Literature DB >> 34937502

MicroRNA miR-18a-3p promotes osteoporosis and possibly contributes to spinal fracture by inhibiting the glutamate AMPA receptor subunit 1 gene (GRIA1).

Meng Zhao1, Junli Dong2, Yuanmei Liao3, Guoyong Lu4, Wei Pan5, Hansong Zhou6, Xiaohua Zuo7, Ben Shan6.   

Abstract

The promoting role that miR-18a-3p plays in osteoporosis (OP) has been previously described. However, the detailed mechanisms remain unclear. Bone tissues were collected from healthy patients, OP patients, and patients with osteoporotic spinal fractures. An osteogenic differentiation of human bone marrow mesenchymal stem cells (hBMSCs) was constructed to detect the expression of miR-18a-3p and glutamate AMPA receptor subunit 1 (GRIA1). Alkaline phosphatase (ALP) activity and a qRT-PCR analysis were used to detect ALP content, alizarin red S staining was used to detect calcium deposition, and qRT-PCR was used to evaluate runt-related transcription factor 2 (RUNX2), osteocalcin (OCN), and osteopontin (OPN) expression levels. A dual-luciferase reporter and RNA pull-down assay was used to verify the targeted correlation between miR-18a-3p and GRIA1. We observed an increase in miR-18a-3p expression and a decrease in GRIA1 expression in OP and osteoporotic vertebral fracture patients. Upregulation of miR-18a-3p restrained the activity and expression of ALP in hBMSCs, inhibited the expression of RUNX2, OCN, and OPN, and inhibited calcium deposition. Knockdown of miR-18a-3p or upregulation of GRIA1 promoted osteogenic differentiation. Our findings indicate that miR-18a-3p promotes OP progression by regulating GRIA1 expression, suggesting that targeting miR-18a-3p/GRIA1 may be a therapeutic strategy for OP.

Entities:  

Keywords:  GRIA1; miR-18a-3p; osteoporosis; spinal fracture

Mesh:

Substances:

Year:  2022        PMID: 34937502      PMCID: PMC8805820          DOI: 10.1080/21655979.2021.2005743

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

Osteoporosis (OP) is a chronic, systemic disease that mainly affects the elderly and postmenopausal women and has a significant impact on health-related quality of life. The socioeconomic burden of OP increases as the population ages [1]. Osteoporotic vertebral fractures account for almost half of all osteoporotic patients who have increased fragility and fracture susceptibility [2,3]. Currently, a variety of drugs, such as metformin, statins, and fibrates, have been developed to treat OP, but some have side effects [4]. Therefore, it is necessary to elucidate the molecular and cellular factors that play a role in the treatment of OP. Human mesenchymal stem cells (hMSCs) can be stimulated into multiple cell types [5]. Among them, osteoblastic and adipocytic cells in the bone marrow are two major determinants of bone homeostasis [6]. Once this dynamic equilibrium breaks, the subsequent low bone mass induces degenerative bone disorders, including OP [7]. Therefore, the mechanisms underlying hMSC osteoblastic differentiation are of interest to scientists across the globe. Recently, with the progression of high-throughput sequencing techniques, an increasing number of microRNAs (miRNAs), including miR-122-5p, miR-4516, and miR-29b-3p, have been found to be associated with OP [8-10]. For example, miR-181 c-5p and miR-497-5p are promising signatures of progressive clinical situations in OP patients [11]. The in vivo alleviating effects of miR-152 inhibitor on osteoporosis have also been described in an ovariectomized rat model of osteoporosis [12]. MiR-23b-3p is negatively associated with the Wnt/β-catenin signaling pathway to suppress osteogenic differentiation of human bone marrow mesenchymal stem cells (hBMSC), thereby promoting OP progression. MiR-18a-3p is a type of miRNA that has been extensively studied in various disorders, such as cancer, and it mainly regulates tumor cell proliferation and energy production. Previous studies have reported that the dynamic balance between osteogenic bone formation and osteoclast bone resorption regulates the normal bone mass cycle [13]. Currently, convincing evidence has highlighted the involvement of miR-18a-3p in the differentiation of mesenchymal stem cells (MSCs), which are a source of osteogenesis [14]. This suggests that it has a role in bone formation. More importantly, Wang et al. demonstrated that miR-18a-3p overexpression suppresses osteogenic differentiation of hBMSCs and facilitates OP progression [15]. However, the underlying mechanisms are not fully understood. Previous results led us to suspect that miR-18a-3p was a key miRNA in OP. Hence, our study aimed to further explore the function of miR-18a-3p in OP and determine the key genes involved in its underlying mechanism. Our findings suggest a new potential treatment target for OP.

