Nateelak Kooltheat1,2, Kamonrat Chujit1, Kanjana Nuangnong1, Nuttikarn Nokkaew3, Kingkan Bunluepuech4,2, Kenshi Yamasaki5, Moragot Chatatikun1,2. 1. School of Allied Health Sciences, 65133Walailak University, Nakhon Si Thammarat, Thailand. 2. Research Excellence Center for Innovation and Health Products,65133Walailak University, Nakhon Si Thammarat, Thailand. 3. School of Pharmacy, 65133Walailak University, Nakhon Si Thammarat, Thailand. 4. School of Medicine, 65133Walailak University, Nakhon Si Thammarat, Thailand. 5. 38047Graduate School of Medicine, Tohoku University, Sendai, Miyagi, Japan.
Abstract
Artemisia lactiflora, a Chinese-origin plant, has been reported to have unique phytochemicals responsible for its medicinal properties. The growth of the agricultural industry emits air pollution, which has adverse effects on health. There are limited scientific reports on the biological activities of A. lactiflora. Studies on its activities and mechanisms may provide insight into its use in medicinal purposes to treat those health problems and conditions. In this study, leaves of A. lactiflora were extracted and fractioned with solvents of different polarities. Total phenolics, total flavonoids DPPH• scavenging, ABTS•+ scavenging, and cytotoxicity of A. lactiflora were assessed. Anti-inflammatory activities were evaluated by pre-treating macrophages with extract or fractions then induced inflammatory response by coconut shell pyrolysis smoke. Inflammatory responses were assessed by measuring pro-inflammatory genes expression and pro-inflammatory cytokines secretion. Among all extract and fractions of A. lactiflora, butanol fraction has the highest phenolic, flavonoid, and DPPH• scavenging activity. All extract and fractions significantly down-regulated pro-inflammatory genes expression (RelA, TNF, IL6) and decreased pro-inflammatory cytokines secretion (TNF-α, IL-6), p < 0.0001, compared with pyrolysis smoke-induced macrophages. The ethyl acetate fraction showed the highest anti-inflammatory activity in decreasing pro-inflammatory cytokines secretion. These results may prove the anti-inflammatory activities of A. lactiflora through the inhibition of the NF-κB-dependent pathway. Taken together, this study first reported the anti-inflammatory activities of A. lactiflora. Thus, the plant can be used to prevent and treat inflammatory responses caused by highly oxidative pyrolysis smoke released from the re-utilization of agro-industrial leftovers.
Artemisia lactiflora, a Chinese-origin plant, has been reported to have unique phytochemicals responsible for its medicinal properties. The growth of the agricultural industry emits air pollution, which has adverse effects on health. There are limited scientific reports on the biological activities of A. lactiflora. Studies on its activities and mechanisms may provide insight into its use in medicinal purposes to treat those health problems and conditions. In this study, leaves of A. lactiflora were extracted and fractioned with solvents of different polarities. Total phenolics, total flavonoids DPPH• scavenging, ABTS•+ scavenging, and cytotoxicity of A. lactiflora were assessed. Anti-inflammatory activities were evaluated by pre-treating macrophages with extract or fractions then induced inflammatory response by coconut shell pyrolysis smoke. Inflammatory responses were assessed by measuring pro-inflammatory genes expression and pro-inflammatory cytokines secretion. Among all extract and fractions of A. lactiflora, butanol fraction has the highest phenolic, flavonoid, and DPPH• scavenging activity. All extract and fractions significantly down-regulated pro-inflammatory genes expression (RelA, TNF, IL6) and decreased pro-inflammatory cytokines secretion (TNF-α, IL-6), p < 0.0001, compared with pyrolysis smoke-induced macrophages. The ethyl acetate fraction showed the highest anti-inflammatory activity in decreasing pro-inflammatory cytokines secretion. These results may prove the anti-inflammatory activities of A. lactiflora through the inhibition of the NF-κB-dependent pathway. Taken together, this study first reported the anti-inflammatory activities of A. lactiflora. Thus, the plant can be used to prevent and treat inflammatory responses caused by highly oxidative pyrolysis smoke released from the re-utilization of agro-industrial leftovers.
Medicinal plants have been used as new trends for complementary and alternative
medicine. Phytochemicals found in plants have shown various biological activities
including antioxidant, anti-inflammation, anti-diabetic, and anti-cancer properties.
Artemisia lactiflora, a Chinese-origin medicinal plant, has
been reported to have unique phytochemicals including balanophonin, aurantiamide,
and isovitexin.
Its medicinal relatives A. annua, A. argyi,
and A. vulgaris, which have anti-malarial,
anti-gastric ulcer,
and anti- gynecological diseases.
A. lactiflora may have decent medicinal activities and might be
benefit for patient with those undesirable diseases and conditions.Production of coconut shell charcoal, as the re-utilization of agro-industrial
leftovers, releases toxic gasses such as carbon monoxide, nitric oxide, and
aldehydes, which become air pollution. The pollution is the main problem found
mostly in the agricultural area, especially in developing countries, where effective
pollution management is not available. Inhalation of those toxic gasses may damage
cells, induce inflammatory responses, increase respiratory tract
infections,[5,6]
promote the development of serious diseases, and cause long-term health problems.There are limited previous reports associated with A. lactiflora
activities. Most of the available data consists of non-scientific, unclear
information. The aims of this study were to fractionate A.
lactiflora leaves for testing of phytochemical composition and
antioxidant activities. Then we investigated anti-inflammatory activities of
A. lactiflora extract and fractions on human coconut shell
pyrolysis smoke-stimulated human macrophages. These findings may provide insight
into its safety use as a food ingredient or precisely use in medicinal purposes.
