Chimeric crRNA improves CRISPR-Cas12a specificity in the N501Y mutation detection of Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2.

Many CRISPR/Cas platforms have been established for the detection of SARS-CoV-2. But the detection platform of the variants of SARS-CoV-2 is scarce because its specificity is very challenging to achieve for those with only one or a few nucleotide(s) differences. Here, we report for the first time that chimeric crRNA could be critical in enhancing the specificity of CRISPR-Cas12a detecting of N501Y, which is shared by Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2 without compromising its sensitivity. This strategy could also be applied to detect other SARS-CoV-2 variants that differ only one or a few nucleotide(s) differences.

Introduction

The emergence of SARS-CoV-2 variants, including B.1.1.7 (Alpha), B.1.351 (Beta), P.1 (Gamma), B.1.617.2 (Delta), C.37 (Lambda), and B.1.621 (Mu) continues to challenge infection control through accelerating transmission and/or escaping neutralization with the current vaccines [1-4]. It intensifies the urge to develop rapid detection tests that directly recognize these variants to triage those exposed for implementing measures of isolation or quarantine. CRISPR/Cas platform is an alternative and rapid method based on nucleic acid detection without expensive devices. It has been applied to SARS-CoV-2 and/or variants detection, including Cas9 (RAY [5]), Cas12a (DETECTR [6] and miSHELOCK [7]), and Cas13a (SHERLOCK [8]). Among them, the Cas12a system is faster than Cas13a as Cas13a requires in vitro transcription for detection, and possess higher target specificity than CRISPR-Cas9 system as the latter is more tolerant to mismatch [9]. Thus, CRISPR-Cas12a was used in our study. Detection of the N501Y plays a crucial role in identifying the Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2 as N501Y mutation is shared by these variants. However, the hurdle for designing crRNA with high specificity for detecting N501Y is primarily due to single nucleotide substituting wild-type SARS-CoV-2. We report here a chimeric crRNA which could be efficiently used to detect N501Y with high specificity and sensitivity by CRISPR-Cas12a.

Results

We have designed and compared three different types of N501Y crRNA, namely, N501Y crRNA 20-nt (20-nt spacer, designing 20-nt spacer crRNAs is the traditional strategy for genome editing and detection by CRISPR-Cas12a, and in accordance, this 20-nt crRNA has recently been used to detect N501Y in miSHERLOCK platform [7]), N501Y chimeric crRNA 24-nt (24-nt spacer), and N501Y crRNA 24-nt (24-nt spacer) to determine the most efficient crRNA used for N501Y detection (The sequences of primers and crRNAs are given in Table 1). N501Y chimeric crRNA 24-nt was designed according to the method by Kim et al. replacing the last 8-nt of the crRNA with DNA which can improve CRISPR-Cas12a specificity of target DNA cleavage [9]. However, whether this kind of chimeric crRNA can increase the specificity of detection (collateral effect of Cas12a) has not been determined as per our knowledge. Therefore, N501Y crRNA 24-nt was also designed to evaluate whether the length of crRNA influences the specificity. We observed that the chimeric crRNA works best to differentiate N501Y from wild type as there is no false positive signal compared with a strong false positive signal for wild type when using N501Y crRNA 20-nt and N501Y crRNA 24-nt (Fig 1A). Thus, the chimeric crRNA enhances the specificity of the detection assay.

Table 1

Sequences of primers and crRNAs used in this study.

crRNAs and primers	Sequences	Length (nt)
N501Y chimeric crRNA 24-nt	UAAUUUCUACUAAGUGUAGAUCAACCCACUUAUGGUGTTGGTTAC	45 (The last 8-nt are DNA)
N501Y crRNA 24-nt	UAAUUUCUACUAAGUGUAGAUCAACCCACUUAUGGUGUUGGUUAC	45
N501Y crRNA 20-nta	UAAUUUCUACUAAGUGUAGAUCAACCCACUUAUGGUGUUGG	41
N501Y RPA F	CAGGCCGGTAGCACACCTTGTAATGGTGTT	30
N501Y RPA R	TTGCTGGTGCATGTAGAAGTTCAAAAGAAAG	31
T7-3G IVT primer [10]	GAAATTAATACGACTCACTATAGGG	25
N501Y crRNA 24-nt IVT template	GTAACCAACACCATAAGTGGGTTGATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC	70
N501Y crRNA 20-nt IVT template	CCAACACCATAAGTGGGTTGATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC	66

a The sequence is the same as N501Y crRNA of miSHERLOCK [7].

