Literature DB >> 34949205

Neglected malaria parasites in hard-to-reach areas of Odisha, India: implications in elimination programme.

Madhusmita Bal1, Ramakanta Rana1, Arundhuti Das1, Hemant Kumar Khuntia1, Nilam Somalkar2, Niranjan Sahoo3, Jyoti Ghosal1, Sanghamitra Pati1, Ambarish Dutta4, Manoranjan Ranjit5.   

Abstract

BACKGROUND: Information on the foci of Plasmodium species infections is essential for any country heading towards elimination. Odisha, one of the malaria-endemic states of India is targeting elimination of malaria by 2030. To support decision-making regarding targeted intervention, the distribution of Plasmodium species infections was investigated in hard-to-reach areas where a special malaria elimination drive, namely Durgama Anchalare Malaria Nirakaran (DAMaN) began in 2017.
METHODS: A cross-sectional survey was conducted in 2228 households during July to November 2019 in six districts, to evaluate the occurrence of Plasmodium species. The species were identified by polymerase chain reaction (PCR) followed by sequencing, in case of Plasmodium ovale.
RESULTS: Of the 3557 blood specimens tested, malaria infection was detected in 282 (7.8%) specimens by PCR. Of the total positive samples, 14.1% were P. ovale spp. and 10.3% were Plasmodium malariae infections. The majority of P. ovale spp. (75.8%) infections were mixed with either Plasmodium falciparum and/or Plasmodium vivax and found to be distributed in three geophysical regions (Northern-plateau, Central Tableland and Eastern Ghat) of the State, while P. malariae has been found in Northern-plateau and Eastern Ghat regions. Speciation revealed occurrence of both Plasmodium ovale curtisi (classic type) and Plasmodium ovale wallikeri (variant type).
CONCLUSIONS: In the present study a considerable number of P. ovale spp. and P. malariae were detected in a wide geographical areas of Odisha State, which contributes around 40% of the country's total malaria burden. For successful elimination of malaria within the framework of national programme, P. ovale spp. along with P. malariae needs to be incorporated in surveillance system, especially when P. falciparum and P. vivax spp. are in rapid decline.
© 2021. The Author(s).

Entities:  

Keywords:  Hard-to reach areas; India; Malaria elimination; Odisha; PCR; Plasmodium malariae; Plasmodium ovale spp.

Mesh:

Year:  2021        PMID: 34949205      PMCID: PMC8698664          DOI: 10.1186/s12936-021-04010-8

Source DB:  PubMed          Journal:  Malar J        ISSN: 1475-2875            Impact factor:   2.979