Methods
Preparation of Plant Materials
Fresh leaves of Artemisia lactiflora Wall. ex DC. (White
Mugwort) were collected from cultivation garden in Phop Phra, Tak, Thailand.
Voucher samples were deposited at Botanical Garden, Walailak University, Nakhon
Si Thammarat, Thailand, assigned herbarium numbers: 01545–01548.
Extraction and Fractionation of A. lactiflora Leaves
A. lactiflora leaves were washed with deionized water, absorbed
with paper towels, weighed, and extracted by homogenization-maceration. The
leaves of 1.4 kg were homogenized and macerated with seven liters of 1% acetic
acid in 50% methanol at 4 °C, for 7 days with agitation. The extract was
filtered through 0.22 µM polyethersulfone membrane and concentrated at 40 °C.
The extract was dissolved with 500 mL of deionized water and fractionated by
liquid-liquid partitioning using solvents of different polarity (RCI Labscan
Ltd, Bangkok, Thailand). The aqueous crude extract was first fractionated three
times with equal volume of diethyl ether to obtain non-polar molecules. Sodium
bicarbonate was added to the partitioned aqueous extract to reach pH of 8.5, to
convert phenolic acid to soluble phenolic sodium salts. The alkaline aqueous
extract was then fractionated three times with chloroform to separate
non-phenolic molecules. The pH of the aqueous was adjusted to 3.5, to convert
phenolic sodium salts back to phenolic acid. The acidic aqueous extract was
partitioned three times with ethyl acetate to fractionate phenolic acid
molecules. Residual phenolics were further fractionated three times with
n-butanol, separated from aqueous residual fraction. Extract and fractions of
A. lactiflora leaves were dried by evaporation, weighted,
stored in airtight tubes, and stored in a desiccator.[7,8]
Determination of Total Phenolic and Flavonoid Contents
Total phenolic content was determined by Folin-Ciocalteu method using 96-well
plate. Reaction contains 100 µL of 1 mg/mL test substance, 100 µL of 10%
Folin-Ciocalteu reagent (Merck KGaA, Darmstadt, Germany), and 100 µL of 0.1 M
sodium carbonate. The reaction was mixed, incubated in the dark at room
temperature for 1 h, and measured for the absorbance at 750 nm using microplate
reader (Eon Microplate Spectrophotometer, BioTek Instruments, Winooski, VT,
USA). Total phenolic of test substances was calculated from the standard curve
of gallic acid as mg gallic acid equivalent/g of dry extract.[9,10]Total flavonoid content was determined by aluminum chloride colorimetric method
using 96-well plate. The reaction mixed 100 µL of 1 mg/mL test substance with
100 µL of 2% aluminum chloride in methanol (Merck KGaA, Darmstadt, Germany),
incubated in the dark at room temperature for 30 min, and measured for the
absorbance at 415 nm using microplate reader. Total flavonoid of test substances
was calculated from the standard curve of quercetin as mg quercetin equivalent/g
of dry extract.[9,10]
Determination of Antioxidant Activities
Antioxidant activities of A. lactiflora extract and fraction
were tested against free radical of 2,2-diphenyl-1-picrylhydrazyl
(DPPH•) and anion radical of
2,2′-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS•+) (Merck
KGaA, Darmstadt, Germany).[9,10]For DPPH assay, 20 µL of each 1 mg/mL test substance was mixed with 180 µL of
0.1 mM DPPH• in methanol, incubated in the dark at room temperature
for 30 min, and measured at the absorbance of 517 nm using microplate
reader.For ABTS assay, the cation was generated by oxidizing 7 mM ABTS with 2.45 mM
potassium persulphate at the ratio of 2:3, incubated in the dark for 16 h, and
diluted with methanol to the absorbance of 0.7 at 734 nm. The activity of test
substance was tested by mixing 20 µL of each 1 mg/mL test substance and 180 µL
of prepared ABTS•+ solution, incubated in the dark at room
temperature for 45 min, and measured at the absorbance of 734 nm using
microplate reader.Percent scavenging activities of each extract against DPPH• and
ABTS•+ were calculated in comparison with the positive control,
ascorbic acid (C6H8O6), using the equation:
Percent scavenging activity = (absorbance of standard ˗ subtracted absorbance of
sample) ÷ absorbance of standard × 100.[9,10]
Collection of Coconut Shell Charcoal Pyrolysis Smoke
Coconut shell pyrolysis smoke deposited on exhaust tubes of the charcoal kiln was
collected from the production plant in Tha Sala, Nakhon Si Thammarat, Thailand.
Pyrolysis smoke aggregates were kept in an airtight container until
experimentation.
Ethical Approval, Biosafety, and Blood Sample Collection
Methods and protocols involving human samples were approved by the Human Research
Ethics Committee of Walailak University, project number: WU-EC-AH-2-129-63.
Processing of biological specimens was approved by the Biosafety Committee of
Walailak University, clearance number: WU-IBC-63-006. Leukocyte-rich blood
component (buffy coat) was obtained from Maharaj Nakhon Si Thammarat Hospital,
Thailand with permission.