Fig 1

Specificity and sensitivity of different crRNAs using synthetic RNA containing gene fragments of SARS-CoV-2.

(A) Detection of N501Y variant and wild type using N501Y chimeric crRNA 24-nt, crRNA 24-nt, and crRNA 20-nt after incubation at 37 °C for 10 min. Four replicates were run (n = 4). Recombinase Polymerase Amplification (RPA) using 1E+09 copies of synthetic DNA containing gene fragments of SARS-CoV-2 as a template. (B) Table summarizing positive rate (visualization of the tube) of N501Y and wild type when using different crRNAs after incubation for 1 h. (C) Detection of N501Y variant and wild type using N501Y crRNA 20-nt after incubation for 1 h. The (a) indicates false positive fluorescence signal of the wild type. (D) Detection of N501Y variant and wild type using N501Y chimeric crRNA 24-nt after incubation for 1 h. No false positive signal was obtained. The horizontal red dashed lines indicate the threshold fluorescence signal that can be visualized under UV light. The threshold level of 5000 AU has been determined for visualizing under UV light and validated against spectrophotometry reading. Tenfold serial dilutions (copy number per μL) of synthetic RNA containing gene fragments of SARS-CoV-2 was used for (B), (C), and (D). Four replicates were run for each time and repeated three times for (B), (C), and (D) (n = 12). NC stands for non-template control. Error bars represent the standard deviation of the mean. For (A), (C), and (D), statistical analysis was performed using a one-way ANOVA test with Dunnett’s multiple comparisons test. Where the raw fluorescence (AU) of each reaction was compared to the respective NCs. The asterisks (*, **, ***, ****) indicate significant differences with p < 0.05, p < 0.01, p < 0.001, and p < 0.0001 and ns denotes not significant (p > 0.05).

To determine whether the specificity and sensitivity of N501Y chimeric crRNA 24-nt is significant for N501Y detection, the limit of detection (LOD) was evaluated compared to N501Y crRNA 20-nt using the tenfold serial dilutions of synthetic RNA containing gene fragments of SARS-CoV-2. The fluorescent signal was evaluated by spectrophotometer (BioTeK Synergy H1 microplate reader, northern Vermont, USA) and the tubes were visualized by UV light of ChemiDoc™ Touch Imaging System (California, USA). Compared with N501Y crRNA 20-nt, the N501Y chimeric crRNA 24-nt achieved the same LOD (100 copies /μL RNA) for detecting N501Y samples (Fig 1B and 1D). Although the fluorescent signal of chimeric crRNA was lower than that of regular crRNA (Fig 1C and 1D), it could differentiate the signal between the N501Y and the wild type spectrophotometrically and visually without compromising the LOD. In the detection of samples containing wild type N501, N501Y crRNA 20-nt produced a weak false positive in the CRISPR-Cas12a reaction after incubation of 30 min (Fig 2A and 2B). After incubation for 1 h, the false positive signal is clearly visualized for ≥ 1×103 copies of RNA under UV light, as shown in Fig 1C. The fluorescent signal of the wild type was not visible when chimeric crRNA was used for tube detection under UV light (there was no false positive for chimeric crRNA even after 2 h incubation, Fig 2C and 2D). We observed similar results (LOD and false positive signal for N501Y crRNA 20-nt) using synthetic DNA containing gene fragments of SARS-CoV-2 (S1 Fig). The fluorescent signal could also be detected using blue LED light and orange acrylic goggles as a filter (S2 Fig). Thus, the chimeric crRNA can improve the specificity of CRISPR-Cas12a without compromising its sensitivity in detecting N501Y.

Fig 2

Specificity of different crRNAs using synthetic RNA containing gene fragments of SARS-CoV-2.

(A) Detection of N501Y variant and wild type using N501Y crRNA 20-nt after incubation for 30 min. The (a) indicates false positive fluorescence signal of the wild type. (B) Table summarizing positive rate (visualization of the tube) of N501Y and wild type when using N501Y crRNA 20-nt after incubation for 30 min. (C) Detection of N501Y variant and wild type using N501Y chimeric crRNA 24-nt after incubation for 2 h. No false positive signal was obtained. (D) Table summarizing positive rate (visualization of the tube) of N501Y and wild type when using N501Y chimeric crRNA 24-nt after incubation for 2 h. The horizontal red dashed lines indicate the threshold fluorescence signal that can be visualized under UV light. The threshold level of 5000 AU has been determined for visualizing under UV light and validated against spectrophotometry reading. Tenfold serial dilutions (copy number per μL) of synthetic RNA containing gene fragments of SARS-CoV-2 was used. Four replicates were run for each time and repeated three times (n = 12). NC stands for non-template control. Error bars represent the standard deviation of the mean. For (A) and (C), statistical analysis was performed using a one-way ANOVA test with Dunnett’s multiple comparisons test. Where the raw fluorescence (AU) of each reaction was compared to the respective NCs. The asterisks (*, **, ***, ****) indicate significant differences with p < 0.05, p < 0.01, p < 0.001, and p < 0.0001 and ns denotes not significant (p > 0.05).

