Jie Mei1, ChengYa Zhu1, LiuLiu Pan1, Mian Li2. 1. Department of Obstetrics and Gynecology, The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, China. 2. Department of gynecology, Wenzhou Women and Children Health Guidance Center, Wenzhou, Zhejiang, China.
Abstract
Cervical cancer (CC) ranks as the second most frequent tumor in women, and CC stem cells have been vital in the tumorigenesis of CC. Recently, the metastasis- associated in colon cancer 1 (MACC1) gene was proven to be a promising biomarker of CC. However, the role and mechanism of MACC1 in CC remain undetermined. Expressions of MACC1 were estimated by qRT-PCR, immunohistochemistry, and Western blot assays in cervical cancer tissues and cells. Three siRNAs were generated to knockdown expressions of MACC1 in CC cells. After knockdown of MACC1 or/and Colivelin treatment, cell migration, invasion, apoptosis, and stemness were evaluated through a series of functional experiments including Transwell, flow cytometry, Hoechst staining, and sphere-formation assays. MACC1 was found to express more highly in CC tissues in comparison with corresponding non-tumor tissues at both mRNA and protein levels. Functionally, the knocking- down of MACC1 significantly repressed migration and invasion, and induced apoptosis of CC cells. Also, knockdown of MACC1 was discovered to suppress sphere-formation of CC cells and downregulate OCT4 and Nanog. It was proved that knockdown of MACC1 had a significant blocking effect on the AKT/STAT3 pathway. In addition, we verified that treatment with the STAT3 activator (Colivelin) had significant reversal effects on the malignant behaviors of CC cells and CC stemness. Our study concluded that MACC1 might be a novel regulator of CC by regulating the AKT/STAT3 pathway to change the migration, invasion, apoptosis, and cancer stemness of CC cells.
Cervical cancer (CC) ranks as the second most frequent tumor in women, and CC stem cells have been vital in the tumorigenesis of CC. Recently, the metastasis- associated in colon cancer 1 (MACC1) gene was proven to be a promising biomarker of CC. However, the role and mechanism of MACC1 in CC remain undetermined. Expressions of MACC1 were estimated by qRT-PCR, immunohistochemistry, and Western blot assays in cervical cancer tissues and cells. Three siRNAs were generated to knockdown expressions of MACC1 in CC cells. After knockdown of MACC1 or/and Colivelin treatment, cell migration, invasion, apoptosis, and stemness were evaluated through a series of functional experiments including Transwell, flow cytometry, Hoechst staining, and sphere-formation assays. MACC1 was found to express more highly in CC tissues in comparison with corresponding non-tumor tissues at both mRNA and protein levels. Functionally, the knocking- down of MACC1 significantly repressed migration and invasion, and induced apoptosis of CC cells. Also, knockdown of MACC1 was discovered to suppress sphere-formation of CC cells and downregulate OCT4 and Nanog. It was proved that knockdown of MACC1 had a significant blocking effect on the AKT/STAT3 pathway. In addition, we verified that treatment with the STAT3 activator (Colivelin) had significant reversal effects on the malignant behaviors of CC cells and CC stemness. Our study concluded that MACC1 might be a novel regulator of CC by regulating the AKT/STAT3 pathway to change the migration, invasion, apoptosis, and cancer stemness of CC cells.
