formation was conducted post-transfection. (f) Colonies were counted. (g) Transwell invasion assay was performed after the transfection. (h) Invaded cells number was quantified. (i) Tumor size, (j) tumor images, and (k) tumor weight were examined in mice of anti-miR-ctrl and anti-miR-181a-5p groups. (l) The protein expression of AKT and p-AKT (Ser473) was detected using western blot. *P < 0.05 and **P < 0.01 compared with the anti-miR-ctrl group
Increasing miR-181a-5p facilitated the proliferation, invasion, and xenograft formation of breast cancer
As shown in Figure 3(a), miR-181a-5p levels were upregulated in the miR-181-5p overexpressing group, compared with the control and the miR-ctrl groups. Enforced miR-181a-5p promoted cell proliferation and invasion (Figure 3(b-h)). In the tumor xenograft model, the upregulation of miR-181a-5p increased tumor size and weight (Figure 3(i-k)). Enforced miR-181a-5p upregulated p-AKT levels, but did not influence AKT levels (Figure 3(l)).
Figure 3.
Elevated expression of miR-181a-5p facilitated the proliferation, colony formation, invasion, and xenograft of breast cancer. (a) Transfection efficiency was measured in the control, miR-ctrl and miR-181a-5p groups of HCC2157 cells by RT-qPCR. Cell proliferation was elevated using (b) CCK-8 assay, (c-d) BrdU assay and (e-f) colony formation assay. (g-h) Cell invasion was examined by transwell assay and invaded cells numbers were quantified. (i) Tumor growth curves, (h) tumor represent images, and (k) tumor weight were measured and showed. (l) The protein expression of AKT and p-AKT (Ser473) was detected using western blot. *P < 0.05 and **P < 0.01 compared with the miR-ctrl group
Elevated expression of miR-181a-5p facilitated the proliferation, colony formation, invasion, and xenograft of breast cancer. (a) Transfection efficiency was measured in the control, miR-ctrl and miR-181a-5p groups of HCC2157 cells by RT-qPCR. Cell proliferation was elevated using (b) CCK-8 assay, (c-d) BrdU assay and (e-f) colony formation assay. (g-h) Cell invasion was examined by transwell assay and invaded cells numbers were quantified. (i) Tumor growth curves, (h) tumor represent images, and (k) tumor weight were measured and showed. (l) The protein expression of AKT and p-AKT (Ser473) was detected using western blot. *P < 0.05 and **P < 0.01 compared with the miR-ctrl group
Silencing of miR-181a-5p suppressed glycolysis of breast cancer
We measured whether miR-181a-5p affects the glycolysis of breast cancer. The data demonstrated that the downregulation of miR-181a-5p reduced glucose consumption and lactate production (Figure 4(a,b)). Additionally, silencing of miR-181a-5p reduced metabolic enzymes activities and protein levels, such as HK2, PKM2, and LDHA (Figure 4(c-g)).
Figure 4.
Silencing of miR-181a-5p inhibited glycolysis of breast cancer cells. (a) Glucose consumption was analyzed via Glucose Assay Kit. (b) The lactate production was assessed by Lactate Assay Kit. (c) HK2, (d) PKM2, and (e) LDHA metabolic enzymes activities were assessed by ELISA. (f) The protein levels of HK2, PKM2, and LDHA were examined using western blot. (g) Gray analysis of western blot. *P < 0.05 and **P < 0.01, compared with the anti-miR-ctrl group
Silencing of miR-181a-5p inhibited glycolysis of breast cancer cells. (a) Glucose consumption was analyzed via Glucose Assay Kit. (b) The lactate production was assessed by Lactate Assay Kit. (c) HK2, (d) PKM2, and (e) LDHA metabolic enzymes activities were assessed by ELISA. (f) The protein levels of HK2, PKM2, and LDHA were examined using western blot. (g) Gray analysis of western blot. *P < 0.05 and **P < 0.01, compared with the anti-miR-ctrl group
NDRG2 was verified as a miR-181a-5p target
To explore the potential molecular mechanism, the targets of miR-181a-5p were identified. Bioinformatic analysis results predicted that 3ʹUTR of NDRG2 has putative binding sites of miR-181a-5p (Figure 5(a)). MiR-181a-5p significantly reduced relative luciferase activity in the wt NDRG2 group rather than in the mt NDRG2 group (Figure 5(b)). Furthermore, NDRG2 was enriched in the biotinylated (Bio)-wt-miR-181a-5p group, compared with the (Bio)-mt-miR-181a-5p group (Figure 5(c)). Then, miR-181a-5p downregulated the mRNA and protein levels of NDRG2 in BT-474, HCC1569, HCC2157, and T-47D cells (Figure 5(d,e)). Moreover, NDRG2 was negatively correlated with miR-181a-5p in tumor tissues (R2 = 0.443, P < 0.001; Figure 5(f)).