Isolation and Differentiation of Human Peripheral Blood Monocytes
Human monocytes were isolated from buffy coat (leukocyte concentrate) by density
gradient centrifugation followed by size sedimentation centrifugation.
Hank's balanced salt solution (HBSS)-diluted buffy coat of 10 mL was
layered on 5 mL of Lymphoprep solution (Alere Technologies AS, Oslo, Norway) in
15 mL centrifuge tube and centrifuged at 3000 rpm for 30 min. Separated layer of
peripheral blood mononuclear cells was collected and suspended with HBSS. Cells
suspension of 5 mL were then layered on 10 mL of 46% Percoll solution (Ge
Healthcare Bio-Sciences AB, Uppsala, Sweden) in RPMI-1640 medium (Thermo Fisher
Scientific, Waltham, MA, USA) and centrifuged at 3000 rpm for 30 min. Isolated
cells were washed with HBSS and suspended in completed RPMI medium containing
10% fetal bovine serum and 1% antibiotic/antimycotic (Thermo Fisher Scientific,
Waltham, MA, USA). Monocytes were differentiated into macrophages by plating
onto cell culture flask and incubated at 37 °C in humidified condition with 5%
carbon dioxide for 7 days.
Determination of Cellular Cytotoxicity
Cytotoxicity of A. lactiflora extract, fractions, and pyrolysis
smoke was determined by neutral red uptake cytotoxicity bioassay.[7,11] Each test
substance was dissolved in dimethyl sulfoxide (DMSO) and diluted with
completed-RPMI medium to 0–10000 µg/mL geometrically sequential concentrations.
Human macrophages were plated onto a 96-well plate at the density of
5 × 104 cells/well, rested for 48 h, and washed once with HBSS.
Cells were then treated with 50 µL of the sequentially diluted test substance
for 24 h, washed with HBSS, and stained with 50 µL of 50 µg/mL neutral red dye
in RPMI for 2 h. Cells were washed and dissolved with 50 µL of acid-alcohol
solution. Absorbance at 545 nm of each condition was measured using microplate
reader.Percentage of cell viability of test substance-treated cells was calculated by
comparing with untreated control condition. Data were plotted and analyzed by
dose-response curve fitting to calculate median lethal concentration
(LC50) and 5% lethal concentration (LC5) of the test
substance.
Investigation of Anti-Inflammatory Activities
Human macrophages were plated onto 24-well plate at the density of
5 × 105 cells/well, rested for 48 h, and washed once with HBSS.
Test substances were dissolved in DMSO and diluted with completed RPMI medium.
Cells were pre-treated with 500 µL of LC5 concentration of A.
lactiflora extract or fractions for 6 hours, washed once with HBSS,
and stimulated with 500 µL of LC5 concentration of pyrolysis smoke.
Lipopolysaccharide (LPS) (Merck KGaA, Darmstadt, Germany) at a concentration of
10 ng/mL served as a positive control in stimulating pro-inflammatory response.
Non-steroidal anti-inflammatory drug, 5.42 µg/mL of aspirin (SEA Pharm, Co.,
Ltd, Phra Nakhon Si Ayutthaya, Thailand), and steroidal anti-inflammatory drug,
12.5 ng/mL of prednisolone (Medic Pharma Co., Ltd, Samut Sakhon, Thailand),
served as control drugs for anti-inflammatory activities.Cell culture supernatant was collected to microcentrifuge tube for the
measurement of secreted pro-inflammatory cytokines by ELISA. Treated cells were
processed to RNA extraction for the quantification of pro-inflammatory genes
expression by qRT-PCR.
RNA Extraction and Quantitative Reverse Transcription PCR (qRT-PCR)
For the total RNA extraction, cells in each well of 24-well plate were washed
once with HBSS, lysed with 200 µL of TRIzol reagent (Thermo Fisher Scientific,
Waltham, MA, USA), transferred to 1.5 mL microcentrifuge tube, and incubated at
room temperature for 5 min. Reagent phases were separated by adding 50 µL of
chloroform to the tube, mixed by inverting, incubated for 3 min, and centrifuged
for 15 min at 12000 × g, 4 °C. Aqueous phase containing RNA was transferred to
new tube, then RNA was precipitated by adding 100 µL of isopropanol, mixed for
10 min, and centrifuged for 10 min at 12000 × g, 4 °C. Supernatant was
discarded, RNA pellet was washed with 200 µL of 75% ethanol, mixed by vortexing,
and centrifuged for 5 min at 7500 × g, 4 °C. Supernatant was discarded, ethanol
was allow to evaporate, and RNA was dissolved with RNase-free water (Merck KGaA,
Darmstadt, Germany). RNA concentration was directly quantified using NanoDrop
One Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).For the quantification of mRNA expression, each reaction contains 4 µL of 1 ng/mL
RNA template, 0.8 µL of 10 µM forward primer, 0.8 µL of 10 µM reverse primer
0.2 µL of reverse transcriptase, 0.4 µL of RNase inhibitor, and 10 µL of
SensiFAST SYBR No-ROX One-Step reagent (Bioline Reagents Ltd, London, UK).
One-step qRT-PCR steps were reverse transcription at 45 °C for 10 min,
polymerase activation at 95 °C for 2 min, and 40 cycles of denaturation at 95 °C
for 5 sec with annealing/extension at 60 °C for 20 sec. Forward and reverse
primer for each pro-inflammatory gene was retrieved from PrimerBank database
(Table 1).