Entities:
Keywords:
AKT/STAT3 pathway; Cervical cancer; metastasis- associated in colon cancer 1; stemness
Cervical cancer (CC) is the second most gynecological malignancy worldwide and causes over 0.2 million deaths every year [1]. Epidemiological investigation showed that over eighty percentage of new CC cases occur in developing countries and the mortality is reported to be ten times higher compared with that in the developed world [2]. CC is one of the major public health concerns and is a heavy burden on the social medical system [3]. Despite that numerous drugs have been developed against CC, the recurrence of cervical cancer is still disturbing problem for clinical doctors [4].It is well-known that the recurrence and metastasis of cervical cancer is partially due to cancer stem cells [5]. Cancer stem cells (CSCs), as a sub population of tumor cells, possess various unique properties, such as self-renewal ability, chemo-resistance, and multi-differentiation potential [6]. Increasing evidences have shown that CSCs are closely linked to CC prognosis and are responsible for CC recurrence, metastasis, and anti-CC treatments [7]. Fortunately, targeting networks of CSCs provide opportunities to obliterate CSCs, and ultimately improving the prognosis of CC [8]. Thus, developing novel drugs targeting specific targets involved in the CSCs signaling pathway is a promising approach to develop anti-CC therapies.MACC1 (metastasis-associated in colon cancer 1) was demonstrated to expresses differently in human colorectal cancer tissues in a genome-wide search [9]. Evidence revealed that MACC1 can activate the HGF/MET signaling axis and enhance colorectal cancer cell metastasis and recurrence [10]. Gain- and loss-of-functions performed in vitro revealed that MACC1 acts as an oncogene in multiple human tumors, such as colorectal cancer [11,12], breast cancer [13], gastric cancer [14], and ovarian cancer [15]. Recently, MACC1 was also reported to be a promising marker for CC diagnosis [16,17]. However, its potential roles and specific mechanisms in CC remain unclear. Also, MACC1 has been reported to facilitate CSCs-like properties of colorectal cancer cells through the (phosphoinositide 3-kinase/protein kinase B) PI3K/AKT pathway [18], suggesting that MACC1 may be one of the most important components of CSCs networks in colon cancer. Nevertheless, whether MACC1 affects the properties of CSCs in CC is still undetermined.In order to investigate the functions of MACC1 in CC, in the current study, we hypothesized that MACC1 expression promoted CC stemness-like property by promoting cell malignant activity by activating PI3K/AKT pathway. We measured expression of MACC1 in CC and explored its role on migration, invasion, apoptosis, as well as stemness in CC cells was investigated. Moreover, the possible regulatory pathway of MACC1 was further explored in CC, and we suggest that the PI3K/AKT pathway might be required for MACC1 in the progression of CC. Therefore, we speculated that MACC1 might be a potential oncogene in CC.
Materials and methods
CC tissues
A total of 40 pairs of cervical cancer and matched para-carcinoma tissues were collected from CC patients who were diagnosed at the Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University between 2018 and 2019. Written informed consents were obtained from each subject involved in this study. Tissues were stored at −80°C until further use. Ethical approval of this study was given by the Ethics committee of the Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University.
Cell lines
A human cervical squamous cell line, Ect1 and CC cell lines (Hela, Siha, Caski, C-33A, HCC94, and MS7501) were supplied by the Shanghai Cell Biology Institute (Shanghai, China). Cells were cultured in DMEM (Gibco-BRL, USA) including FBS (10%, Sigma, USA), penicillin (100 U/ml, Sigma), and streptomycin (100 μg/ml, Sigma) at 37°C under 5% CO2.
Quantitative real-time PCR (qRT-PCR)
First, total RNAs of clinical tissues obtained from CC patients were isolated using TRIzol (Thermo Fisher Scientific, USA), and their quality was examined by denaturing agarose gel stained with ethidium bromide. cDNA was synthesized by using the PrimerScript one-step RT-PCR kit (Takara, Dalian, China). Then real time PCR assay was performed using the SYBR-Green PCR kit (Takara, Japan) on the ABI7500 Fast Real-Time PCR System (PE Applied Biosystems). Relative expressions of MACC1, OCT4, and Nanog were calculated using the 2−ΔΔCt method [19]. The primer sequences used in this study are listed in Table 1.
Table 1.