Discussion

We report for the first time that chimeric crRNA can be used to efficiently differentiate N501Y of Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2 from the wild type and other variants. The sensitivity of chimeric crRNA is comparable to regular crRNA, whereas the specificity is higher and can be stable for more than 2 h. It improves and provides the versatility of applying CRISPR-Cas12a in a larger throughput, even as a point-of-care testing (POCT). Replacing the last 8-nt of the crRNA with DNA can decrease the binding energy between crRNA and target DNA, leading to less off-target of CRISPR-Cas12a [9]. RNA-guided Cas12a unleashes indiscriminate single-stranded DNase activity when CRISPR-Cas12a recognizes its target [11]. As the detection signal is produced by cleavage of fluorophore-quenched ssDNA fluorescent reporter, improving on-target specificity by chimeric crRNA 24-nt can increase the specificity of CRISPR-Cas12a detection. Designing chimeric crRNA can also be used for other variants detection with only one or a few nucleotide(s) differences. The primers and chimeric crRNA of our study can be developed into all-in-one tube detection using RPA and CRISPR-Cas12a. To further differentiate Alpha, Beta, Gamma, and Mu, other mutation sites in the Spike protein like 69–70 deletion or 144 deletion, 242–244 deletion or K417N, R190S or K417T, T95I or R346K can be detected respectively.

Materials and methods

Target RNAs and crRNAs preparation

Target RNAs were prepared from synthetic gene fragments of SARS-CoV-2 (Beijing Genomics Institute, BGI). The gene fragments were amplified using primer with T7 promoter by PCR followed by target RNAs synthesis through in vitro transcription (IVT, HiScribe T7 Quick High Yield RNA Synthesis Kit, NEB) using the PCR products. The IVT products were treated with TURBO DNase (Thermo Scientific) to remove the template and purified by Monarch RNA Cleanup Kit (NEB).

crRNAs were prepared by IVT (HiScribe T7 Quick High Yield RNA Synthesis Kit, NEB) using annealed crRNA templates with T7 promoter. The IVT products was purified as mentioned above for target RNAs.

RPA and RT-RPA amplification

A 50 μL reaction mixture was prepared with 25 μL 2x Reaction Buffer (TwistAmp® Liquid Basic), 2.25 μL dNTPs (10 mM each dNTP, NEB, N0447S), 5 μL 10x Basic E-mix (TwistAmp® Liquid Basic), 2.4 μL each of the RPA primers (10 μM), 1.6 μL AMV Reverse Transcriptase (NEB: M0277L, only required for RT-RPA), 2.5 μL 20x Core Reaction Mix, 2.5 μL of 280mM MgOAc, and 5 μL RNA or DNA template, water to make up the volume to 50 μL. The reaction mix was incubated at 37 °C for 40 min and heated at 65 °C for 10 min.

CRISPR-Cas12a detection

CRISPR-Cas12a detection mixture was prepared according to Broughton et al. [6]. In brief, 11.2 μL H2O, 2 μL 10 × NEB buffer 2.1, 0.8 μL EnGen Lba Cas12a (1 μM, NEB), 2 μL crRNA (400 nM) was premixed and incubated at 37 °C for 30 min. Then, 2 μL fluorophore-quenched ssDNA fluorescent reporter (1 μM, FAM-TTATTATT-BHQ1, BGI) and 2 μL of RPA products were added. Fluorescent intensities were monitored every 10 min at 37 °C for 2 h by BioTeK Synergy H1 microplate reader with 5’FAM channel (Excitation/Bandwidth: 484/12.5 and Emission/Bandwidth: 530/12.5). For tube detection, the tube was incubated at 37 °C before visualizing by ChemiDoc™ Touch Imaging System (Bio-Rad). The fluorescent signal of the tube was also visualized by blue LED light (with filter: an orange acrylic goggle (Invitrogen Safe Imager) was placed on top to filter out blue light and enhance contrast (S2 Fig). To enhance contrast a black paper with a non-reflection surface was used.