Expression of each gene was compared with expression of beta-actin gene
(ACTB) and calculated by normalized gene expression
analysis using 2−ΔΔCt method.
Table 1.
Oligonucleotide Primers Used in This Study.
Gene
Primer
Oligonucleotide Sequence, 5′ to 3′
RelA
Forward
ATGTGGAGATCATTGAGCAGC
Homo sapiens v-rel reticuloendotheliosis viral oncogene
homolog A (avian), mRNA
Reverse
CCTGGTCCTGTGTAGCCATT
TNF
Forward
CCTCTCTCTAATCAGCCCTCTG
Homo sapiens tumor necrosis factor, mRNA
Reverse
GAGGACCTGGGAGTAGATGAG
IL6
Forward
ACTCACCTCTTCAGAACGAATTG
Homo sapiens interleukin 6 (interferon, β2), mRNA
Reverse
CCATCTTTGGAAGGTTCAGGTTG
ACTB
Forward
CATGTACGTTGCTATCCAGGC
Homo sapiens β actin; β cytoskeletal actin, mRNA
Reverse
CTCCTTAATGTCACGCACGAT
Oligonucleotide Primers Used in This Study.
Enzyme-Linked Immunosorbent Assay (ELISA)
Level of pro-inflammatory cytokines, TNF-α and IL-6, secreted from human
macrophages was quantified by ELISA using antibody pairs (ImmunoTools,
Friesoythe, Germany) and reagent kit (GenPack-5, MabTag GmbH, Friesoythe,
Germany). ELISA plate was coated with 100 µL of capture antibody for 24 h at
room temperature and blocked with 300 µL of blocking buffer for 1 h. Cell
culture supernatant of 100 µL was added to ELISA well along with cytokine
standard and incubated at room temperature for 2 h with shaking. Plate was
washed 5 times with phosphate-buffered saline containing 0.05% tween-20 (PBST),
100 µL of biotinylated detection antibody was added and incubated at room
temperature for 2 h with shaking. The plate was washed, 100 µL of
streptavidin-HRP was added and incubated in the dark at room temperature for
30 min with shaking. Plate was washed, 100 µL of TMB substrate was added, and
incubated in the dark at room temperature for 30 min with shaking. The reaction
was stopped by adding 50 µL of stop solution. Absorbance at 450 nm of the
reaction was measured by microplate reader. Cytokine level of each experimental
condition was calculated according to the standard curve of the reference
standard cytokine.
Statistical Analysis and Study Report
This study was performed in a triplicate of three-independent experiments. Data
was collected, analyzed, and plotted by GraphPad Prism (GraphPad Software, San
Diego, CA, USA). Distribution of data was analyzed by Shapiro-Wilk test.
Differences among data sets was analyzed by one-way ANOVA with Bonferroni
multiple comparisons (normal distribution) or Kruskal-Wallis test with Dunn's
multiple comparisons (non-parametric) at a significance level of 0.05. Detailed
statistical analyses are available in the Supplementary File.Experimental data was reported according to the guideline for Reporting
Experiments in Homeopathic Basic Research (REHBaR) as suggested by EQUATOR
Library of Reporting Guidelines.
Results
A. lactiflora Leaves Extract and Fractions
Extraction of 1400 g fresh A. lactiflora leaves yielded 55.63 g
(3.97%) of crude extract. Fractionation of the crude extract yielded 1.58 g
(0.11%) of diethyl ether fraction, 1.08 g (0.08%) of chloroform fraction, 1.03 g
(0.07%) of ethyl acetate fraction, 1.29 g (0.09%) butanol fraction, and 46.93 g
(3.35%) of residual salt fraction.
Total Phenolic and Total Flavonoid Contents of A. lactiflora
Leaves Extract and Fractions
Total phenolic content of A. lactiflora extract and fractions
are shown in Figure 1A.
Crude extract had total phenolics of 8.88 ± 0.72 mg gallic acid equivalent/g of
dry extract. Butanol fraction had the highest total phenolics of 14.77 ± 0.82 mg
gallic acid equivalent/g of dry extract, significantly higher than crude extract
(p < 0.0001). Ethyl acetate fraction also had higher
phenolic contents than crude extract at 13.72 ± 0.99 mg gallic acid equivalent/g
of dry extract (p < 0.0001). There was no significant
difference between total phenolics of butanol and ethyl acetate fractions. Lower
phenolic content was shown in diethyl ether, chloroform, and residual fraction
at 2.49 ± 0.21, 2.98 ± 0.25, and 2.90 ± 0.22 mg gallic acid equivalent/g of dry
extract, respectively, compared with crude extract (p <
0.0001). There was no significant difference among total phenolics of diethyl
ether, chloroform, and residual fractions.
Figure 1.
Total phenolic and total flavonoid contents of A.
lactiflora leaves extract and fractions. (A) Total phenolic
content. (B) Total flavonoid content. Abbreviation: CRUDE, crude
extract; Et2O, diethyl ether fraction; CHLF, chloroform
fraction; EtOAc, ethyl acetate fraction; BtOH, butanol fraction; RES,
residual salt fraction. One-way ANOVA, compared with CRUDE: *,
p < 0.0001; #,
p = 0.0007.