Primers used for real-time quantitative PCR assay
Gene
Sequence (5ʹ-3ʹ)
GAPDH
Forward: TGTTCGTCATGGGTGTGAAC
Reverse: ATGGCATGGACTGTGGTCAT
Oct-4
Forward: GGGAGATTGATAACTGGTGTGTT
Reverse: GTGTATATCCCAGGGTGATCCTC
Nanog
Forward: CCCCAGCCTTTACTCTTCCTA
Reverse: CCAGGTTGAATTGTTCCAGGTC
MACC1
Forward: CGCTCCTGCCTTGATTTGAA
Reverse: GTTAAGCATGTGTGGCGGAT
Primers used for real-time quantitative PCR assay
Western blot
Western blot assay was performed as Lin W describe [20]. CC tissues or cell lines were collected and lysed in RIPA buffer in a cocktail of protease and phosphatase repressor (Beyotime Biotechnology, China). The concentration of protein samples was measured by a total protein detection Kit (Thermo Fisher Scientific). Approximately 50 μg of proteins were injected into the well followed by a gel electrophoresis in 10% SDS-PAGE and then transferred onto polyvinylidene fluoride membranes (PVDF, Milipore, USA). After incubating in 5% nonfat milk (Santa Cruz Biotechnology, sc-2324, USA) for 2 h, the membranes were incubated with primary antibodies at 4°C for 10 h. Next, the PVDF file was incubated with the HRP-labeled secondary antibodies at room temperature for 2 h. Signals were detected by the BeyoECL Plus kit, and band intensities were analyzed using Image J software (National Institutes of Health, NIH, USA). The primary antibodies used were as follow: MACC1 (rabbit, 1:1000, ab226803, Abcam, USA), OCT4 (rabbit, 1:10000, ab200834, Abcam), Nanog (rabbit, 1:5000, ab109250, Abcam), AKT (rabbit, 1:500, ab8805, Abcam), STAT3 (rabbit, 1:2000, ab68153, Abcam), p-AKT (rabbit, 1:1000, ab38449, Abcam), p-STAT3 (rabbit, 1:5000, ab76315, Abcam), caspase3 (rabbit, 1:500, ab13847, Abcam), Bax (rabbit, 1:2000, ab32503, Abcam), and GAPDH (rabbit, 1:5000, ab8245, Abcam).
Cell transfection
Three siRNAs target MACC1 (siRNA #1, siRNA #2, and siRNA #3) and non-target (NT) control siRNA were designed and generated by GenePharma Co. Ltd (Shanghai, China). The siRNAs were transfected into CC cells using lipofectamine 3000 reagent (Thermo Fisher Scientific).
Transwell assay
Briefly, cell migration and invasion of cells were assessed by Transwell chambers (Corning, USA). Briefly, cells (1 × 104 cells in 500 μL serum-free medium) in each group were added into the upper chamber, and culture medium (10% FBS) was placed in the lower one. Afterward, cells on the upper surface of the membrane were removed, while invaded or migrated cells on the lower surface of the chamber were fixed with 4% paraformaldehyde and dyed with 0.1% crystal violet (Sigma). Cells on the lower surface of the chamber were observed under a microscope (Olympus, Japan), and the number of invading cells was manually counted in six random fields. Transwell assay was performed as Wu describe [21].
Flow cytometry analysis
CC cell apoptosis was measured by using the Annexin V-FITC/PI Apoptosis Detection Kit (BD Biosciences) under the instructions of the manufacturer, followed by flow cytometry analysis (Thermo Fisher Scientific). This experiment was performed as Li describe [22].
Hoechst staining
CC cells were collected and fixed in 4% paraformaldehyde (Sigma) for 2 h at 4°C, followed by incubation with 0.2% Triton-X 100 for permeabilization. Then, cells were stained with Hoechst 33342 (Sigma-Aldrich) for 30 min followed by staining with DAPI dye. The nuclear morphology was observed under a laser scanning confocal microscope [23].
Spheroid colony formation assay
Approximate 100 cells of each group were seeded in ultra-low-attachment plates. Cells were cultured in serum-free medium with B27 (2%), N2 (1%), EGF (10 ng/mL), and bFGF (20 ng/mL). After two weeks of culture, the diameter of spheres in each group was recorded and observed under a microscope [24].
Statistical analysis
Data in this study were in the form of mean ± standard deviation (SD) using Graphpad Prism (Version 7.0, USA). Data analysis between groups was analyzed using the Student’s t test. One-way ANOVA was used between three or more groups. P < 0.05 was considered statistically significant.