Background

Malaria is one of the most important global public health challenges that contributes to a high burden of mortality and morbidity [1, 2]. According to the World Malaria Report [1, 2] an estimated 215 million malaria cases and 384,000 malaria deaths were reported globally in 2019. Amongst them, 3% are from Southeast Asia and the majority are from India [3]. Of the five Plasmodium species causing malaria in humans Plasmodium falciparum is most virulent and responsible for most fatalities [4]. Plasmodium vivax, once known to cause relapse, has recently been found to be associated with severe clinical presentations and deaths as well [5]. Plasmodium malariae, an established cause of nephrotic syndrome, can lead to progressive renal failure, particularly in adolescents or young adults [6]. Plasmodium knowlesi, a simian parasite, has recently been detected in humans, causing severe disease and fatalities [7]. Plasmodium ovale causes clinically mild disease but possesses the ability to cause relapse, like P. vivax [8]. Molecular fingerprinting has revealed that ovale malaria is caused by two genetically distinct sub-species Plasmodium ovale wallikeri and Plasmodium ovale curtisi [9]. Historically, P. vivax was the predominant species causing malaria in India (> 53%), but in the recent past the proportion P. falciparum has increased to 64%, while P. malariae remained around 2% [10, 11]. Plasmodium ovale spp. has been formally reported on only two occasions from India [12, 13]. Plasmodium knowlesi has not been reported from India so far, but P. knowlesi-specific gene sequences have been reported in the malaria vector Anopheles sundaicus in Andaman and Nicobar Islands [14]. With 4% of the total population of India, the state of Odisha, with its humid and hot climatic conditions and forested low-hill topography, is highly conducive to malaria transmission, and contributes to around 40% of the country’s total burden of malaria, 91.5% of which is caused by P. falciparum and 8.5% by non-falciparum species [15]. The National Framework for Malaria Elimination (NFME) launched by Government of India in 2016 set the goal to eliminate malaria from the entire country by 2030 [16]. Realising this goal as a significant public health challenge, Odisha State chapter of National Vector-borne Disease Control Programme (NVBDCP), which is responsible for malaria control activities in the state, in addition to national initiatives, launched in 2017 a special drive named Durgama Anchalare Malaria Nirakaran (translation: malaria elimination in less accessible areas), in short DAMaN. DAMaN targets high-transmission, recalcitrant malaria ‘pockets’, which were identified in hard-to-reach areas of the state, spread over 23 districts. DAMaN comprised half-yearly mass malaria screening of populations living in villages and hamlets in hard-to-reach areas with historically high malaria burden, less access to routine malaria programme, and complete treatment of malaria positive cases. It also comprised distribution of long-lasting insecticidal nets (LLIN) to large sections of the state population and actively promoted their use. The details of DAMaN are described elsewhere [17]. Although the state has witnessed a drastic reduction in falciparum malaria cases (> 80%) after launching of DAMaN, malaria continues to persist in many hard-to-reach areas [18]. This has led the state to initiate a neutral assessment of DAMaN, which has been described elsewhere [17]. Effective malaria elimination strategy needs not only continuous surveillance of current levels of transmission but also monitoring of the hidden reservoir of other less common malaria species that are often associated with persistent transmission of the disease. Rapid diagnostic tests (RDTs) used in malaria elimination programmes are easy and reliable tools for diagnosis of either P. falciparum or P. vivax, but other species are often unrecognized or underestimated, due to low parasite densities, technical difficulties and observational error [19]. Routine diagnostic tests may not detect rarer malaria-causing species, which may lead to their unchecked transmission. Recently a study conducted in Tanzania has revealed persistent transmission of P. malariae and P. ovale spp. in areas of declining P. falciparum transmission [6]. Whether this scenario is also likely to emerge in traditionally high malaria transmission areas of India that are witnessing a rapid decline in falciparum malaria remains to be seen. Emergence of such situations can have far-reaching public health ramifications, especially for national malaria elimination initiatives, because the transmission of rarer species, also referred as ‘neglected malaria parasites’, is likely to remain undetected and unaddressed by current routine programme measures. This can lead to their persistence in the community, which can continue to fuel transmission of malaria in the country, jeopardizing ambitious elimination goals. Against the backdrop of this apprehension, the decline of falciparum malaria in DAMaN-implemented areas of Odisha afforded the current study the opportunity to examine the presence of less common/neglected malaria species, so that the programme can be informed about their presence, if any. If found present, this can lead to the mounting of control/elimination measures targeted against such neglected malaria species in addition to the routine focus on falciparum and vivax malaria. As a part of the DAMaN assessment study, this current study aimed to identify the presence of different types of malaria species in the communities covered by DAMaN.

Methods

Study setting

DAMaN is being implemented in 23 districts out of 30 administrative districts of the State of Odisha [17]. The current study took place in six DAMaN-implementing districts representing three distinct geophysical regions (Northern plateau: Sundargarh and Keonjhar district, Central table land: Anugul and Kandhamal district and Eastern ghat: Raygada and Kalahandi district) (Fig. 1). The districts have been selected based on the annual parasite index (API), the number of confirmed cases of malaria per 1,000 population reported by NVBDCP-Odisha in 2015.
Fig. 1

Map of Odisha showing sample collection site from six DAMaN implemented Districts (grey). Each site is represented by two blocks comprising 16 sub-centres. Both mono and mixed species infection due to Plasmodium were observed in all five districts (out of six). But P. ovale spp. and P. malariae was found in four study districts. *In Sundargarh and Kalahandi district there was an overlap of symbols as both P. ovale spp. and P. malariae were detected at the same GIS coordinate