Materials and methods

Chemicals and reagents

L-alanyl-L-glutamine and insulin-like growth factor-1 (IGF-1) were purchased from Thermo Fisher (Waltham, MA, USA); Lipofectamine 2000 reagent was obtained from Invitrogen (Carlsbad, CA, USA); β-glycerophosphate disodium salt, dexamethasone, and l-ascorbic acid were obtained from Sigma-Aldrich (St Louis, MO, USA); and primary antibodies against GRIA1 (ab183797), GAPDH (ab8245), and HRP secondary antibody (ab6747) were obtained from Abcam (Cambridge, MA, USA).

Patients

Patients with fractures that were hospitalized in our hospital were included in this study. The patients used in this study were divided into 40 healthy patients (control), 40 OP patients without osteoporotic thoracolumbar vertebral compression fractures (OP-no-Frt), and 40 patients with osteoporotic thoracolumbar vertebral compression fractures (OP-Frt). The vertebral fractures were assessed using X-rays of the lateral and anterior-posterior positions of the lumbar and thoracic vertebrae. Bone tissue from the fracture site was collected during surgery and stored in liquid nitrogen at – 80°C. The present study was approved by the Ethics Committee of the Affiliated Huai’an Hospital of Xuzhou Medical University (Huai’an, China). The processing of clinical tissue samples was in strict compliance with the ethical standards of the Declaration of Helsinki. Written, informed consent was obtained from all patients, and the clinical characteristics of the study subjects are shown in Table 1.
Table 1.

The characteristics of the clinical samples used in this study

 ControlOsteoporosis patients without spinal fractureOsteoporosis patients with spinal fracture
Included patients (n)404040
Age (years), mean (range)52.4 (18–77)68.3 (46–83)72.6 (57–85)
Sex   
Male, n (%)19 (47.5)13 (32.5)8 (20.0)
Female, n (%)21 (52.5)27 (67.5)32 (80.0)
Body mass index (± SD)22.7 ± 3.0430.5 ± 4.6331. 8 ± 5.79
Main diagnosisHealthy controlOsteoporosis patients without spinal vertebralOsteoporosis patients with spinal vertebral
Bone density (T-score) ± SD0.17 ± 0.73−2.48 ± 0.28−2.69 ± 0.76
The characteristics of the clinical samples used in this study

Osteoblastic differentiation

Human bone marrow mesenchymal stem cells were purchased from the American Tissue Collection Center (ATCC) (Manassas, VA, USA) and cultured in mesenchymal stem cell basal medium containing 2.4 mM L-alanyl-L-glutamine, 125 pg/mL Rh FGF-b, 15 ng/mL rh IGF-1, and 7% FBS. The cells were maintained at 5% CO2 and 95% humidity. To induce osteoblast mineralization, hMSCs were cultured in 6-well culture plates for 3–5 generations and in osteogenic induction solution containing 10 mmol/L β-glycerophosphate disodium salt hydrate, 10 nmol/L dexamethasone, and 50 μg/mL L-ascorbic acid for 2 days.

The qRT-PCR process

The miRNAs from hBMSCs were extracted using a NucleoSpin® miRNA kit (Macherey Nagel, France), and the ImProm-II Reverse Transcription system (Promega, Madison, WI, USA) was used to reverse the RNA to cDNA. Subsequently, qPCR was performed using TransStart Eco Green qPCR SuperMix (TransGen Biotech, Beijing, China). For mRNA, an RNA isolation kit (Takara, Shiga, Japan) was used to extract total RNA, which was reverse transcribed to cDNA using PrimeScript™ RT Master Mix (Takara), and then amplified with PrimeScript™ RT Master Mix (Takara) on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). MiR-18a-3p, ALP, RUNX2, OPN, OCN, and GRIA1 expression levels were quantified using the 2−∆∆Ct method [16] and normalized to U6 or GAPDH. The sequences of the primers used in this study are listed in Table 2.
Table 2.

Sequence of the primers used in this study

Gene nameSequence (5ʹ-3ʹ)
miR-18a-3p①Forward:CGACTACTGCCCTAAGTGCTC
 Reverse:GTGCAGGGTCCGAGGTATTC
U6①Forward:CTC GCTTCGGCAGCACA
 Reverse:AACGCTTCA CGAATTTGCGT
GRIA1②Forward:GCCAATGTAAAAAGGAATA
 Reverse:AACAGAAACGGTAAGTCATC
GAPDH③Forward:TGTTCGTCATGGGTGTGAAC
 Reverse:GTCTTCTGGGTGGCAGTGAT
ALP③Forward:TGCAGTACGAGCTGAACAGG
 Reverse:GTCAATTCTGCCTCCTTCCA
RUNX2④Forward:GCCTTCAAGGTGGTAGCCC
 Reverse:AAGGTGAAACTCTTGCCTCGTC
OCN③Forward:GGCAGCGAGGTAGTGAAGA
 Reverse:TCAGCCAACTCGTCACAGTC
OPN③Forward:TCAGCTGGATGACCAGAGTG
 Reverse:TTGGGGTCTACAACCAGCAT
Sequence of the primers used in this study

Cell transfection

The overexpression vector pcDNA3.1/GRIA1 (OE-GRIA1) was constructed using the vector pcDNA3.1 (K480001) (Invitrogen). The miR-18a-3p miRNA (mimic), miR-18a-3p miRNA inhibitor (inhibitor), and negative control (NC) were purchased from Ribobio (Guangzhou, China). The miR-18a-3p mimic/inhibitor, OE-GRIA1, and their NCs were immediately transfected into hBMSCs using Lipofectamine 2000 reagent after the cells had grown to 80% confluence. After transfection for 48 h, the cells were analyzed.