Total phenolic and total flavonoid contents of A.
lactiflora leaves extract and fractions. (A) Total phenolic
content. (B) Total flavonoid content. Abbreviation: CRUDE, crude
extract; Et2O, diethyl ether fraction; CHLF, chloroform
fraction; EtOAc, ethyl acetate fraction; BtOH, butanol fraction; RES,
residual salt fraction. One-way ANOVA, compared with CRUDE: *,
p < 0.0001; #,
p = 0.0007.Total flavonoid content of A. lactiflora extract and fractions
are shown in Figure 1B.
Crude extract had the lowest total flavonoid of 0.53 ± 0.02 mg quercetin
equivalent/g of dry extract. Butanol fraction had the highest total flavonoid of
2.27 ± 0.20 mg quercetin equivalent/g of dry extract, significantly higher than
crude extract (p < 0.0001). Significantly higher total
flavonoid content than crude extract was shown in diethyl ether
(p < 0.0001), residual (p < 0.0001),
chloroform (p < 0.0001), and ethyl acetate fractions
(p = 0.0007) at 1.92 ± 0.17, 1.4 ± 0.14, 1.22 ± 0.09, and
0.97 ± 0.10 mg quercetin equivalent/g of dry extract, respectively. There was no
significant difference in total flavonoid content when comparing chloroform with
ethyl acetate fractions and chloroform with residual fractions.
Antioxidant Activity of A. lactiflora Leaves Extract and
Fractions
Percentage of DPPH• free radical scavenging activity of A.
lactiflora extract and fractions are shown in Figure 2A. Ascorbic acid had
DPPH• free radical scavenging activity of 96.37 ± 0.72%. Crude
extract had significantly lower DPPH• free radical scavenging
activity than the ascorbic acid at 78.76 ± 6.68% (p <
0.0001). Significantly higher activity was observed in butanol fraction at
84.15 ± 1.48%, p = 0.0053, compared with crude extract.
Significantly lower activity than crude extract was observed in ethyl acetate
(p = 0.0006), residual (p < 0.0001),
diethyl ether (p < 0.0001), and chloroform fractions
(p < 0.0001) at 72.28 ± 3.52%, 25.77 ± 1.95%,
11.80 ± 1.03%, and 6.84 ± 0.64%, respectively. There were significant
differences of DPPH• free radical scavenging activity among all
extract and fractions (p < 0.05).
Figure 2.
Antioxidant activities of A. lactiflora leaves extract
and fractions. (A) DPPH• free radical scavenging activity.
(B) ABTS•+ radical cation scavenging activity. Abbreviation:
C6H8O6, ascorbic acid; CRUDE, crude
extract; Et2O, diethyl ether fraction; CHLF, chloroform
fraction; EtOAc, ethyl acetate fraction; BtOH, butanol fraction; RES,
residual salt fraction. One-way ANOVA, compared with CRUDE: *,
p < 0.0001; #, p
= 0.0007; §, p = 0.0088; †,
p = 0.0106; ‡,
p = 0.0001.
Antioxidant activities of A. lactiflora leaves extract
and fractions. (A) DPPH• free radical scavenging activity.
(B) ABTS•+ radical cation scavenging activity. Abbreviation:
C6H8O6, ascorbic acid; CRUDE, crude
extract; Et2O, diethyl ether fraction; CHLF, chloroform
fraction; EtOAc, ethyl acetate fraction; BtOH, butanol fraction; RES,
residual salt fraction. One-way ANOVA, compared with CRUDE: *,
p < 0.0001; #, p
= 0.0007; §, p = 0.0088; †,
p = 0.0106; ‡,
p = 0.0001.Percentage of ABTS•+ radical cation scavenging activity of A.
lactiflora extract and fractions are shown in Figure 2B. Ascorbic acid had
ABTS•+ free radical scavenging activity of 93.48 ± 0.15%. The
highest ABTS•+ radical cation scavenging activity was found in crude
extract at 96.02 ± 0.83%, significantly higher than ascorbic acid
(p = 0.0106). Fractions of the extract had significantly
lower activity than the crude extract (p ≤ 0.0001). Butanol,
ethyl acetate, chloroform, diethyl ether, and residual fractions had the
scavenging activity of 92.91 ± 0.32%, 92.71 ± 0.25%, 81.88 ± 1.19%,
70.84 ± 2.82%, and 70.36 ± 1.00%, respectively. There was no significant
difference of ABTS•+ radical cation scavenging activity when
comparing diethyl ether with residual fractions and ethyl acetate with butanol
fractions.
Cellular Cytotoxicity of A. lactiflora Leaves Extract,
Fractions, and Pyrolysis Smoke
Median lethal concentration (LC50) of test substances is shown in
Figure 3. Butanol
fraction of A. lactiflora leaves extract had the highest
LC50 of 3899.42 µg/mL while diethyl ether fraction had the lowest
LC50 of 18.58 µg/mL. Crude extract, residual, ethyl acetate, and
chloroform fractions had LC50 of 2747.89, 2133.04, 1415.79, and
96.16 µg/mL, respectively. Coconut shell charcoal pyrolysis smoke had a moderate
LC50 of 2546.83 µg/mL.
Figure 3.
Dose-response curve showing LC5 of test substances. (A) Crude
extract of A. lactiflora leaves. (B) diethyl ether
fraction. (C) chloroform fraction. (D) ethyl acetate fraction. (F)
butanol fraction. (G) coconut shell pyrolysis smoke.