Map of Odisha showing sample collection site from six DAMaN implemented Districts (grey). Each site is represented by two blocks comprising 16 sub-centres. Both mono and mixed species infection due to Plasmodium were observed in all five districts (out of six). But P. ovale spp. and P. malariae was found in four study districts. *In Sundargarh and Kalahandi district there was an overlap of symbols as both P. ovale spp. and P. malariae were detected at the same GIS coordinate A survey was conducted at 2,228 households in those six districts between August 2019 and February 2020. One out of six sampled households had pregnant women and one out of two had children under 5 years of age. The average distance of these villages from ICMR-RMRC, Bhubaneswar laboratory is around 300 km. Blood samples were obtained from 3557 consenting individuals who were present at the time of the survey in the selected households.

Blood specimen collection and processing

During this survey 1 ml of venous blood sample was collected in BD Vacutainer ® EDTA tubes. The blood samples collected from the field sites were preserved at 4 ℃ at the local hospital and transported to the ICMR-RMRC laboratory within 24 h. The Pf-PAN RDT (SD- Biosensor, India) was used for point-of-care detection of P. falciparum and/or other Plasmodium infections from a finger prick blood. At least 500 μl blood was taken into a microcuvette and post-centrifugation, the blood components were separated and stored at − 80 ℃. DNA was extracted from the red blood cells (RBCs). Laboratory-confirmed Plasmodium infections were those with parasites in peripheral blood as detected via RDT and/or polymerase chain reaction (PCR).

Species-specific PCR detection of Plasmodium parasites

Genomic DNA was extracted from blood using the QIAamp® DNA Blood Mini Kit (QIAGEN, Germany) and eluted in 50 μl of distilled water. The species-specific nucleotide sequences of the 18S ribosomal RNA (18SrRNA) genes of P. falciparum, P. vivax, P. malariae, and P. ovale spp. were amplified in two successive rounds of PCR as described by Snounou [20]. For differentiation of two sub-species of P. ovale (P. o. curtisi and P. o. wallikeri), partial sequence of small subunit ribosomal (18 S rRNA) gene was amplified by using two-step PCR and confirmed by DNA sequencing. PCR products were visualized under UV light following electrophoresis on 1.2% (w/v) ethidium bromide-stained agarose gel and images captured using a gel documentation system. Briefly, primary PCR was performed using PO1: CTACTTGACATTTCTACT TACA and PO2: CGTTCTTGATTAATGGAAGTAT and nested PCR was carried out using PO3: GCTGTAGCTAATACTTGCTTTA and PO4: TTCACCTCTGACATCTGAATC primers. The primary PCR was performed in a 25 μL reaction mixture that contained 0.2 U of Taq DNA polymerase (GCC Biotech, India), 0.2 mM each dNTP (HIMEDIA Laboratories, India), 0.4 mM each primer (GCC Biotech, India) and 2.0 mM MgCl2 (GCC Biotech, India). The reaction was allowed to proceed for 35 cycles after an initial denaturation at 94 ℃ for 1 min, annealing at 50 ℃ for 1 min and extension at 72 ℃ for 1 min; final extension was at 72 ℃ for 10 min in a Thermal Cycler (Agilent, USA). The nested PCR reaction condition was same as primary PCR except the annealing temperature which was 55 ℃. PCR product of P. ovale spp.-positive samples were purified using QIA quick gel extraction kit (QIAGEN, Germany) following the protocol provided by the manufacturer and then subjected to DNA sequencing. 18 S rRNA gene was sequenced partially from both directions using the above-mentioned primers (PO3 and PO4) in a DNA Sequence Analyser (Applied Bio systems, Life Technology, USA). The consensus sequences were created after editing the DNA sequences using MultAlin (MultAlin Version 5.4.1, INRA, France). The sequences thus obtained were analysed by aligning with the available sequence at the National Centre for Biotechnology Information (NCBI) database for P. o. wallikeri (KF219558.1) and P. o. curtisi (KF696373.1).