Results
In this study, we investigated the role of MACC1 in cervical cancer on malignant biological behavior of tumor cells. Firstly, we measured and analyzed the expression of MACC1 in CC tissues and para-carcinoma tissues. Subsequently, MACC1 was knock-down in cancer cell lines, C-33A and Caski. Cell migration, invasion and apoptosis, stemness-like property was measured afterward. Finally, a STAT3 agonist was used to rescue MACC1 siRNA in C-33A and Caski, and cell migration, invasion and apoptosis, stemness-like property were measured. This study showed that MACC1 was an oncogene in CC and can promoted progress of CC by activating AKT pathway, and suggested that MACC1/STAT3 might be potential targets in treating CC.
MACC1 was upregulated in CC
By analyzing MACC1 expressions in 40 pairs of CC and para-carcinoma tissues, we found that expressions of MACC1 in CC tissues were significantly higher than that in para-carcinoma tissues (Figure 1(a)). IHC results from the Human Protein Atlas indicated that the MACC1 protein was upregulated in the CC tissues with respect to that in the non-tumor tissues (Figure 1(b)). Moreover, Western blotting results also proved the MACC1 was up-regulated in CC tissues (Figure 1(c,d)). Thus, these results verified the high expression of MACC1 in CC tissues.
Figure 1.
MACC1 was prominently upregulated in CC tissues. (a) The mRNA level of MACC1 in CC and para-carcinoma tissues was verified by qRT-PCR. (b) Immunohistochemical analysis of MACC1 in CC and corresponding non-tumor tissues through the Human Protein Atlas. (c and d) Western blot analysis of MACC1 protein expression in CC and para-carcinoma tissues, and the relative expressions of MACC1 were quantitatively analyzed in accordance with the gray values in each group
MACC1 was prominently upregulated in CC tissues. (a) The mRNA level of MACC1 in CC and para-carcinoma tissues was verified by qRT-PCR. (b) Immunohistochemical analysis of MACC1 in CC and corresponding non-tumor tissues through the Human Protein Atlas. (c and d) Western blot analysis of MACC1 protein expression in CC and para-carcinoma tissues, and the relative expressions of MACC1 were quantitatively analyzed in accordance with the gray values in each group
Knockdown of MACC1 inhibited CC cell migration and invasion, and induced CC cell apoptosis
Next, we examined MACC1 protein expressions in CC cell lines (Hela, Siha, Caski, C-33A, HCC94, and MS7501) by Western blot. Compared to the normal cervical cell line (Ect1), the protein level of MACC1 was significantly increased in the CC cell lines, among which, Caski and C-33A exhibited the highest expression levels (Figure 2(a)). To investigate the function of MACC1 in CC tumorigenesis, we established MACC1 knock-down CC cell lines by transfecting siRNA of MACC1. Since expression of MACC1 is highest in Caski and C-33A, these two cells were selected for MACC1 loss-of-function assays. Three MACC1 siRNAs (siRNA #1, siRNA #2, and siRNA #3) were generated to knockdown expressions of MACC1 in Caski and C-33A cells, and the results of Western blot assay showed that MACC1 siRNA #2 exhibited the greatest knockdown effect (Figure 2(b)). siRNA #2 was used in the following experiments. In comparison with blank and non-target (NT) groups, the invasiveness and migration capability of Caski and C-33A cells in the MACC1 knockdown group were obviously suppressed (Figure 2(c,d)). By using flow cytometry analysis, we found that MACC1 knockdown significantly increased the apoptotic rate of Caski and C-33A cells (Figure 2(e)). Western blot analysis showed that the protein levels of apoptosis-related proteins (caspase3 and Bax) were sharply increased in MACC1-knockdown Caski and C-33A cells compared to control and NT groups (Figure 2(f)). Additionally, knockdown of MACC1 in Caski and C-33A cells led to an increase in the percentage of Hoechst-positive cells (Figure 2(g)). These findings suggested that MACC1 might be an oncogene in CC in vitro.
Figure 2.