CCK-8 assay

Human bone marrow mesenchymal stem cell proliferation was detected by a CCK-8 assay (Beyotime, Shanghai, China) as previously described [17]. The hBMSCs were cultured in a 96-well plate at a density of 1 × 105 cells/mL. After 24, 48, and 72 h of incubation, 10% CCK-8 reagent was added and the cells were cultured at 37°C with 5% CO2 for 4 h. The hBMSC cell suspension was transferred into a 96-well plate and the absorbance of the medium was measured at 450 nm using a microplate reader (Bio-Tek Instruments, Winooski, VT, USA).

Alkaline phosphatase (ALP) activity

Osteogenic differentiation of hBMSCs was evaluated using ALP as described previously [18]. The hBMSCs (1 × 104) were seeded into a 6-well plate, and the ALP activity of the supernatant was detected using an ALP assay kit (Beyotime) according to the manufacturer’s instructions. The cells were washed with PBS and incubated with RIPA buffer solution at 37°C for 10 min. The ALP activity was then detected and analyzed.

Alizarin red staining (ARS)

Mineral deposition was assessed using ARS as described previously [19]. The hBMSCs were seeded in 24-well plates at 1 × 104 cells per well, incubated for 24 h, and then the medium was changed. Cells in each group were fixed at room temperature with 4% paraformaldehyde for 15 min, washed with deionized water, and stained with 2% alizarin red solution for 20 min. Cells with excess staining were then washed with PBS and observed under a light microscope (Leica Microsystems GmbH, Wetzlar, Germany).

Assay for osteocalcin (OCN)

After hBMSCs were induced for the indicated time, a human OCN ELISA kit (Millipore, Billerica, MA, USA) was used to determine the OCN concentration as previously described [20]. Briefly, 100 µL of a solution that contained 15,000 cells was seeded into a 96-well plate and incubated overnight. The next day, the cell culture medium was discarded and 200 µL of 1 × wash buffer A was added to each well. A total of 100 μL of fixing solution and 200 μL of 1 × quenching buffer were added to each well and then the plate was incubated for 20 min. After washing, the 1 × detection antibody was added to each well and then the plate incubated for 2 h at room temperature. Two hours later, 50  µL of 1 × HRP-conjugated secondary antibody was added and the plate was incubated for another 1 h. The plate was read at 450 nm using a plate reader after incubation with 100  µL of stop solution.

Dual‐luciferase reporter assay

The binding sites between miR-18a-3p and GRIA1 were predicted using the TargetScan database. Then, wild-type GRIA1 sequences containing miR-18a-3p binding sites and GRIA1 sequences that had been mutated at the miR-18a-3p binding sites were synthesized. Wild-type or mutant GRIA1 sequences were inserted into pGL3 control vectors (E1741, Promega) to construct GRIA1-WT, GRIA1-MUT-1, GRIA1-MUT-2, and GRIA1-MUT luciferase reporter vectors. Then, hBMSCs were placed in 96-well plates and cultured at 37°C for 16 h, and the luciferase reporter vectors were co-transfected with the miR-18a-3p mimic or NC mimic into the hBMSCs. Finally, the firefly and renilla luciferase activity was measured using a dual-luciferase reporter system (Promega) as previously described [21].

RNA-pull down assay

The RNA pull-down assay was performed using a specific biotin-labeled miR-18a-3p probe obtained from Sangon Biotech (Shanghai, China), as previously described [22]. Then, hBMSCs were transfected with bio-miR-18a-3p and Bio-N and incubated for 48 h. After incubation, RIP lysis buffer was used. Dynabeads M-280 Streptavidin was added to the resulting lysate and the mix was incubated overnight at 4°C. Finally, GRIA1 enrichment was detected using qRT-PCR.

Western blot

First, hBMSCs were lysed with RIPA buffer (Beyotime), and then the protein levels in each sample were measured using a BCA kit (Tiangen Biotechnology, Beijing, China). Equivalent amounts of protein were separated by 10% SDS-PAGE and transferred to a polyvinylidene fluoride membrane (Millipore) for Western blot assay. The membrane was then sealed for 1 h with 5% skimmed milk and washed with TBST. The PVDF membrane was incubated with the primary antibody against GRIA1 (ab183797; 1:10,000; Abcam, Cambridge, UK), collagen I (ab34710; 1:10,000; Abcam), collagen II (ab34712; 1:10,000; Abcam), and GAPDH (ab8245; 1:10,000; Abcam) at 4°C overnight. Then, the membrane was incubated at 25°C for 1 h with horseradish peroxidase (HRP) secondary antibody (ab6747; 1:4,000; Abcam). Protein expression was visualized using an ECL kit (Beyotime) as described previously [23], and band intensities were quantified using Image J software (NIH, Bethesda, MD, USA).