Figure 5.
MiR-181a-5p directly targets NDRG2. (a) The putative binding sites of miR-181a-5p with 3ʹUTR of NDRG2 were predicted by TargetScan Human 7.2. (b) The targeted relationship was affirmed by dual-luciferase reporter assay and (c) RNA pull-down assay. NDRG2 expression in BT-474, HCC1569, HCC2157 and T-47D cells was measured by (d) RT-qPCR and (e) western blot. (f) Pearson’s correlation scatters plot analyzed the relationship between miR-181a-5p and NDRG2 in breast cancer. *P < 0.05 and **P < 0.01
MiR-181a-5p directly targets NDRG2. (a) The putative binding sites of miR-181a-5p with 3ʹUTR of NDRG2 were predicted by TargetScan Human 7.2. (b) The targeted relationship was affirmed by dual-luciferase reporter assay and (c) RNA pull-down assay. NDRG2 expression in BT-474, HCC1569, HCC2157 and T-47D cells was measured by (d) RT-qPCR and (e) western blot. (f) Pearson’s correlation scatters plot analyzed the relationship between miR-181a-5p and NDRG2 in breast cancer. *P < 0.05 and **P < 0.01
Knockout of NDRG2 facilitated proliferation, invasion, glycolysis, and PTEN/AKT signaling pathway
To explore the biological function of NDRG2 in breast cancer cells, the levels of NDRG2 were reduced in HCC2157 cells transfected with sgNDRG2-1 and sgNDRG2-2 (Figure 6(a)). Cell proliferation and invasion were facilitated by the knockout of NDRG2 (Figure 6(b-f)). The loss of NDRG2 increased glucose consumption as well as lactate production (Figure 6(g,h)). Additionally, the ratios of p-PTEN/PTEN and p-AKT/AKT were increased by the knockout of NDRG2 (Figure 6(i,j)).
Figure 6.
The knockout of NDRG2 facilitated cell proliferation, invasion, and glycolysis through the PTEN/AKT pathway. (a) Transfection efficiency was examined by western blot after HCC2157 cells transfection of sgNDRG2-1, sgNDRG2-2, and sgNC. Cell proliferation was tested by (b) CCK-8 assay and (c-d) colony formation assay. (e-f) Cell invasion was analyzed using Matrigel transwell assay. (g) Glucose consumption was measured by Glucose Assay Kit. (h) The lactate production was assessed by Lactate Assay Kit. (i) Protein levels of p-PTEN (Ser380/Thr 382/Thr383), PTEN, p-AKT (Ser473), and AKT were detected by western blot, normalizing to GAPDH levels. (j) The ratios of p-PTEN/PTEN and p-AKT/AKT were quantified. *P < 0.05 and **P < 0.01 compared with the sgNC group
The knockout of NDRG2 facilitated cell proliferation, invasion, and glycolysis through the PTEN/AKT pathway. (a) Transfection efficiency was examined by western blot after HCC2157 cells transfection of sgNDRG2-1, sgNDRG2-2, and sgNC. Cell proliferation was tested by (b) CCK-8 assay and (c-d) colony formation assay. (e-f) Cell invasion was analyzed using Matrigel transwell assay. (g) Glucose consumption was measured by Glucose Assay Kit. (h) The lactate production was assessed by Lactate Assay Kit. (i) Protein levels of p-PTEN (Ser380/Thr 382/Thr383), PTEN, p-AKT (Ser473), and AKT were detected by western blot, normalizing to GAPDH levels. (j) The ratios of p-PTEN/PTEN and p-AKT/AKT were quantified. *P < 0.05 and **P < 0.01 compared with the sgNC group
Restoring the expression of NDRG2 rescued the effects induced by miR-181a-5p of breast cancer
Overexpression of miR-181a-5p reduced NDRG2, elevated p-PTEN and p-AKT, but did not affect PTEN and AKT. NDRG2 abolished the effects induced by miR-181a-5p (Figure 7(a,b)). NDRG2 restored the promotion of the proliferation and invasion induced by enforced miR-181a-5p (Figure 7(c-g)). For glycolysis, miR-181a-5p induced the increase of glucose consumption and lactate production, while NDRG2 rescued the increase (Figure 7(h,i)).