Knockdown of MACC1 dramatically suppressed CC cell migration and invasion, and promoted CC cell apoptosis. (a) MACC1 protein expression in CC cell lines (Hela, Siha, Caski, C-33A, HCC94, and MS7501) was estimated by Western blot, The Ect1 cell line was used as the control group. (b) After 24 h of MACC1 siRNAs (siRNA #1, siRNA #2, and siRNA #3) transfection, Caski and C-33A cells had MACC1 expression detected by Western blot. The Transwell assay was used to assess the effects of MACC1 knockdown on (c) the migratory and (d) invasive abilities of Caski and C-33A cells. (e) Flow cytometry analysis was used to examine the apoptotic rate of Caski and C-33A cells after MACC1 knockdown. (f) Apoptosis-related proteins (caspase3 and Bax) were measured by Western blot in MACC1-knocked-down Caski and C-33A cells. (g) Hoechst staining was conducted to monitor the change in apoptosis of MACC1-knockdown Caski and C-33A cells
Knockdown of MACC1 dramatically suppressed CC cell migration and invasion, and promoted CC cell apoptosis. (a) MACC1 protein expression in CC cell lines (Hela, Siha, Caski, C-33A, HCC94, and MS7501) was estimated by Western blot, The Ect1 cell line was used as the control group. (b) After 24 h of MACC1 siRNAs (siRNA #1, siRNA #2, and siRNA #3) transfection, Caski and C-33A cells had MACC1 expression detected by Western blot. The Transwell assay was used to assess the effects of MACC1 knockdown on (c) the migratory and (d) invasive abilities of Caski and C-33A cells. (e) Flow cytometry analysis was used to examine the apoptotic rate of Caski and C-33A cells after MACC1 knockdown. (f) Apoptosis-related proteins (caspase3 and Bax) were measured by Western blot in MACC1-knocked-down Caski and C-33A cells. (g) Hoechst staining was conducted to monitor the change in apoptosis of MACC1-knockdown Caski and C-33A cells
Knockdown of MACC1 suppressed the stemness of CC cells
Since CSCs have been reported to be closely linked with the aggressive behaviors of cancer cells, such as invasion, migration and proliferation, we further examined the effects of MACC1 knockdown on the stemness of CC cells by measuring the sphere-formation capacity and expression changes of stemness markers (OCT4 and Nango) in C-33A and Caski cells. Results from the sphere-formation assay indicated that knockdown of MACC1 caused a significant reduction in the sphere diameter and a decrease in the number of CC spheres (Figure 3(a)). Moreover, knockdown of MACC1 was found to markedly decrease the protein and mRNA levels of OCT4 and Nango in both C-33A and Caski cells (Figure 3(b,c)). In addition, our data showed that MACC1 knockdown led to a significant reduction of expressions of p-AKT and p-STAT3 in C-33A and Caski cells (Figure 3(d)), implying that the AKT/STAT3 pathway was repressed by MACC1 knockdown in CC. Therefore, these results indicated MACC1 knockdown might repress the stemness of CC cells by inhibiting the AKT/STAT3 pathway.
Figure 3.
Knockdown of MACC1 markedly inhibited the stemness of CC cells. (a) Representative images showing the spheroid formation ability of Caski and C-33A cells after transfection with non-target siRNA (NT) or MACC1 siRNAs. (b) Western blot and (c) qRT-PCR were used to assess protein and mRNA expression levels of stemness markers (OCT4 and Nanog) in MACC1-knockdown Caski and C-33A cells. (d) After MACC1 knockdown by siRNAs, protein expression levels of p-AKT and p-STAT3 were confirmed by Western blot in Caski and C-33A cells
Knockdown of MACC1 markedly inhibited the stemness of CC cells. (a) Representative images showing the spheroid formation ability of Caski and C-33A cells after transfection with non-target siRNA (NT) or MACC1 siRNAs. (b) Western blot and (c) qRT-PCR were used to assess protein and mRNA expression levels of stemness markers (OCT4 and Nanog) in MACC1-knockdown Caski and C-33A cells. (d) After MACC1 knockdown by siRNAs, protein expression levels of p-AKT and p-STAT3 were confirmed by Western blot in Caski and C-33A cells
Colivelin treatment eliminated the inhibitory effects of MACC1 knockdown on CC malignant activity
Since the AKT/STAT3 pathway was inhibited by MACC1 knockout in CC, we continued to examine if the inhibitory effects of MACC1 was mediated by the AKT/STAT3 pathway. By treating C-33A and Caski cells with the STAT3 activator (Colivelin), it was found that the repression of invasiveness and migration capability of C-33A and Caski cells induced by MACC1 knockdown were reversed (Figure 4(a,b)). Moreover, the promotive effects of MACC1 knockdown on the apoptosis of C-33A and Caski cells were partially reversed by the treatment of Colivelin (Figure 4(c)). The upregulation of apoptosis-related proteins (caspase3 and Bax) induced by MACC1 knockdown was abrogated by the treatment of Colivelin (Figure 4(d)). Furthermore, the increase of Hoechst-positive cells found in MACC1-knockdown C-33A and Caski cells were reversed by the treatment of Colivelin (Figure 4(e)). Thus, the repressive effects of MACC1 knockdown on CC might be mediated by the AKT/STAT3 pathway.