Statistical analysis

Statistical analysis was performed using a one-way ANOVA test with Dunnett’s multiple comparisons test by GraphPad Prism 9 (GraphPad Software, Inc.). A p value < 0.05 was considered significant.

Specificity and sensitivity of two type crRNAs using tenfold serial dilutions of synthetic DNA (copy number per μL) containing gene fragments of SARS-CoV-2.

(A) Detection of N501Y variant and wild type using N501Y crRNA 20-nt after incubation for 1 h. The (a) indicates fluorescence of the wild type could be visualized. (B) Detection of N501Y variant and wild type using N501Y chimeric crRNA 24-nt after incubation for 1 h. No false positive signal is obtained. The horizontal red dashed lines indicate the threshold fluorescence signal that can be visualized under UV light. The threshold level of 5000 AU has been determined for visualizing under UV light and validated against spectrophotometry reading. NC stands for non-template control. Error bars represent the standard deviation of means. (C) Table summarizing positive rate of N501Y and wild type when using different crRNAs after incubation for 1 h. Eight replicates were run (n = 8). For (A) and (B), statistical analysis was performed using a one-way ANOVA test with Dunnett’s multiple comparisons test. Where the raw fluorescence (AU) of each reaction was compared to the respective NCs. The asterisks (*, **, ***, ****) indicate significant differences with p < 0.05, p < 0.01, p < 0.001, and p < 0.0001 and ns denotes not significant (p > 0.05).

(TIF)

Click here for additional data file.

Visualization of sample tubes by easily available materials.

(A) Equipment used for signal visualization, including blue LED light, filter (an orange acrylic goggles (Invitrogen Safe Imager)), sample tubes, and black paper with a non-reflective surface. (B) Photograph of P (positive) and N (negative) samples under blue LED light.

(TIF)

Click here for additional data file.

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

8 Nov 2021

PONE-D-21-31939Chimeric crRNA improves CRISPR–Cas12a specificity in the N501Y mutation detection of Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2PLOS ONE

Dear Dr. Ip,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Dec 23 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Yu-Hsuan Tsai

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

[This work was supported by internal grants from the Department of Microbiology, Faculty of Medicine, The Chinese University of Hong Kong.]

We note that you have provided funding information that is currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

[This work was supported by internal grants from the Department of Microbiology, Faculty of Medicine, The Chinese University of Hong Kong.]

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

5.  Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The baseline of the conclusion which chimeric crRNA improves the specificity of Cas12a-based detection of COVID-19 N501Y variant is acceptable and can be useful for the scientific community once the data is published. The following comments need to be addressed in the revision:

1. How does the LOD of 5,000 raw fluorescent units be selected? It seems that this is chosen in this paper with the intention to differentiate the detection result with crRNA 20-nt and chimeric crRNA 24-nt as false positive and negative, which makes the result more interesting. The more rigorous way to report specificity improvement using the fold change in background signal (e.g. ~ 3-fold) . Also, since the maximum signal of detection in chimeric crRNA also reduces, the author should compare the dynamic range of detection using different crRNA.

2. Statistical analysis of significance is not performed in all bar graphs where such analysis is needed and the method of statistical analysis is missing in the method section.

Reviewer #2: Overall comments & recommendations:

The aim of the study is the first report that chimeric crRNA could be useful for enhancing detection of the specificity of CRISPR-Cas12a for SARS-CoV-2 mutation N501Y, which is shared by Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2 without reducing its sensitivity.

To test specificity, the authors developed N501Y chimeric crRNA 24-nt sequence and compared it with crRNA 20-nt to test N501Y variant and wild type of the virus. In addition, to determine whether the sensitivity of N501Y chimeric crRNA 24-nt is significant for N501Y detection, the limit of detection (LoD) was evaluated and compared to N501Y crRNA 20-nt using the tenfold serial dilution of synthetic RNA containing gene fragments of SARS-CoV-2.

The study provided valuable data on this chimeric crRNA. However, there are some comments on the study.

1.In the background section, the authors should explain how application of chimeric crRNA on N501Y detection is significant. And, the authors should further describe how to identify the variants of Alpha, Beta, Gamma, and Mu.

2. Please describe Statistical analysis in Method.

3.In Discussion, the effectiveness and mechanism of chimeric crRNA on N501Y is needed to discuss.