Figure 7.
NDRG2 reversed the effects induced by miR-181a-5p. (a) Protein expression of NDRG2, p-PTEN (Ser380/Thr 382/Thr383), PTEN, p-AKT (Ser473) and AKT was tested by western blot. (b) The ratios of p-PTEN/PTEN and p-AKT/AKT were quantified. Cell proliferation capability was assessed by (c) CCK-8 assay and (d-e) colony formation assay. (f-g) Cell invasion ability was assessed by transwell assay. (h) Glucose consumption was detected by Glucose Assay Kit. (i) Lactate production was tested by Lactate Assay Kit. *P < 0.05 and **P < 0.01 compared with the miR-181a-5p group
NDRG2 reversed the effects induced by miR-181a-5p. (a) Protein expression of NDRG2, p-PTEN (Ser380/Thr 382/Thr383), PTEN, p-AKT (Ser473) and AKT was tested by western blot. (b) The ratios of p-PTEN/PTEN and p-AKT/AKT were quantified. Cell proliferation capability was assessed by (c) CCK-8 assay and (d-e) colony formation assay. (f-g) Cell invasion ability was assessed by transwell assay. (h) Glucose consumption was detected by Glucose Assay Kit. (i) Lactate production was tested by Lactate Assay Kit. *P < 0.05 and **P < 0.01 compared with the miR-181a-5p group
Discussion
Breast cancer is prevalent among women, with increasing morbidity, mortality, and economic pressures. On one hand, cellular invasion, one character of malignancy, causes distant metastasis of tumor cells [14]. On the other hand, glycolysis produces ATP to provide energy for tumor cells, and also promotes invasion [15]. HK2, PKM2, and LDHA, glycolysis-associated proteins, affect tumorigenesis, cell growth, migration, autophagy of breast cancer [16]. Therefore, controlling cancer cell invasion and glycolysis could attenuate the development of cancer. Numerous miRNAs are aberrantly expressed in human cancers, and regulated cellular processes, including tumor growth, invasion, angiogenesis, and drug resistance [6]. Therefore, studying the effects of miRNAs on tumor cell invasion and glycolysis has clinical value.Among all miRNAs, miR-181a-5p is known as an oncomiR or tumor suppressor in different types of cancer. For example, as a tumor suppressor, the miR-181a-5p levels are reduced in prostate cancer, which inhibits the proliferation and cell cycle [17]. MiR-181a-5p suppresses the proliferation and migration of non-small-cell lung cancer cells [18]. In contrast, as an oncomiR, miR-181a-5p promotes cervical cancer cell proliferation, invasion, and suppresses cell apoptosis [19]. Silencing of miR-181a-5p suppresses biological behaviors of gastric cancer cells [20]. These studies demonstrated that the function of miR-181a-5p is complex and controversial. More interesting, the role of miR-181a-5p in breast cancer is contradictory. On one hand, miR-181a-5p inhibits cell growth, metastasis, and angiogenesis, attenuating breast cancer progression [21,22]. On the other hand, miR-181a-5p plays an oncogenic role in breast cancer [10,23,24]. In the present study, miR-181a-5p was upregulated in breast cancer tissues and several cell lines, and induced poor prognosis. High or low expression of miR-181a-5p in different cell lines may be because miR-181a-5p is a controversial miRNA. Silencing of miR-181a-5p suppressed cell growth, invasion, glycolysis, and tumor growth. While enforced miR-181a-5p promoted biological behaviors and tumor growth. All these findings indicated that miR-181a-5p acts as a tumor promoter in breast cancer.In this scenario, to better understand the molecular