Figure 4.
Colivelin abolished the inhibitory effects of MACC1 knockdown on CC malignant activity. (a and b) The Transwell assay was used to evaluate the migratory and invasive capacities of MACC1-knockdown Caski and C-33A cells treated with Colivelin. (c) After treatment with Colivelin, Caski and C-33A cells were studied for apoptosis using flow cytometry. (d) Apoptosis-related proteins (caspase3 and Bax) were detected by Western blot in MACC1-knockdown Caski and C-33A cells treated with Colivelin. (e) Hoechst staining was used to detect the apoptosis of MACC1-knockdown Caski and C-33A cells treated with Colivelin
Colivelin abolished the inhibitory effects of MACC1 knockdown on CC malignant activity. (a and b) The Transwell assay was used to evaluate the migratory and invasive capacities of MACC1-knockdown Caski and C-33A cells treated with Colivelin. (c) After treatment with Colivelin, Caski and C-33A cells were studied for apoptosis using flow cytometry. (d) Apoptosis-related proteins (caspase3 and Bax) were detected by Western blot in MACC1-knockdown Caski and C-33A cells treated with Colivelin. (e) Hoechst staining was used to detect the apoptosis of MACC1-knockdown Caski and C-33A cells treated with Colivelin
Colivelin treatment eliminated the inhibitory effects of MACC1 knockdown on CC stemness
The suppressed ability of sphere-formation found in MACC1-knockdown C-33A and Caski cells was restored by the treatment of Colivelin (Figure 5(a)). The downregulation of protein and mRNA expressions of OCT4 and Nango in both C-33A and Caski cells induced by MACC1 knockdown were abolished by the treatment of Colivelin (Figure 5(b,c)). Additionally, it was found that Colivelin treatment reversed the downregulation of protein expressions of p-AKT and p-STAT3 of C-33A and Caski cells induced by MACC1 knockdown (Figure 5(d)). Therefore, the repressive effects of MACC1 knockdown on CC stemness might be mediated by the AKT/STAT3 pathway.
Figure 5.