Statistical analysis

Data are expressed as mean ± SD deviation. The statistical analysis was conducted using SPSS software (version 20.0; SPSS, Chicago, IL, USA) as previously described [24]. Unpaired Student’s t-tests were used to compare the differences between two groups and a one-way ANOVA followed by Tukey’s post hoc test were used to compare the differences among multiple groups. Pearson’s correlation was used to analyze the correlation between miR-18a-3p and GRIA1 in tissues. The statistical significance was set at P < 0.05 and all experiments were performed three times.

Results

In the present study, we aimed to determine the function of miR-18a-3p in OP and its underlying mechanism by investigating the key genes involved in the process. The results of a bioinformatics analysis and cell function experiments showed that miR-18a-3p targeting GRIA1 could promote OP by suppressing osteogenic differentiation of hBMSCs. Our data suggest that the miR-18a-3p/GRIA1 axis may be a therapeutic strategy for OP.

MiR-18a-3p is associated with OP

MiR-18a-3p expression was detected by qRT-PCR so that the effect of miR-18a-3p on osteoporotic vertebral fractures could be measured. The results showed that miR-18a-3p expression was 2.1 times higher in OP-no-Frt than in the control, while miR-18a-3p expression was three times higher in OP-Frt (Figure 1(a)). It has been suggested that miR-18a-3p may be associated with osteoporotic spine fractures because it is ectopically overexpressed. In addition, we measured the changes in miR-18a-3p expression in hBMSCs during osteogenic differentiation. The results revealed that miR-18a-3p expression decreased with induction time. (Figure 1(b)). We also found that ALP activity and ALP mRNA expression increased during osteogenic differentiation induction (Figure 1(c,D)). Furthermore, ARS showed that calcium deposition increased after the induction of osteogenic differentiation (Figure 1(e)). Therefore, we identified several osteogenic markers. The qRT-PCR results revealed that the RUNX2, OCN, and OPN expression levels increased (Figure 1(f–h)). The OCN concentration also increased with induction time (Figure 1(i)). In addition, we tested collagen expression. The Western blot analysis showed that the collagen I and collagen II expression levels increased in hBMSCs after induction, indicating that miR-18a-3p is associated with OP and osteogenic differentiation.
Figure 1.

MiR-18a-3p is associated with OP and osteogenic differentiation (a) miR-18a-3p expression level in OP-no-Frt and OP-Frt was determined through qRT-PCR. **P < 0.001. (b) miR-18a-3p expression level in hBMSCs osteogenesis was detected via qRT-PCR. (c) ALP activity of cells described in hBMSCs osteogenesis. (d) Osteogenesis related genes ALP was detected in hBMSCs osteogenesis by qRT-PCR. (e) ARS was applied to quantify the bone mineralization ability of hBMSCs. (f-h) Osteogenesis related genes RUNX2 (f), OCN (g) and OPN (h) were detected in hBMSCs osteogenesis by qRT-PCR. (i). ELISA analysis of OCN expression in culture medium at different time. (j) Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis.*P < 0.05 vs. 0 day; **P < 0.001 vs. 0 day.

MiR-18a-3p is associated with OP and osteogenic differentiation (a) miR-18a-3p expression level in OP-no-Frt and OP-Frt was determined through qRT-PCR. **P < 0.001. (b) miR-18a-3p expression level in hBMSCs osteogenesis was detected via qRT-PCR. (c) ALP activity of cells described in hBMSCs osteogenesis. (d) Osteogenesis related genes ALP was detected in hBMSCs osteogenesis by qRT-PCR. (e) ARS was applied to quantify the bone mineralization ability of hBMSCs. (f-h) Osteogenesis related genes RUNX2 (f), OCN (g) and OPN (h) were detected in hBMSCs osteogenesis by qRT-PCR. (i). ELISA analysis of OCN expression in culture medium at different time. (j) Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis.*P < 0.05 vs. 0 day; **P < 0.001 vs. 0 day.