Results

Of the 3557 respondents from whom blood samples could be collected, 1,127 (31.7%) were male and 2,430 (68.3%) were female. The age of the study population ranged from 1 to 90 years. Overall, the median age was 24 years (IQR = 26 years) and the mean age was 23.12 years (± SD = 17.09). Amongst the individuals from whom blood samples were collected, 339 (9.5%) were pregnant and 724 (20.4%) were under five years old. Of the 3557 blood samples, 170 (4.8%) were found to be RDT-positive for malaria parasites, whereas PCR successfully amplified Plasmodium DNA in 282 (7.9%) samples (Table 1). Amongst the RDT-negative samples, 50 (1.5%) were PCR-positive; amongst RDT-positive cases, 14 (8.2%) were PCR-negative. PCR identified substantially a higher number of Plasmodium carriages than RDT. Of the total PCR-positive samples, 168 (59.6%) were carrying mono-infection and 114 (40.4%) mixed infections. The majority of the cases with mono-infection were P. vivax, accounting for 40.8%. The P. falciparum mono-infection was present in 15.6% (44/282), P. malariae in 2.5% (7/282) and P. ovale spp. 0.7% (2/282) of the cases. Amongst the mixed infections 29.1% (82/282) were double infection, 10.3% (29/282) were triple infection, and 1.1% (3/282) quadruple infection. Out of 82 mixed infections P. ovale spp. was found in 27 (32.9%) of the cases and the majority (22 out of 27, 75.8%) were mixed with either P. falciparum and/or P. vivax (Table 2). Amongst the 29 P. ovale spp. PCR-positive individuals, 12 (41.4%) were clinically symptomatic, while 17 (58.6%) were clinically asymptomatic. Overall, the median age of the individuals positive for P. ovale spp. was 8 years (IQR = 22.5 years) and the majority were female (n = 17, 58.6%), two were pregnant/lactating. Asymptomatic malaria in this study was classified as a malaria infection (PCR positive) found in participants with axillary temperature < 37.5 °C at the time of the survey with absence of fever within the previous two days. Participants with asymptomatic malaria accounted for 55.67% (157/282) of the study population, and symptomatic 44.3% (125/282).
Table 1

Details of blood samples collection sites from six DAMaN-implemented districts of Odisha

DistrictBlockBlood specimen collectedRDTPCR
AngulPallahara298 (39.2%)4 (1.3%)4 (1.3%)
AngulChendipada268 (34.3%)3 (1.1%)4 (1.5%)
KalahandiBiswanathpur251 (38.0%)23 (9.2%)49 (19.5%)
KalahandiM. Rampur181 (34.9%)13 (7.2%)10 (5.5%)
KandhamalG.udayagiri320 (49.9%)0 (0.0%)0 (0%)
KandhamalTikabali296 (38.8%)0 (0.0%)0 (0%)
KeonjharHarichandanpur402 (40.5%)4 (1.0%)4 (1%)
KeonjharTelkoi208 (36.6%)1 (0.5%)0 (0%)
RayagadaChandrapur331 (43.2%)81 (24.5%)102 (30.8%)
RayagadaKashipur339 (52.5%)15 (4.4%)9 (2.7%)
SundargarhLahunipara292 (51.7%)24 (8.2%)100 (34.2%)
SundargarhGurundia371 (45.5%)2 (0.5%)0 (0%)
Total3557170282

The results of two different diagnostic tests (RDT and PCR) are mentioned

Table 2

Different malaria species infection dynamics as mono or mixed infection in six districts of Odisha