Dose-response curve showing LC5 of test substances. (A) Crude
extract of A. lactiflora leaves. (B) diethyl ether
fraction. (C) chloroform fraction. (D) ethyl acetate fraction. (F)
butanol fraction. (G) coconut shell pyrolysis smoke.Five percent lethal concentration (LC5) of test substances is also
shown in Figure 3.
A. lactiflora crude extract, diethyl ether, chloroform,
ethyl acetate, butanol, aqueous residual fractions, and pyrolysis smoke had
LC5 of 1209.77, 7.24, 25.8, 356.03, 51.67, 1189.68, and
1118.17 µg/mL, respectively. These LC5 was used in the investigation
of the inflammatory response of pyrolysis smoke and anti-inflammatory activities
of A. lactiflora extract and fractions.
Inflammatory Potential of Charcoal Pyrolysis Smoke and Anti-Inflammatory
Activities of A. lactiflora Extract
Inflammatory responses of macrophages were investigated by measuring
pro-inflammatory genes expression (Figure 4) and pro-inflammatory cytokines
secretion (Figure
5).
Figure 4.
Expression of pro-inflammatory genes (A) RelA, (B)
TNF, and (C) IL6. Cells were
stimulated with charcoal pyrolysis smoke to induce pro-inflammatory
response. A. lactiflora extract and fractions were used
to pre-treat cells to investigate anti-inflammatory activities.
Abbreviation: UNTR CTRL, untreated control; LPS, lipopolysaccharide;
PYRO, pyrolysis smoke; CRUDE, crude extract; Et2O, diethyl
ether fraction; CHLF, chloroform fraction; EtOAc, ethyl acetate
fraction; BtOH, butanol fraction; RES, residual salt fraction; ASPR,
aspirin; PRED, prednisolone. One-way ANOVA, compared with PYRO
SMOKE-stimulated cells: *, p < 0.0001; ns,
non-significant.
Figure 5.
Secretion of pro-inflammatory cytokines (A) TNF-α , and (B) IL-6. Cells
were stimulated with charcoal pyrolysis smoke to induce pro-inflammatory
response. A. lactiflora extract and fractions were used
to pre-treat cells to investigate anti-inflammatory activities.
Abbreviation: UNTR CTRL, untreated control; LPS, lipopolysaccharide;
PYRO, pyrolysis smoke; CRUDE, crude extract; Et2O, diethyl
ether fraction; CHLF, chloroform fraction; EtOAc, ethyl acetate
fraction; BtOH, butanol fraction; RES, residual salt fraction; ASPR,
aspirin; PRED, prednisolone. One-way ANOVA, compared with PYRO
SMOKE-stimulated cells: *, p < 0.0001.
Expression of pro-inflammatory genes (A) RelA, (B)
TNF, and (C) IL6. Cells were
stimulated with charcoal pyrolysis smoke to induce pro-inflammatory
response. A. lactiflora extract and fractions were used
to pre-treat cells to investigate anti-inflammatory activities.
Abbreviation: UNTR CTRL, untreated control; LPS, lipopolysaccharide;
PYRO, pyrolysis smoke; CRUDE, crude extract; Et2O, diethyl
ether fraction; CHLF, chloroform fraction; EtOAc, ethyl acetate
fraction; BtOH, butanol fraction; RES, residual salt fraction; ASPR,
aspirin; PRED, prednisolone. One-way ANOVA, compared with PYRO
SMOKE-stimulated cells: *, p < 0.0001; ns,
non-significant.Secretion of pro-inflammatory cytokines (A) TNF-α , and (B) IL-6. Cells
were stimulated with charcoal pyrolysis smoke to induce pro-inflammatory
response. A. lactiflora extract and fractions were used
to pre-treat cells to investigate anti-inflammatory activities.
Abbreviation: UNTR CTRL, untreated control; LPS, lipopolysaccharide;
PYRO, pyrolysis smoke; CRUDE, crude extract; Et2O, diethyl
ether fraction; CHLF, chloroform fraction; EtOAc, ethyl acetate
fraction; BtOH, butanol fraction; RES, residual salt fraction; ASPR,
aspirin; PRED, prednisolone. One-way ANOVA, compared with PYRO
SMOKE-stimulated cells: *, p < 0.0001.The potent inflammatory stimulator, LPS, significantly up-regulated expression of
RelA, TNF, and IL6 to
3.72 ± 0.15, 4.29 ± 0.66, and 4.82 ± 0.47 -fold of untreated control macrophages
(p < 0.0001) (Figure 4). Coconut shell pyrolysis smoke
had comparable activity as LPS in significantly up-regulated expression of
RelA, TNF, and IL6 to
2.91 ± 0.23, 3.81 ± 0.69, and 4.15 ± 0.35 -fold of untreated control macrophage
(p < 0.0001). There was only significantly lower
RelA expression (p < 0.0001) in cells
stimulated between LPS and pyrolysis smoke. A. lactiflora
extract, diethyl ether, chloroform, ethyl acetate, butanol, and residual
fractions significantly down-regulated expression of RelA to
1.41 ± 0.07, 1.28 ± 0.10, 1.49 ± 0.11, 1.32 ± 0.20, 1.46 ± 0.23, and 1.49 ± 0.11
-fold, respectively, p < 0.0001, compared with pyrolysis
smoke-stimulated cells (Figure
4A). The extract and fractions significantly down-regulated
TNF to 1.57 ± 0.18, 1.39 ± 0.15, 1.89 ± 0.22, 1.60 ± 0.19,
1.80 ± 0.15, and 1.42 ± 0.11 -fold, respectively, p < 0.0001
(Figure 4B). The
extract and fractions significantly down-regulated IL6 to
1.92 ± 0.22, 1.67 ± 0.22, 2.54 ± 0.43, 1.87 ± 0.29, 2.12 ± 0.27, and 2.26 ± 0.26
-fold, respectively, p < 0.0001 (Figure 4C). There was no significant
difference in activity among extract and fractions of A.