4.Lines149: Please describe the SARS-CoV-2 origins in the experiment

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Zhuobin Liang

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Comment.docx

Click here for additional data file.

16 Nov 2021

12th November, 2021

To Professor Emily Chenette

Editor in Chief,

PLOS ONE

Dear Prof. Emily Chenette,

Submission of revised manuscript entitled “Chimeric crRNA improves CRISPR–Cas12a specificity in the N501Y mutation detection of Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2”

We enclose hereby the revised manuscript entitled “Chimeric crRNA improves CRISPR–Cas12a specificity in the N501Y mutation detection of Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2” for considering to publish in your renowned journal PLOS ONE.

We are very grateful for your comments and of the reviewers’. Our point-by-point response to the reviewers’ comments follow and our detailed revisions in the manuscript are highlighted with Tracked changes

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response: This manuscript has been prepared according to PLOS ONE’s style requirements and file naming format.

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

[This work was supported by internal grants from the Department of Microbiology, Faculty of Medicine, The Chinese University of Hong Kong.]

We note that you have provided funding information that is currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

[This work was supported by internal grants from the Department of Microbiology, Faculty of Medicine, The Chinese University of Hong Kong.]

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Response: For your kind information, the funding-related text, “This work was supported by internal grants from the Department of Microbiology, Faculty of Medicine, The Chinese University of Hong Kong.” has been removed from the revised manuscript. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

Response: We do not wish to change our Data Availability statement.

4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

Response: ‘Data not shown’ has been replaced by Fig 2 and we have added the data in the revised manuscript. Please refer to line 123 in the revised manuscript with track changes.

5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Response: The reference list is complete and correct. There is no retracted paper. We added Ref 10 and Ref 11 to the list. Please check the revised manuscript. For your kind information:

10. Kellner MJ, Koob JG, Gootenberg JS, Abudayyeh OO, Zhang F. SHERLOCK: nucleic acid detection with CRISPR nucleases. Nat Protoc. 2019;14: 2986–3012. doi:10.1038/s41596-019-0210-2

11. Chen JS, Ma E, Harrington LB, DaCosta M, Tian X, Palefsky JM, et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018;360: 436–439. doi:10.1126/science.aar6245

Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The baseline of the conclusion which chimeric crRNA improves the specificity of Cas12a-based detection of COVID-19 N501Y variant is acceptable and can be useful for the scientific community once the data is published. The following comments need to be addressed in the revision:

1. How does the LOD of 5,000 raw fluorescent units be selected? It seems that this is chosen in this paper with the intention to differentiate the detection result with crRNA 20-nt and chimeric crRNA 24-nt as false positive and negative, which makes the result more interesting. The more rigorous way to report specificity improvement using the fold change in background signal (e.g. ~ 3-fold) . Also, since the maximum signal of detection in chimeric crRNA also reduces, the author should compare the dynamic range of detection using different crRNA.

Response: Many thanks for your comments. It is very important issue you raised here. We have explained in the manuscript how 5000 AU was chosen as the threshold. For your kind information, below 5000 AU from the spectrophotometry reading, these test tubes are not visible under UV light. The signal of the N501Y and wild type of chimeric crRNA 24-nt is lower than that of crRNA 20-nt, so the fold change cannot give the exact picture of specificity in this case. That is why we have provided the data with 5000 AU as the threshold. We did not mention any dynamic range because when the signal is below 5000 AU, it cannot be visualized whereas at any value above 5000 AU, it has been visualized.

2. Statistical analysis of significance is not performed in all bar graphs where such analysis is needed and the method of statistical analysis is missing in the method section.

Response: Thank you very much for your suggestions. Statistical analysis results have been added to all bar graphs. We also added the method of statistical analysis in the method section. Please check line 198 of the revised manuscript with track changes.

Reviewer #2: Overall comments & recommendations:

The aim of the study is the first report that chimeric crRNA could be useful for enhancing detection of the specificity of CRISPR-Cas12a for SARS-CoV-2 mutation N501Y, which is shared by Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2 without reducing its sensitivity.

To test specificity, the authors developed N501Y chimeric crRNA 24-nt sequence and compared it with crRNA 20-nt to test N501Y variant and wild type of the virus. In addition, to determine whether the sensitivity of N501Y chimeric crRNA 24-nt is significant for N501Y detection, the limit of detection (LoD) was evaluated and compared to N501Y crRNA 20-nt using the tenfold serial dilution of synthetic RNA containing gene fragments of SARS-CoV-2.