MiR-18a-3p regulates osteogenic differentiation

The miR-18a-3p mimic and inhibitor were transfected into cells to further understand the effect of miR-18a-3p on hBMSC osteogenic differentiation. The qRT-PCR results revealed that miR-18a-3p expression was reduced to 20% in the NC group after transfection with the inhibitor and that the miR-18a-3p level increased to six times that of the NC group after miR-18a-3p mimic transfection (Figure 2(a)). Then, the effect of the differential expression of miR-18a-3p on hBMSCs was examined. The CCK-8 assay showed that cell viability increased with culture time and further increased after miR-18a-3p knockdown, while miR-18a-3p overexpression reduced cell viability (Figure 2(b)). In addition, the ALP activity assay showed that activity increased approximately 2-fold after miR-18a-3p inhibitor transfection, but decreased by about 50% after transfection with the miR-18a-3p mimic (Figure 2(c)). Similarly, ALP mRNA expression increased after miR-18a-3p was downregulated and decreased after miR-18a-3p was overexpressed (Figure 2(d)). We also examined the effect of miR-18a-3p on calcium deposition. The ARS results revealed that the staining area and calcium deposition increased in the miR-18a-3p inhibitor group compared to the control group, whereas calcium deposition decreased in the miR-18a-3p mimic group (Figure 2(e)). We also analyzed the changes in RUNX2, OCN, and OPN expression levels. The qRT-PCR showed that the mRNA expressions associated with OPN, OCN, and RUNX2 increased by approximately 2.8, 3.1, and 1.9 times, respectively, after miR-18a-3p was inhibited, and that mRNA expression associated with RUNX2, OCN, and OPN decreased to 30%, 20%, and 40%, respectively, after miR-18a-3p was upregulated (Figure 2(f–h)). The ELISA assay for OCN in conditioned medium increased when miR-18a-3p was silenced, whereas miR-18a-3p overexpression resulted in a lower OCN concentration (Figure 2(i)). Similarly, the expressions of collagen I and collagen II were elevated in hBMSCs with the miR-18a-3p, inhibitor, but their levels decreased in hBMSCs transfected with miR-18a-3p mimic (Figure 2(j)). Taken together, the results show that miR-18a-3p silencing increased osteogenic differentiation, whereas miR-18a-3p overexpression reduced osteogenic differentiation.
Figure 2.

The low expression of miR-18a-3p promotes osteogenic differentiation, while overexpression of miR-18a-3p inhibits osteogenic differentiation. (a) miR-18a-3p level was determined by qRT-PCR in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (b) Cell viability of hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic was measured by CCK-8 assay. (c) ALP activity of cells described in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (d) Osteogenesis related genes ALP was detected in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic by qRT-PCR. (e) ARS was applied to quantify the bone mineralization ability of hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (f-h) Osteogenesis related genes RUNX2 (f), OCN (g) and OPN (h) were detected in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic by qRT-PCR. (i) ELISA analysis of OCN expression in culture medium of different groups. (j). Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis in different groups. *P < 0.05, **P < 0.001 vs. blank.

The low expression of miR-18a-3p promotes osteogenic differentiation, while overexpression of miR-18a-3p inhibits osteogenic differentiation. (a) miR-18a-3p level was determined by qRT-PCR in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (b) Cell viability of hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic was measured by CCK-8 assay. (c) ALP activity of cells described in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (d) Osteogenesis related genes ALP was detected in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic by qRT-PCR. (e) ARS was applied to quantify the bone mineralization ability of hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. (f-h) Osteogenesis related genes RUNX2 (f), OCN (g) and OPN (h) were detected in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic by qRT-PCR. (i) ELISA analysis of OCN expression in culture medium of different groups. (j). Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis in different groups. *P < 0.05, **P < 0.001 vs. blank.

GRIA1 is the target of miR-18a-3p

The results showed that miR-18a-3p inhibits osteogenic differentiation and is overexpressed in OP and vertebral fractures. Therefore, we attempted to clarify its mechanism. Using TargetScan, we found two binding sites for miR-18a-3p and GRIA1 (Figure 3(a)). GRIA1 had either mutated at both miR-18a-3p binding sites (GRIA1-MUT) or it had mutated at a single binding site (GRIA1-MUT-1, GRIA1-MU1-2). The luciferase activity of GRIA1-MUT did not significantly change after co-transfection with the miR-18a-3p mimic. However, the luciferase activities of GRIA1-MUT-1 and GRIA1-MU1-2 decreased to a certain extent, and the GRIA1-WT luciferase activity decreased the most (Figure 3(b)). Furthermore, the RNA pull-down assay showed that GRIA1 was enriched in miR-18a-3p (Figure 3(c)). This suggested that GRIA1 combined with miR-18a-3p and that miR-18a-3p targets GRIA1. We then elucidated the differential expressions of GRIA1 in OP. The qRT-PCR results showed that GRIA1 was expressed at low levels in both OP-Frt and OP-no-Frt, but was lower in OP-Frt (Figure 3(d)). The Pearson’s analysis revealed a negative correlation between miR-18a-3p and GRIA1 in OP-Frt and OP-no-Frt (Figure 3(e–f)). In addition, we examined the changes in GRIA1 during osteogenic differentiation and the results showed that GRIA1 mRNA and protein expression rose as the differentiation time increased (Figure 3(g–h)). This result is contrary to the trend for miR-18a-3p. Therefore, we hypothesized that miR-18a-3p negatively regulates GRIA1 during osteogenic differentiation. To confirm this hypothesis, we examined changes to the GRIA1 content in hBMSCs after miR-18a-3p regulation. The qRT-PCR and Western blot results revealed that the GRIA1 level increased when miR-18a-3p expression was low and decreased when miR-18a-3p expression was high (Figure 3(i–j)). This indicated that miR-18a-3p targeted the inhibition of GRIA1.
Figure 3.

