Literature DB >> 34937497

E2F transcription factor 1/small nucleolar RNA host gene 18/microRNA-338-5p/forkhead box D1: an important regulatory axis in glioma progression.

Quanfeng Ma1, Tianhao Yang2.   

Abstract

This study aims to probe the biological functions of long non-coding RNA small nucleolar RNA host gene 18 (SNHG18) on glioma cells and its underlying mechanism. In this study, SNHG18 expression in glioma tissues was quantified employing GEPIA database; quantitative real-time PCR was adopted to examine the expressions of SNHG18, microRNA-338-5p (miR-338-5p) and forkhead box D1 (FOXD1) mRNA in glioma tissues and cell lines; cell proliferation, migration and invasion were detected utilizing cell counting kit-8, EdU and Transwell assays; Western blot was utilized to quantify the protein expressions of E-cadherin, N-cadherin, Vimentin and FOXD1; dual-luciferase reporter gene and RNA immunoprecipitation experiments were utilized to validate the targeting relationships between SNHG18 and miR-338-5p, as well as miR-338-5p and FOXD1 mRNA 3'UTR; dual-luciferase reporter gene and chromatin immunoprecipitation assays were utilized to verify the binding of E2F transcription factor 1 (E2F1) to the SNHG18 promoter region. It was revealed that, SNHG18 expression in glioma was up-regulated and associated with unfavorable prognosis of the patients; knockdown of SNHG18 repressed the malignant biological behaviors of glioma cells, enhanced E-cadherin expression and repressed N-cadherin and Vimentin expressions. MiR-338-5p was a target of SNHG18, and SNHG18 promoted the expression of FOXD1 by decoying miR-338-5p. Additionally, E2F1 could bind to the promoter of SNHG18 to elevate its expression. In conclusion, SNHG18 accelerates glioma progression via regulating the miR-338-5p/FOXD1 axis.

Entities:  

Keywords:  FOXD1; Glioma; SNHG18; epithelial-mesenchymal transformation; miR-338-5p; proliferation

Mesh:

Substances:

Year:  2022        PMID: 34937497      PMCID: PMC8805867          DOI: 10.1080/21655979.2021.2005990

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

Glioma is identified as the most common primary brain tumor [1]. World Health Organization (WHO) categorized glioma into four grades: grade I–IV, and grade IV glioma, also known as glioblastoma (GBM), is the most deadly [2]. Many pathological factors, genetic and epigenetic alterations included, trigger the pathogenesis of glioma [3]. At present, the treatment strategy of glioma mainly includes surgical resection and postoperative radiotherapy, and chemotherapy [4]. Due to the strong aggressiveness, high growth rate, and high risk of recurrence, the prognosis of GBM is extremely unfavorable, and the median overall survival time of GBM is only about 14.6 months [5]. Therefore, expounding on the molecular mechanism of glioma/GBM progression is crucial. Long non-coding RNAs (lncRNAs) function importantly in a wide range of malignancies including glioma [6-9]. LncRNAs can regulate mRNA expression by competing with miRNA for mRNAs binding sites, thus regulating tumor development [6-9]. Reportedly, LINC00963 overexpression accelerates the growth and enhances the invasion of glioma cells in vivo and in vitro [10]. LncRNA FEZF1-AS1 and lncRNA H19 are up-regulated in glioma tissues and are closely related to glioma progression [11]. These studies indicate that lncRNAs are potential predictor of prognosis and therapy targets for glioma patients. LncRNA small nucleolar RNA host gene 18 (SNHG18) expression is elevated in glioma, and it is linked to the enhanced radioresistance of glioma cells [12]. It is also reported that SNHG18 promotes the epithelial-mesenchymal transition, migration and invasion of glioma cells [13]. Nonetheless, the underlying mechanisms of SNHG18 in glioma pathogenesis are largely unclear. In this study, based on bioinformatics analysis, we hypothesized that SNHG18 could promote glioma progression via modulating microRNA-338-5p (miR-338-5p) and forkhead box D1 (FOXD1). A series of in vitro experiments were performed to validate this hypothesis. Additionally, we investigated the regulatory effects of E2F transcription factor 1 (E2F1) on SNHG18, to explain the mechanism of SNHG18 dysregulation in glioma.