mechanism of miR-181a-5p involved in breast cancer progression, the potential targets of miR-181a-5p were explored. We identified that NDRG2 is a miR-181a-5p target. NDRG2 commonly functions as a tumor suppressor. For instance, increased NDRG2 suppresses esophageal cancer cell proliferation, migration, invasion, and EMT [25]. Additionally, NDRG2 inhibits tumorigenesis of oral squamous cell carcinoma. Overexpression of NDRG2 inhibits cell proliferation and colony formation [26]. In breast cancer, upregulated NDRG2 inhibits cell proliferation, tumor angiogenesis, EMT, glucose uptake, and xenograft tumor growth [27-29]. NDRG2 also functions as a metabolism-related gene, which is associated with energy metabolism, especially glycose metabolism [30]. Previous studies have revealed that NDRG2 suppresses glycolysis of colorectal carcinoma and renal cell carcinoma [31,32]. However, the role of NDRG2 in different subtypes of breast cancer is also controversial. NDRG2 expression is reduced in tumor tissues [13]. But a previous study has reported that NDRG2 is upregulated in basal-like breast cancer and associated with poor prognosis [33]. In the current study, NDRG2 levels were decreased in breast cancer tissues and some cell lines, associated with poor prognosis, and negatively related to miR-181a-5p levels. The knockout of NDRG2 facilitated the proliferation, invasion, and glycolysis of breast cancer. Moreover, NDRG2 rescued the facilitation of biological functions induced by miR-181a-5p. These findings suggested that NDRG2 functions as a tumor suppressor in breast cancer. MiR-181a-5p facilitates the progression of breast cancer via targeting NDRG2.PTEN, a lipid phosphatase, is identified as a tumor suppressor and has the function of regulating growth and survival pathway via the PI3K/AKT pathway [34]. As a PTEN-binding protein, NDRG2 regulates PTEN phosphatase activity through dephosphorylation at Clusters Ser380, Thr382, and Thr383 at the c-terminal tail of PTEN [35]. The main substrate of PTEN, PIP3, could activate AKT, leading to the phosphorylation of AKT [36]. The loss of NDRG2 modulates PTEN dephosphorylation [37,38]. Furthermore, miR-181a-5p also affects cellular processes via the PTEN/AKT signaling pathway [35,39]. Upregulated miR-181a-5p decreased the PTEN expression when miR-181a-5p acts as tumor suppressor [40]. In the present study, the knockout of NDRG2 enhanced the levels of phosphorylation of PTEN and AKT. Moreover, miR-181a-5p promoted p-PTEN and p-AKT levels, while NDRG2 abolished the promotion. This is inconsistent with Ding et al. research, because miR-181a-5p is an oncogene in the study. Taking together, overexpression of miR-181a-5p accelerated breast cancer progression through NDRG2-modulated PTEN/AKT pathway.
Conclusions
MiR-181a-5p serves as an oncomiR and NDRG2 acts as a tumor suppressor in breast cancer. MiR-181a-5p targets NDRG2 to promote proliferation, invasion, and glycolysis by activating the PTEN/AKT pathway. The findings provide a theoretical reference for miR-181a-5p as a therapeutic target for breast cancer .
Authors: Amancio Carnero; Carmen Blanco-Aparicio; Oliver Renner; Wolfgang Link; Juan F M Leal Journal: Curr Cancer Drug Targets Date: 2008-05 Impact factor: 3.428
Authors: Kheshwant S Gill; Philana Fernandes; Tracey R O'Donovan; Sharon L McKenna; Kishore K Doddakula; Derek G Power; Declan M Soden; Patrick F Forde Journal: Biochim Biophys Acta Date: 2016-07-08