DistrictAngulKalahandiKandhamalKeonjharRayagadaSundargarhTotal
BlockPallaharaChendipadaBiswanathpurM. RampurG.udayagiriTikabaliHarichandanpurTelkoiChandrapurKashipurLahuniparaGurundia
Mono infection
 Pf416200202801044
 Pv011650000253650115
 Pm0010000060007
 Po0010000010002
Total mono infection422470020603660168
Total mixed infection (Pf, Pv/ Pf, Po/ Pv, Pm/ Pf, Pv, Pm / Pv, Pm, Po/ Pf, Pv, Po / Pf, Pv, Pm, Po)022530020426340114
P ovale spp found in mixed infection011200000806027
P malariae found in mixed infection014000009010024
Details of blood samples collection sites from six DAMaN-implemented districts of Odisha The results of two different diagnostic tests (RDT and PCR) are mentioned Different malaria species infection dynamics as mono or mixed infection in six districts of Odisha The presence of P. ovale spp. malaria was detected in five community health centres (CHCs) belonging to four districts and three geophysical regions. Prevalence estimates ranged from a maximum of 12.9% (43 out of 331) in Chandrapur CHC of Raygada district to a minimum of 0.74% (2 out of 268) in Chhendipada CHC of Anugul district. Region-wise distribution indicated high prevalence of P. ovale spp. in Eastern ghat (Raygada and Kalahandi), Central table land (Anugul) and Northern plateau (Sundargarh) regions. However, P. malariae has been detected in three districts belonging to Eastern ghat (Raygada and Kalahandi) and Northern plateau (Sundargarh) regions. Of the 29 samples that were PCR-positive for P. ovale spp., 5 (17.2%) belong to P. o. wallikeri, 11 (37.9%) P. o. curtisi and 13 (44.8%) to both P. o. wallikeri and P. o. curtisi. DNA sequencing was carried out using PCR product of seven P. ovale spp.-positive samples, which were of sufficient quality and quantity for the detection of distinct Plasmodium spp. 18S haplotypes in an ABI-3730 XL DNA Analyser (Applied Biosystems). Obtained DNA sequences after editing were analysed by aligning with the sequence available at the NCBI Gene Bank for P. o. curtisi and P. o. wallikeri. The sequence data have been submitted to the NCBI data base and the GenBank Accession No of P. o. curtisi is MW426407/MW 426,410 /MW426419/MW426434/W426443 and P. o. wallikeri is MW295851/MW295941 (Fig. 2).
Fig. 2

Nucleotide sequence of PCR amplified fragment of A Plasmodium ovale curtisi (MW426419108) and B Plasmodium ovale wallikeri (MW295941) 18 s r RNA gene, showing alignment with National Centre for Biotechnology Information (NCBI) database sequence for P. ovale curtisi (KF696374.1 and KF696373.1) and P. ovale wallikeri (KF219558.1 and KF219560.1) using multalin

Nucleotide sequence of PCR amplified fragment of A Plasmodium ovale curtisi (MW426419108) and B Plasmodium ovale wallikeri (MW295941) 18 s r RNA gene, showing alignment with National Centre for Biotechnology Information (NCBI) database sequence for P. ovale curtisi (KF696374.1 and KF696373.1) and P. ovale wallikeri (KF219558.1 and KF219560.1) using multalin