lactiflora. The lowest down-regulation of RelA,
TNF, and IL6 was observed in cells
pre-treated with diethyl ether fraction, compared with pyrolysis
smoke-stimulated cells. The activity of A. lactiflora extract
and fractions was comparable to the activity of inflammatory drugs, aspirin and
prednisolone, in down-regulation of pro-inflammatory genes. Aspirin
significantly down-regulated expression of RelA,
TNF, and IL6 to 1.18 ± 0.14, 1.67 ± 0.20,
and 1.94 ± 0.30 -fold, respectively, p < 0.0001, compared
with pyrolysis smoke-stimulated cells. Prednisolone significantly down-regulated
expression of RelA, TNF, and
IL6 to 1.14 ± 0.12, 1.45 ± 0.15, and 1.70 ± 0.19 -fold,
respectively, p < 0.0001, compared with pyrolysis
smoke-stimulated cells.Baseline secretion of TNF-α and IL-6 from untreated control macrophages was
264.80 ± 13.60 and 345.10 ± 8.17 ng/mL (Figure 5). LPS significantly increased
secretions of TNF-α and IL-6 to 1127.00 ± 10.70 and 1427.00 ± 8.60 ng/mL,
p < 0.0001, compared with untreated control macrophages.
Pyrolysis smoke significantly increased secretion of TNF-α and IL-6 to
866.20 ± 22.41 and 1102.00 ± 9.64 ng/mL, p < 0.0001,
compared with untreated control macrophages. The inflammatory activity of
pyrolysis smoke was significantly lower than the activity of LPS
(p < 0.0001). A. lactiflora extract,
diethyl ether, chloroform, ethyl acetate, butanol, and residual fractions
significantly decreased secretion of TNF-α to 730.90 ± 18.05, 501.20 ± 18.54,
365.90 ± 21.40, 71.55 ± 2.68, 708.60 ± 15.71, and 696.60 ± 15.42 ng/mL,
respectively, p < 0.0001, compared with pyrolysis
smoke-stimulated cells (Figure
5A). The extract and fractions significantly decreased secretion of
IL-6 to 578.20 ± 14.15, 444.40 ± 11.38, 381.20 ± 13.13, 173.80 ± 4.08,
892.60 ± 15.84, and 942.00 ± 19.55, respectively, p <
0.0001, compared with pyrolysis smoke-stimulated cells (Figure 5B). There were significant
differences in secretion of TNF-α and IL-6 among cells pre-treated with most of
extract and fractions of A. lactiflora (p ≤
0.0003). No significant difference in secretion of TNF-α between cells
pre-treated with crude extract and butanol fraction as well as between crude
extract and residual fraction. The lowest TNF-α and IL-6 secretion was observed
in cells pre-treated with ethyl acetate fraction, compared with pyrolysis
smoke-stimulated cells. The activity of A. lactiflora extract
and fractions was comparable to the activity of inflammatory drugs, aspirin and
prednisolone in decreasing secretion of pro-inflammatory cytokines. Aspirin
significantly decreased secretion of TNF-α and IL-6 to 410.40 ± 19.46 and
479.40 ± 20.07, p < 0.0001, compared with pyrolysis
smoke-stimulated cells. Prednisolone significantly decreased secretion of TNF-α
and IL-6 to 86.55 ± 7.85 and 199.00 ± 7.30, p < 0.0001,
compared with pyrolysis smoke-stimulated cells.
Discussion
Medicinal plants in the genus Artemisia proved to have various
health benefits. The well-known A. annua comprises of the
anti-malarial biomolecule, artemisinin.
The traditional Chinese A. argyi is notable for using as a
remedy for gastric ulcers.
The common A. vulgaris has been used to treat immunological
and gynecological diseases.
However, few studies have reported only phytochemical composition and
anti-cancer of A. lactiflora.[1,16,17] Thus, this study tends to
investigate antioxidant and anti-inflammatory activities of A.
lactiflora on innate immune cells exposed to inflammatory
substances.Extraction and fractionation of A. lactiflora yielded extracts with
different properties as described by the fractionation method.[7,8] The liquid-liquid partitioning
method is well-practiced in many studies for fractionating different polarities of
phytochemicals by solvents.[8,18,19] We obtained crude extract (concentrate), diethyl ether
(non-polar), chloroform (non-phenolic), ethyl acetate (low-polar polyphenolic),
butanol (high polar polyphenolic), and aqueous residual (salts) fractions. Butanol
fraction showed the highest total phenolics, total flavonoids, and DPPH•
free radical scavenging activity (Figure 1–2).