Materials and methods

Sample collection

Authorized by the Research Ethics Committee of Tianjin Huanhu Hospital (Approval number: 2016A015), this study recruited 47 patients with glioma receiving no radiotherapy or chemotherapy prior to the surgery, with informed consent obtained. The collected glioma and corresponding paracancerous brain tissues were snap-frozen in liquid nitrogen and reserved at −80°C.

Cell culture and transfection [14]

Human glioma cell lines (U251, U87, LN229, LN308, and T98G cells) and human astrocytes (NHA cells) were available from China Center for Type Culture Collection (CCTCC, Wuhan, China). In Dulbecco’s modification of Eagle’s medium Dulbecco (DMEM, Thermo Fisher Scientific, Shanghai, China) supplemented with 10% FBS (Biochrom AG, Berlin, Germany), these cells were routinely cultured at 37°C with 5% CO2. LipofectamineTM 2000 (Invitrogen, Thermo Fisher Scientific, Inc., Carlsbad, CA, USA) was adopted to transfect empty vector (NC), FOXD1 overexpression plasmid (FOXD1), E2F1 overexpression plasmid (E2F1), small interfering RNA targeting SNHG18 (si-SNHG18#1 and si-SNHG18#2) and its control (si-NC), mimics control, miR-338-5p mimics, inhibitors control and miR-338-5p inhibitors (GenePharma, Shanghai, China) into U251 and T98G cells. Quantitative real-time PCR (qRT-PCR), at 24 h after the transfection, was employed to measure the transfection efficiency.

qRT-PCR [15]

TRIzol reagent (Vazyme, Nanjing, China) and a reverse transcription kit (Takara, Dalian, China) were adopted to conduct RNA extraction and cDNA synthesis. ABI 7900 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) and SYBR-Green Master Mix kit (Takara, Otsu, Japan) were adopted to conduct qRT-PCR, with U6 and GAPDH as an internal reference for miR-338-5p and for SNHG18 and FOXD1 mRNA, respectively. 2−ΔΔCT formula was adopted to quantify relative expressions of SNHG18, miR-338-5p and FOXD1. The primers are listed in Table 1.
Table 1.

Sequences used for qRT-PCR

SNHG18F: GGCAAACTCTGCTCATCTTCGR: CGTGCTCTGCTTCTGGTATCCT
miR-338-5pF: ATCCAGTGCGTGTCGTG
 R: TGCTAACAATATCCTGGTG
FOXD1F: TCTGAGTAACGCGTTATGCTT
E2F1R: CGGAATCGGACGCAAGTCTTF: CTTGGCCGGGGCCCCTGCGGR: TGTGGGCCGGGGCGCCTGCG
U6F: CTCGCTTCGCRCAGCACA
 R: AACGCTTCACGAATTTGCGT
GAPDHF: AGAAGGCTGGGGCTCATTTG
 R: AGGGGCCATCCACAGTCTTC
Sequences used for qRT-PCR

Cell counting kit-8 (CCK-8) assay [16]

U251 and T98G cells trypsinized with trypsin were inoculated in a 96-well plate, and, after 24 h, incubated with 10 μL of CCK-8 solution (Beyotime, Shanghai, China) for 1 h. The absorbance of the cells at 450 nm wavelength was measured on the 1st, 2nd, 3rd and 4th day, respectively.

5-Ethynyl-2ʹ-deoxyuridine (EdU) assay [16]

The cells transferred into 24-well plates were added with 200 μL of 5 μmol/L EdU solution (Beyotime, Shanghai, China), and after 2 h, washed with PBS and then fixed for 30 min with paraformaldehyde/glycine, followed by being incubated with Apollo® fluorescence staining solution (Beyotime, Shanghai, China) in the dark for 30 min, and then stained with DAPI reaction solution for 30 min. Finally, the percentage of EdU positive cells was calculated.

Transwell experiment [17]

In migration assay, Transwell chambers (8 μm pore size) (Corning Costar, Cambridge, MA, USA) were positioned in 24-well plates, with 100 μL of cell suspension (in serum-free medium, 1 × 105 cells/well) and 600 μL of medium containing 10% FBS dripped into the upper compartment and lower compartment, respectively. The next day, the cells in the upper chamber were wiped off with cotton swabs, and those attached to the below surface of the membrane were fixed with methanol for 30 min and then stained with 0.1% crystal violet for 20 min. The number of cells attached to the lower surface of the membrane was counted in five randomly selected visual fields. The membrane was coated with Matrigel (Corning, Beijing, China) in the invasion assay, and the other steps were the same with the migration assay.