Discussion

This study has demonstrated, the presence of P. ovale spp. in different geophysical regions of Odisha, an eastern Indian state. In contrast, the previous studies in India reported presence of P. ovale spp, in few individuals or restricted to certain foci. The majority of P. ovale spp. infections observed were mixed with either P. falciparum and/or P. vivax. Molecular typing of P. ovale spp. indicated sympatric distribution of the sibling species of P. o. wallikeri and P. o. curtisi. In addition, the study recorded prevalence of P. malariae, another rare malaria parasite in 10.3% of positive samples (irrespective of their status of single or mixed infections). PCR assay has been used to obtain a high sensitivity and specificity in detection of both mixed-species and non-falciparum infections. Although generally considered benign, P. ovale spp. and P. malariae have the potential to cause significant morbidity. Recently reports of P. ovale spp. infection with acute respiratory distress syndrome (ARDS) [8], acute renal failure [21] and splenic complications [22] have drawn the attention of public health researchers. Plasmodium ovale spp. has limited distribution, with endemic transmission traditionally limited to areas of tropical Africa, New Guinea, the eastern parts of Indonesia and the Philippines. Infections with P. ovale spp. however, have also been reported in the Middle East and different parts of Southeast Asia [23]. With respect to the Indian sub-continent, cases of P. ovale spp. has been reported from Bastar Division of Madhya Pradesh in 2017 [13] and three cases in Koraput District of Odisha in 1989 [24]. However, detection of P. ovale spp. infections during the current survey, using PCR in a wide geographical area (covering north to south) of a state that has been experiencing substantial reduction of P. falciparum infection lately, might be one of the risk factor in persistence of malaria in the future. Furthermore, prevalence of P. ovale spp. infections almost exclusively as mixed species infections with P. falciparum and/or P. vivax rather than mono-infections, illustrates that the transmission of P. ovale spp. followed those of P. falciparum and/or P. vivax. Identification of the sibling species P. o. curtisi and P. o. wallikeri of P. ovale alone and in combination during the present study can conclude that there is no general physical or temporal barrier preventing recombination of these related parasite species, but rather that P. o. curtisi and P. o. wallikeri maintain their distinct genetic identity through yet unknown biological mechanisms [25]. Moreover, P. malariae infections have been observed in all major malaria-endemic regions of the world [26] including India. Earlier studies in Odisha have reported similar, relatively higher prevalence of P. malariae (9.1% mono-infection and 10.9% mixed with either P. falciparum and/or P. vivax) [26] in comparison to that of P. ovale spp. that was currently observed in the DAMaN assessment survey. Diagnosis of P. ovale spp. and P. malariae can be done by microscopy but is often confused with P. vivax. RDTs are even less sensitive for detection of non-falciparum malaria (NFM) as compared to microscopy. However, PCR, being most sensitive for such purpose, has been recognized as a valuable tool for confirming or diagnosing NFM, especially in less-endemic regions [27]. According to current WHO guidelines, primaquine treatment is recommended to prevent relapses of P. ovale spp. infections [28]. The first-line anti-malarial treatment used at the study site was chloroquine for vivax malaria and artemisinin-based combination therapy (ACT) for falciparum malaria as per NVBDCP guidelines. ACT was readily available in the villages where the survey was conducted, as these pockets were mostly ravaged by falciparum malaria. It is well known that ACT, meant for targeting P. falciparum in national programmes, is also highly efficacious against asexual stages of both P. malariae and P. ovale spp. However, to prevent relapses of malaria from these two rarer/neglected species, radical treatment with primaquine is necessary, or else they will remain in circulation and continue to fuel the malaria problem. This can only be undertaken when the programme can detect the rarer/neglected species routinely, the modalities of which may be studied through an implementation research framework. However, currently there is no provision for this, and rightly so, because the rarer/neglected species are yet to caste a considerable burden on malaria scenario in the country. The current study demonstrates that as India gears up to eliminate malaria by 2030, the burden of malaria due to rarer/neglected species can assume substantial proportions in the face of dwindling rates of falciparum and vivax malaria. This study informs the national programme of what might be a future challenge, so that pre-emptive measures can be instituted. The findings highlight some of the key challenges that need to be addressed if malaria elimination is to be achieved in the Indian sub-continent. The observed high and wide prevalence of P. ovale spp and P. malariae in a geographical area where the prevalence of P. falciparum has declined may support previously raised concerns that strategies designed for reducing transmission of P. falciparum may be less effective in reducing transmission of the non-falciparum species of Plasmodium [6]. Further studies will be crucial for confirming if control and elimination strategies targeting P. falciparum and P. vivax are as effective with P. ovale spp. and P. malariae or if additional strategies will be necessary to eliminate these broadly distributed and chronically under-detected rarer/neglected species of malaria. The current malaria programme of India may have to be redesigned with newer diagnostic and surveillance tools and treatment protocols to address rarer/neglected malaria species, especially when P. falciparum and P. vivax spp. are in rapid decline. Microscopy and currently available RDTs have their merits and demerits in diagnosis of P. ovale spp. and P. malariae. However, molecular-based diagnostic approach is a highly sensitive and specific method to determine the molecular signature of all human Plasmodium spp. During the COVID-19 pandemic all district headquarter hospitals (DHHs) have established molecular diagnostic facility and deployed trained human resources for diagnosis and reporting of SARS-CoV-2 infection in resource-prone states such as Odisha. These laboratories can be utilized as a central facility in future for diagnosis and confirmation of malaria species, particularly rare species, in those high-burden malaria districts. In the absence of proper diagnosis of malaria species, the ambitious goal of malaria elimination may otherwise be derailed by a surge in these rarer species.