Other fractions showed different levels of phenolics, flavonoids, DPPH•,
and ABTS•+ scavenging activities due to their composition obtained from
the fractionation method. Extraction of Artemisia with aqueous-methanol can obtain
phytochemicals with the highest antioxidant activities among other
aqueous-alcohol-based solvent systems, as demonstrated in a previous study.
Our A. lactiflora crude extract had lower total phenolic and
total flavonoid contents while showing higher radical scavenging activity compared
with the well-known A. annua extract of the previous
studies.[21,22]Cytotoxicity of test substances can be evaluated by various in vitro bioassays. This
study used the neutral red uptake assay, which is more sensitive than tetrazolium
salt or enzymatic-based assays.
Viability of treated cells was calculated for LC50
(IC50) by dose-response curve fitting. Among extract and fractions of
A. lactiflora, diethyl ether fraction, with the lowest polarity
of compounds, had the highest cytotoxicity. In contrast, butanol fraction, with the
highest polarity of compounds, had the lowest cytotoxicity (Figure 3). These results may indicate the
property of different polar compounds in having different activities and
cytotoxicity since the solvents in all extract and fractions were completely
evaporated.[23,24] When comparing IC50 among Artemisia
extracts, our A. lactiflora crude extract, tested on primary human
macrophages, had lower toxicity than crude extracts of A. annua,
A. absinthium,
A. vulgaris,
and A. biennis
tested in leukemic or cancer cell lines. Pyrolysis smoke of plant materials
contains mainly tar and other carbon-based oxidants.
Our coconut shell pyrolysis smoke had moderate cytotoxicity comparable to the
crude extract of A. lactiflora (Figure 3G).Prevention and treatment of respiratory tract diseases caused by exposure to air
pollution, cigarette smoking, and viral infection are currently
interested.[29,30] In vitro model mimicking the inflammatory response of alveolar
macrophages, the crucial immune cells in response to inhalable toxic substances and
viral particles, was selected in this study. We isolated macrophages from blood of
healthy donors and differentiated them into macrophages. The macrophages were then
treated with highly oxidative charcoal pyrolysis smoke, the common air pollution of
agro-industry with toxic gasses and chemicals,[5,6] to simulate those inflammatory
response in the lung. The pyrolysis smoke has been found to significantly induced
inflammatory response of macrophages by upregulating expression of pro-inflammatory
genes including RelA (NF-κB p65), TNF, and
IL6 (p < 0.0001, compared with untreated
control). It correspondingly increased the secretion of pro-inflammatory cytokines:
TNF-α and IL-6 (p < 0.0001, compared with untreated control)
(Figure 4–-5). The inflammatory
activities of the pyrolysis smoke were comparable with the standard oxidative
stress, inflammatory inducer, LPS. These results showed that the pyrolysis
smoke-induced inflammatory response via the activation of the NF-κB-dependent
inflammatory signaling pathway.Pre-treating of macrophages with A. lactiflora extract and fractions
prior to inducing inflammatory response by pyrolysis smoke demonstrated
anti-inflammatory activities. All extract and fractions significantly down-regulated
expression of pro-inflammatory genes (RelA, TNF,
IL6) and decreased secretion of pro-inflammatory cytokines
(TNF-α, IL-6), p < 0.0001, compared with pyrolysis smoke-induced
macrophage (Figure 4–5). Anti-inflammatory
activities of A. lactiflora extract and fractions were correlated
with activities of anti-inflammatory drugs, aspirin and prednisolone. There was no
difference in activities of extract and fractions in expression of pro-inflammatory
genes while variations in secretion of pro-inflammatory cytokines was observed. The
ethyl acetate fraction of A. lactiflora extract exhibited the most
significant pro-inflammatory cytokines secretion as strong as the steroidal
anti-inflammatory drug, prednisolone (Figure 4–5). These results indicated that A.
lactiflora extract and fractions had anti-inflammatory activities as
they contained high polyphenolic contents. The polyphenolic compounds may inhibit
NF-κB activation by inhibiting the activity of a molecule that activates NF-κB
signaling or directly inhibits DNA binding of the NF-κB.
Previous studies on the anti-inflammatory of Artemisia
species were stated. Testing extract of A. annua,
A. fukudo,
and A. montana
on murine RAW 264.7 macrophage cells showed anti-inflammatory activity by
inhibiting LPS-induced nitric oxide and prostaglandin E2 productions. Our
A. lactiflora extract might also have those similar
anti-inflammatory activities.This study only investigated anti-inflammatory activities of A.
lactiflora extract and fractions in vitro using human innate immune
cells model. Separation and study of phytochemicals by chromatography and mass
spectrometry may provide details on its properties and benefit activities.
Additionally, studies on cyclooxygenase and prostaglandin inhibitions as well as
transcription factor translocation may explain molecular mechanisms underlying the
anti-inflammatory activities of the A. lactiflora extract. Using
A. lactiflora as an alternative medicine may help relieve
inflammation, but we recommend consuming fresh leaves as part of food recipes to
avoid toxicity to liver and kidney.
Conclusions
A. lactiflora has high phenolic and flavonoid contents and
antioxidant activities. This study firstly reported anti-inflammatory activities of
A. lactiflora in inhibiting the NF-κB-dependent signaling
pathway, down-regulating expression of pro-inflammatory genes, and decreasing
secretion of pro-inflammatory cytokines. It may be an alternative remedy to prevent
respiratory tract inflammation due to air pollution from charcoal pyrolysis
smoke.