Colivelin could reverse the inhibition of MACC1 knockdown on stemness in CC cells. (a) Representative images showing the influence of MACC1 knockdown or/and Colivelin exposure on the spheroid formation abilities of Caski and C-33A cells. (b-c) MACC1-knockdown Caski and C-33A cells were treated with Colivelin. Then Western blot (b) and qRT-PCR (c) were used to assess protein and mRNA expression levels of stemness markers (OCT4 and Nanog) (d) Protein expression levels of p-AKT and p-STAT3 were identified through Western blotting analysis in Caski and C-33A cells that were co-treated with MACC1 siRNAs and Colivelin
Colivelin could reverse the inhibition of MACC1 knockdown on stemness in CC cells. (a) Representative images showing the influence of MACC1 knockdown or/and Colivelin exposure on the spheroid formation abilities of Caski and C-33A cells. (b-c) MACC1-knockdown Caski and C-33A cells were treated with Colivelin. Then Western blot (b) and qRT-PCR (c) were used to assess protein and mRNA expression levels of stemness markers (OCT4 and Nanog) (d) Protein expression levels of p-AKT and p-STAT3 were identified through Western blotting analysis in Caski and C-33A cells that were co-treated with MACC1 siRNAs and Colivelin
Discussion
In this study, it was found that the MACC1 expression level was increased in CC tissues and cells. Loss-of-function of MACC1 could repress CC cell invasion, migration, and stemness, and promote CC cell apoptosis. Additionally, the results of this study indicated that the PI3K/AKT pathway was associated with the modulatory effects of MACC1 on CC stemness. Although previous studies found that MACC1 is involved in the invasion, migration, apoptosis, and proliferation of CC [17,25,26], this study is the first to discover that MACC1 facilitates CSCs-like properties in CC through the PI3K/AKT signaling pathway.MACC1, a critical modulator of the HGF/MET signaling pathway, was revealed to predict colon cancer metastasis [9]. It was previously found to be highly expressed in numerous human tumors, such as glioma, breast cancer, and CC [25,27,28]. Evidence has shown that high presentation of MACC1 is closely associated with the FIGO stages, metastasis, and recurrence of CC [29]. Because of the high expression of MACC1 in CC, numerous studies investigated its potential in acting as a biomarker of CC. Recently, a multivariate analysis demonstrated that MACC1 might be an independent prognostic biomarker in CC [16]. Additionally, numerous functional assays also showed that MACC1 plays a key role in oncogenic activity in CC tumorigenesis, and modulates a series of aggressive behaviors, such as invasion, migration and proliferation [30,31]. Consistent with these studies, the current study shows that MACC1 is highly expressed in CC, and knockdown of MACC1 represses CC cell migration and invasion, and promotes CC cell apoptosis. These findings suggested that MACC1 might be a promising biomarker of CC diagnosis and a novel therapeutic target for CC.CSCs have been reported to be implicated in the carcinogenesis, metastasis, and recurrence of CC, and therefore, CSCs inhibition may serve as a new therapy for CC [32]. In recent years, multiple drugs have been developed to target cervical CSCs, such as apigenin, morusin, and phenethyl isothiocyanate, by inhibiting their abilities of self-renewal or facilitating their apoptosis [33-35]. Nevertheless, because of the lack of understanding of the molecular mechanisms of CC tumorigenesis, when and how these drugs function is still unclear. Our work targeting MACC1 might contribute to uncovering the molecular mechanisms of CC tumorigenesis. In our study, MACC1 knockdown was revealed to repress the stemness of CC cells in vitro, indicating that MACC1 might be a potential therapeutic target in eliminating cervical CSCs.Stemness is one of the main reasons for chemo-resistance of cancer cells, largely increasing the difficulty of cancer therapy. Also, accumulating studies have shown that the acquisition of chemo-resistance involves the activation of the PI3K/Akt signaling pathway [36]. Moreover, MACC1 depletion was demonstrated to inhibit the PI3K/AKT axis in colon cancer cells [18]. These findings prompted us to investigate the correlation among MACC1, stemness, and the PI3K/Akt signaling pathway. Our results revealed that MACC1 knockdown significantly represses the PI3K/AKT pathway in CC cells, while treatment with the STAT3 activator Colivelin eliminates the inhibitory effects of MACC1 knockdown on CC cell invasion, metastasis and stemness. Overall, these findings indicated that the PI3K/AKT axis might mediate the effects of MACC1 on CC cell metastasis and stemness.
Conclusion
In summary, our results proved that knockdown of MACC1 inhibits CC cell metastasis, invasion, and stemness, and promotes CC cell apoptosis, by reducing the activation of the PI3K/AKT pathway, implying that MACC1 may be a promising therapeutic target of CC. However, in vivo experiments are still needed to further confirm this conclusion.
Authors: Juan Angel Fresno Vara; Enrique Casado; Javier de Castro; Paloma Cejas; Cristóbal Belda-Iniesta; Manuel González-Barón Journal: Cancer Treat Rev Date: 2004-04 Impact factor: 12.111