GRIA1 is a target mRNA of miR-18a-3p. (a) Schematic picture of miR-18a-3p and GRIA1 3ʹ-UTR. (b) Luciferase activity were detected in hBMSCs containing WT or mutated GRIA1 3ʹ-UTR and transfected with miR-18a-3p mimic or mimic NC. **P < 0.001 vs. miR-NC. (c) RNA pull-down was used to validate the enrichment of GRIA1 in miR-18a-3p. **P < 0.001 vs. Bio-NC. (d) GRIA1 expression level in OP-no-Frt and OP-Frt was determined through qRT-PCR. **P < 0.001. (e) The correlation of miR-18a-3p and GRIA1 in OP-no-Frt was analysis by Pearson. (f) The correlation of miR-18a-3p and GRIA1 in OP-Frt was analysis by Pearson. (g) GRIA1 expression level in hBMSCs osteogenesis was detected via qRT-PCR. **P < 0.001 vs. 0 day. (h) GRIA1 expression level in hBMSCs osteogenesis was detected via Western blot. *P < 0.05, **P < 0.001 vs. 0 day. (i) GRIA1 expression level was determined by qRT-PCR in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. *P < 0.05, **P < 0.001 vs. blank. (j) GRIA1 expression level was determined by Western blot in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic as indicated. *P < 0.05, **P < 0.001 vs. blank.

GRIA1 is a target mRNA of miR-18a-3p. (a) Schematic picture of miR-18a-3p and GRIA1 3ʹ-UTR. (b) Luciferase activity were detected in hBMSCs containing WT or mutated GRIA1 3ʹ-UTR and transfected with miR-18a-3p mimic or mimic NC. **P < 0.001 vs. miR-NC. (c) RNA pull-down was used to validate the enrichment of GRIA1 in miR-18a-3p. **P < 0.001 vs. Bio-NC. (d) GRIA1 expression level in OP-no-Frt and OP-Frt was determined through qRT-PCR. **P < 0.001. (e) The correlation of miR-18a-3p and GRIA1 in OP-no-Frt was analysis by Pearson. (f) The correlation of miR-18a-3p and GRIA1 in OP-Frt was analysis by Pearson. (g) GRIA1 expression level in hBMSCs osteogenesis was detected via qRT-PCR. **P < 0.001 vs. 0 day. (h) GRIA1 expression level in hBMSCs osteogenesis was detected via Western blot. *P < 0.05, **P < 0.001 vs. 0 day. (i) GRIA1 expression level was determined by qRT-PCR in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic. *P < 0.05, **P < 0.001 vs. blank. (j) GRIA1 expression level was determined by Western blot in hBMSCs transfected with NC, miR-18a-3p inhibitor and miR-18a-3p mimic as indicated. *P < 0.05, **P < 0.001 vs. blank.

MiR-18a-3p regulates osteogenic differentiation by suppressing GRIA1 expression

OE-GRIA1 and the miR-18a-3p mimic were transfected into hBMSCs to investigate whether miR-18a-3p regulates hBMSC osteogenic differentiation via GRIA1. We observed that GRIA1 expression levels increased after OE-GRIA1 transfection and that the miR-18a-3p mimic decreased GRIA1 expression (Figure 4(a,b)). We also found that overexpression of GRIA1 increased cellular viability and that the miR-18a-3p mimic reversed the OE-GRIA1-mediated increase in cellular viability (Figure 4(c)). In addition, the ALP activity and mRNA expression level analyses showed that ALP content increased after GRIA1 was upregulated compared to the control group, whereas ALP content decreased after miR-18a-3p mimic transfection compared to the mimic + OE group (Figure 4(d,e)). The ARS assay showed that transfection with OE-GRIA1 promoted calcium deposition, while transfection with the miR-18a-3p mimic partially reversed the influence of OE-GRIA1 on calcium deposition (Figure 4(f)). Furthermore, the qRT-PCR results indicated that OE-GRIA1 promoted the expression of RUNX2, OCN, and OPN, whereas the miR-18a-3p mimic restored OPN, OCN, and RUNX2 expression (Figure 4(g–i)). The OE-GRIA1 vectors enhanced the OCN concentration in the medium with hBMSCs, but this effect was abolished by the miR-18a-3p mimic (Figure 4(j)). Likewise, the increased expression of collagen I and II protein was a result of GRIA1 overexpression, but this effect was reversed after transfection with the miR-18a-3p mimic and OE-GRIA1 vectors (Figure 4(k)). These results show that miR-18a-3p controls hBMSC osteogenic differentiation through GRIA1.
Figure 4.