Conclusions

The study presents to the malaria control community the wide distribution of P. ovale spp. and P. malariae in different geophysical regions of the state of Odisha. This finding may spur incorporation of appropriate surveillance strategies by the national malaria programme to detect such rarer/neglected species in the community. That may further lead to institution of newer treatment modalities to combat these parasites within the framework of the programme, so that comprehensive malaria elimination can be achieved in India.
  22 in total

1.  Genotyping of Plasmodium spp. Nested PCR.

Authors:  Georges Snounou
Journal:  Methods Mol Med       Date:  2002

Review 2.  Malaria elimination drive in Odisha: Hope for halting the transmission.

Authors:  Madan Mohan Pradhan; P K Meherda
Journal:  J Vector Borne Dis       Date:  2019 Jan-Mar       Impact factor: 1.688

3.  Discordance in drug resistance-associated mutation patterns in marker genes of Plasmodium falciparum and Plasmodium knowlesi during coinfections.

Authors:  Rupesh K Tyagi; Manoj K Das; Shiv S Singh; Yagya D Sharma
Journal:  J Antimicrob Chemother       Date:  2013-01-04       Impact factor: 5.790

Review 4.  Plasmodium malariae and Plasmodium ovale--the "bashful" malaria parasites.

Authors:  Ivo Mueller; Peter A Zimmerman; John C Reeder
Journal:  Trends Parasitol       Date:  2007-04-24

5.  An observational study of malaria in British travellers: Plasmodium ovale wallikeri and Plasmodium ovale curtisi differ significantly in the duration of latency.

Authors:  Debbie Nolder; Mary C Oguike; Hector Maxwell-Scott; Hatoon A Niyazi; Valerie Smith; Peter L Chiodini; Colin J Sutherland
Journal:  BMJ Open       Date:  2013-05-28       Impact factor: 2.692

Review 6.  Epidemiology of Plasmodium vivax Malaria in India.

Authors:  Anupkumar R Anvikar; Naman Shah; Akshay C Dhariwal; Gagan Singh Sonal; Madan Mohan Pradhan; Susanta K Ghosh; Neena Valecha
Journal:  Am J Trop Med Hyg       Date:  2016-10-05       Impact factor: 2.345

Review 7.  A systematic review of the clinical presentation, treatment and relapse characteristics of human Plasmodium ovale malaria.

Authors:  Mirjam Groger; Hannah S Fischer; Luzia Veletzky; Albert Lalremruata; Michael Ramharter
Journal:  Malar J       Date:  2017-03-11       Impact factor: 2.979

8.  Under the Radar: Epidemiology of Plasmodium ovale in the Democratic Republic of the Congo.

Authors:  Cedar L Mitchell; Nicholas F Brazeau; Corinna Keeler; Melchior Kashamuka Mwandagalirwa; Antoinette K Tshefu; Jonathan J Juliano; Steven R Meshnick
Journal:  J Infect Dis       Date:  2021-03-29       Impact factor: 5.226

9.  Acute respiratory distress syndrome and acute renal failure from Plasmodium ovale infection with fatal outcome.

Authors:  Yee-Ling Lau; Wenn-Chyau Lee; Lian-Huat Tan; Adeeba Kamarulzaman; Sharifah Faridah Syed Omar; Mun-Yik Fong; Fei-Wen Cheong; Rohela Mahmud
Journal:  Malar J       Date:  2013-11-04       Impact factor: 2.979

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.