The study provided valuable data on this chimeric crRNA. However, there are some comments on the study.

1.In the background section, the authors should explain how application of chimeric crRNA on N501Y detection is significant. And, the authors should further describe how to identify the variants of Alpha, Beta, Gamma, and Mu.

Response: Many thanks for your comments. As we are the first to use chimeric crRNA on detection in order to find a method that can improve the specificity of CRISPR-Cas12a detection, thus, we have added how the application of chimeric crRNA is significant in the discussion section. For your kind information: the sensitivity of chimeric crRNA is comparable to regular crRNA, whereas the specificity is higher and can be stable for more than 2 h. It improves and provides the versatility of applying CRISPR-Cas12a in a larger throughput which will take more time to prepare reactions, even as a point-of-care testing (POCT). Please refer to line 147 of the revised manuscript with track changes

How to identify the variants of Alpha, Beta, Gamma, and Mu has also been added in the discussion. It is worthy to mention that, N501Y mutation is shared by Alpha, Beta, Gamma, and Mu; identification of N501Y is the first step of differentiating variants of Alpha, Beta, Gamma, and Mu from wild type and other variants. To further differentiate Alpha, Beta, Gamma, and Mu, other mutation sites in the Spike protein like 69-70 deletion or 144 deletion, 242-244 deletion or K417N, R190S or K417T, T95I or R346K can be detected respectively. Please refer to line 158 of the revised manuscript with track changes

2. Please describe Statistical analysis in Method.

Response: Thank you very much for your valuable comments. We added the method of statistical analysis in the method section. Please check line 198 of the revised manuscript with track changes

3.In Discussion, the effectiveness and mechanism of chimeric crRNA on N501Y is needed to discuss.

Response: Many thanks for your comments. The effectiveness and mechanism of chimeric crRNA on N501Y have been added in the discussion of the revised manuscript. For your kind information: The sensitivity of chimeric crRNA is comparable to regular crRNA, whereas the specificity is higher and it is stable for more than 2 h. Replacing the last 8-nt of the crRNA with DNA can decrease the binding energy between crRNA and target DNA, leading to less off-target of CRISPR-Cas12a [9]. RNA-guided Cas12a unleashes indiscriminate single-stranded DNase activity when CRISPR-Cas12a recognizes its target [11]. As the detection signal is produced by cleavage of fluorophore-quenched ssDNA fluorescent reporter, improving on-target specificity by chimeric crRNA 24-nt can increase the specificity of CRISPR-Cas12a detection. Please refer to line 147 and line 150 of the revised manuscript with track changes.

4.Lines149: Please describe the SARS-CoV-2 origins in the experiment

Response: We have mentioned the SARS-CoV-2 origins in the revised manuscript (line 165). The above mentioned SARS-CoV-2 gene fragments was collected form BGI (Beijing Genomics Institute, a Chinese genome sequencing company, headquartered in Shenzhen, Guangdong, China).

Yours sincerely,

Margaret Ip

Professor and Chairman,

Department of Microbiology,

The Chinese University of Hong Kong

Email: margaretip@cuhk.edu.hk

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

7 Dec 2021

PONE-D-21-31939R1Chimeric crRNA improves CRISPR–Cas12a specificity in the N501Y mutation detection of Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2PLOS ONE

Dear Dr. Ip,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jan 21 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Yu-Hsuan Tsai

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Minor suggestion: Figure 1C and 1D and the new Figure 2A and 2C look very similar, and my understanding is that they show results from the same experiments but at different time points after reaction incubation. To clarify the difference between Figure 1 and Figure 2 results, I recommend adding the time-point information directly on the figures.

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

8 Dec 2021

Response: Many thanks for your suggestions. Time-point information has been added to Figure 1C and 1D and the new Figure 2A and 2C. Please check the revised Figure 1 and Figure 2. Time-point information has also been added to the legends of Figure 1 and S1 Figure. Please check lines 82 and 267 of the revised manuscript.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

10 Dec 2021

Chimeric crRNA improves CRISPR–Cas12a specificity in the N501Y mutation detection of Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2

PONE-D-21-31939R2

Dear Dr. Ip,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Yu-Hsuan Tsai

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

15 Dec 2021

PONE-D-21-31939R2

Chimeric crRNA improves CRISPR–Cas12a specificity in the N501Y mutation detection of Alpha, Beta, Gamma, and Mu variants of SARS-CoV-2

Dear Dr. Ip:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Yu-Hsuan Tsai

Academic Editor

PLOS ONE