miR-18a-3p controls osteogenic differentiation through GRIA1. (a) GRIA1 expression level was determined by qRT-PCR in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (b) GRIA1 expression level was determined by Western blot in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (c) Cell viability of hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 was measured by CCK-8 assay. (d) ALP activity of cells described in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (e) Osteogenesis related genes ALP was detected in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 by qRT-PCR. (f) ARS was applied to quantify the bone mineralization ability of hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (g-i) Osteogenesis related genes RUNX2 (g), OCN (h) and OPN (i) were detected in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 by qRT-PCR. (j). the osteogenic marker OCN was detected by ELISA. (k). Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis in different groups. *P < 0.05, **P < 0.001 vs. blank.##P < 0.05, ##P < 0.001 vs. mimic + OE.

miR-18a-3p controls osteogenic differentiation through GRIA1. (a) GRIA1 expression level was determined by qRT-PCR in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (b) GRIA1 expression level was determined by Western blot in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (c) Cell viability of hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 was measured by CCK-8 assay. (d) ALP activity of cells described in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (e) Osteogenesis related genes ALP was detected in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 by qRT-PCR. (f) ARS was applied to quantify the bone mineralization ability of hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1. (g-i) Osteogenesis related genes RUNX2 (g), OCN (h) and OPN (i) were detected in hBMSCs transfected with miR-18a-3p mimic or OE-GRIA1 by qRT-PCR. (j). the osteogenic marker OCN was detected by ELISA. (k). Western blotting analysis demonstrating Collagen I and II expression in hBMSCs osteogenesis in different groups. *P < 0.05, **P < 0.001 vs. blank.##P < 0.05, ##P < 0.001 vs. mimic + OE.

Discussion

Osteoporosis is caused by decreased bone density and by destruction of the bone microstructure and may trigger brittle fracture [25,26]. Bone homeostasis requires a strict balance between osteoblast formation and resorption [27]. The osteogenic differentiation of hBMSCs is one of the determinants of this balance. Nevertheless, the mechanism underlying hBMSC osteogenic differentiation remains unclear. In this study, we found that miR-18a-3p was robustly expressed in OP tissues and downregulated during osteogenic differentiation of hBMSCs. Overexpression of exogenous miR-18a-3p suppressed calcium deposition and ALP activity and reduced osteoblast marker protein expression (OSX, ALP, OCN, collagen I, collagen II, and RUNX2), which suggests that that osteogenic de-differentiation had occurred. In contrast, osteogenic differentiation was detected in hBMSCs transfected with the miR-18a-3p inhibitor. GRIA1 is a proven target of miR-18a-3p and its overexpression partially antagonized miR-18a-3p overexpression in induced hBMSCs. Our findings provide further evidence that miR-18a-3p is involved in hBMSC differentiation and the GRIA1 mediated progression of OP. Previous reports have verified that miR-18a-3p plays a significant role in bone formation and the pathological processes involved in OP [28]. A recent investigation into OP showed that miR-18a-3p was highly expressed in OP tissues, especially in tissues from OP patients with vertebral compression fractures [15]. Consistently, we also found enhanced miR-18a-3p levels in the bone tissue of patients with OP and OP vertebral fractures. We found that calcium deposition was intensified as the hBMSC induction time and the ALP, RUNX2, OCN, and OPN contents increased. In addition, this was accompanied by an increase in the level of miR-18a-3p, suggesting the involvement of miR-18a-3p during osteogenic differentiation of hBMSCs. Furthermore, after regulating the level of miR-18a-3p, we found that overexpression of miR-18a-3p downregulated osteogenic differentiation, while under-expression promoted osteogenic differentiation. Our findings are consistent with those of a previous investigation which revealed that miR-18a-3p is involved in the negative regulation of the osteogenic differentiation of hBMSCs [15]. Previous studies have shown that miRNAs are involved in the post-transcriptional regulation of gene expression during bone formation [29,30]. In this study, we found that the GRIA1 gene is the target gene of miR-18a-3p. Similar to other members of the AMPA receptor family, it has two isomers, consisting of 16 small exons, which are regulated by development [31]. Its overexpression regulates excessive Ca2+ influx into the cell, which significantly disrupts cellular ion homeostasis and influences cell proliferation and differentiation [32]. Its anti-apoptotic and pro-proliferative properties have been observed in human osteosarcoma in vitro [33]. However, its function in OP has not been previously reported. Our results showed that GRIA1 is weakly expressed in patients with OP and vertebral fractures. Furthermore, miR-18a-3p was negatively correlated with GRIA1, which reinforces the target relationship between them. Therefore, we attempted to elucidate the mechanism underlying the relationship between miR-18a-3p and GRIA1 during osteogenic differentiation. Our results showed that the osteogenic differentiation process was promoted by the upregulation of GRIA1 and that the upregulation of miR-18a-3p reverses the osteogenic differentiation induced by GRIA1. These results indicate that miR-18a-3p targets GRIA1 to control osteogenic differentiation. Although dysregulated miRNAs have been shown to be related to OP, the origin of these disorders is unclear. It has been reported that with age, many molecules are released from senescent cells and transported in the blood or other cells [34]. In future studies, we will focus on elucidating the origin of miR-18a-3p in OP. In addition, we also need to establish OP animal models to verify the therapeutic effect of miR-18a-3p and GRIA1 on OP.

Conclusions

In conclusion, this research revealed that miR-18a-3p was highly expressed during OP and in vertebral fractures associated with OP, while low expression was observed in induced hBMSCs. The results also showed that miR-18a-3p negatively inhibited the osteogenic differentiation of hBMSCs, thereby promoting OP by targeting GRIA1. Our findings suggest that the miR-18a-3p/GRIA1 axis has broad prospects in the treatment of OP.
  34 in total

Review 1.  Mesenchymal stem cells for bone repair: preclinical studies and potential orthopedic applications.

Authors:  Treena Livingston Arinzeh
Journal:  Foot Ankle Clin       Date:  2005-12       Impact factor: 1.653

2.  Ca2+-permeable AMPA receptors regulate growth of human glioblastoma via Akt activation.

Authors:  Shogo Ishiuchi; Yukari Yoshida; Kenichi Sugawara; Masanori Aihara; Toshiyuki Ohtani; Takashi Watanabe; Nobuhito Saito; Keisuke Tsuzuki; Haruo Okado; Akiko Miwa; Yoichi Nakazato; Seiji Ozawa
Journal:  J Neurosci       Date:  2007-07-25       Impact factor: 6.167

3.  Novel High-Selectivity Fluorescent Probe for Detecting Alkaline Phosphatase Activity in Marine Environment.

Authors:  Jingya Sun; Mei Liu; Peng Wang; Zhiwei Gao; Jun Mu; Qingguo Chen
Journal:  J Nanosci Nanotechnol       Date:  2020-06-01

4.  Involvement of microRNA-23b in TNF-α-reduced BMSC osteogenic differentiation via targeting runx2.

Authors:  Lin Deng; Guoli Hu; Lei Jin; Chenglong Wang; Hongwen Niu
Journal:  J Bone Miner Metab       Date:  2017-12-12       Impact factor: 2.626

5.  By inhibiting ADCY5, miR-18a-3p promotes osteoporosis and possibly contributes to spinal fracture.

Authors:  Lei Wang; Junli Dong; Jun Ma; Qin Lu; Ben Shan; Tingting Han; Peng Xie; Xiaohua Zuo
Journal:  Biochem Biophys Res Commun       Date:  2021-03-05       Impact factor: 3.575

6.  Glutamate AMPA receptor subunit 1 gene (GRIA1) and DSM-IV-TR schizophrenia: a pilot case-control association study in an Italian sample.

Authors:  Chiara Magri; Rita Gardella; Stefano Davide Barlati; Damiano Podavini; Paraskevas Iatropoulos; Silvia Bonomi; Paolo Valsecchi; Emilio Sacchetti; Sergio Barlati
Journal:  Am J Med Genet B Neuropsychiatr Genet       Date:  2006-04-05       Impact factor: 3.568

Review 7.  Osteoporosis.

Authors:  Kristine E Ensrud; Carolyn J Crandall
Journal:  Ann Intern Med       Date:  2017-08-01       Impact factor: 25.391

8.  Assessment of an ELISA kit for platelet-derived microparticles by joint research at many institutes in Japan.

Authors:  Shosaku Nomura; Akira Shouzu; Katsushi Taomoto; Yuko Togane; Shinya Goto; Yukio Ozaki; Shinichiro Uchiyama; Yasuo Ikeda
Journal:  J Atheroscler Thromb       Date:  2009-12-22       Impact factor: 4.928

9.  Long non-coding RNA XIST promotes osteoporosis by inhibiting the differentiation of bone marrow mesenchymal stem cell by sponging miR-29b-3p that suppresses nicotinamide N-methyltransferase.

Authors:  Jiang Yu; Min Xiao; Guohai Ren
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

10.  Inhibition of Circulating miR-194-5p Reverses Osteoporosis through Wnt5a/β-Catenin-Dependent Induction of Osteogenic Differentiation.

Authors:  Bobin Mi; Chenchen Yan; Hang Xue; Lang Chen; Adriana C Panayi; Liangcong Hu; Yiqiang Hu; Faqi Cao; Yun Sun; Wu Zhou; Yuan Xiong; Guohui Liu
Journal:  Mol Ther Nucleic Acids       Date:  2020-07-23       Impact factor: 8.886

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.