Subcellular fractionation assay [18]

A Cytoplasmic and Nuclear RNA Purification Kit (Norgenbiotek Corporation, Thorold, ON, Canada) was utilized to conduct nucleus-cytoplasm separation of U251 and T98G cells, and SNHG18 expression was quantified employing qRT-PCR, with GAPDH and U6 working as the positive controls for cytoplasmic and nuclear RNA, respectively.

Western blot [19]

BCA protein assay kit (Beyotime, Haimen, China) was adopted to quantify the protein samples, which were extracted from the cells with RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China). The samples added with 5× loading buffer were denatured in boiling water, and then the protein samples were separated via SDS-PAGE and then transferred to polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA, USA). After being blocked with 5% skim milk, the membrane was incubated with primary antibody anti-FOXD1 (PA5-50,498, 1: 1000; Thermo Fisher Scientific, Shanghai, China) at 4°C overnight. To normalize protein bands, an anti-β-actin antibody (ab179467, 1:2000; Abcam, Cambridge, UK) was utilized to detect β-actin. After the rinse with tris buffered saline tween (TBST), the membrane was incubated with the secondary antibody (ab205718, 1: 2500, Abcam, Cambridge, UK) for 1 h at ambient temperature and rinsed with TBST again. After the proteins were reacted with an ECL chemiluminescent kit (Millipore, Billerica, MA, USA), the protein bands were developed. The image analysis software ImageJ was applied to perform grayscale analysis of the protein bands.

Dual-luciferase reporter gene experiment [20]

The promoter region sequence of the SNHG18 (wid type: GCGGGAAA; mutant type: CACCCGGA), SNHG18 sequence (wild type:5ʹ-CAGUACGGGCCUUUUAAUAAGAUAUUGUA-3ʹ; 5ʹ-CUCUUGGUUAAAUUUCUGGAUAUAUUGUC-3ʹ; 5ʹ-GCAACUCAAUUUGCUUAAACAAAAUUGUU-3ʹ. mutant type: 5ʹ-CAACGAGCACCUUUUAAUAAAGACCCAUA-3ʹ; 5ʹ-CUACCCCAUAAAUUUCUGGAUCACGGACC-3ʹ; 5ʹ-GCAGCAGCAUUUGCUUAAACAAACAACCA-3ʹ) and FOXD1 3ʹUTR sequence (wild type: 5ʹ-AUUCUUUACAAGGAGUAUUGUAA-3ʹ; 5ʹ-UUUACUGGCAAUUAUUAUUGUAC-3ʹ. mutant type: 5ʹ-AUUCUUUACAAGGAGGGCGCAAA-3ʹ; 5ʹ-UUUACUGGCAAUUAUGCGGACAC-3ʹ) were amplified by PCR and cloned into a pGL3-basic vector (Promega, Madison, WI, USA) to construct wild type (WT) and mutant type (MUT) luciferase reporter vectors (SNHG18-WT, SNHG18-MUT, FOXD1-WT, FOXD1-MUT, SNHG18 promoter-WT, SNHG18 promoter-MUT). The above vectors were transfected into U251 cells with miR-338-5p mimics or mimics NC, respectively. The ratios of firefly luciferase activity to Renilla luciferase activity were calculated after 12 h.

RNA immunoprecipitation (RIP) assay [21]

U251 and T98G cells were lysed in RIP lysis buffer. The cell extracts were co-immunoprecipitated employing anti-Argonaute2 (Ago2) antibody conjugated with magnetic beads or control IgG. Subsequently, proteinase K was adopted to incubate the samples to remove the protein in the immunoprecipitate. Co-precipitated RNA was then isolated with TRIzol reagent (Vazyme, Nanjing, China), and the enrichment of SNHG18 and miR-338-5p in the immunoprecipitate was detected employing qRT-PCR.

Bioinformatics analysis [22]

The correlation between SNHG18 and the overall survival time of glioma patients was analyzed with GEPIA database. LncBase Predicted v.2, TargetScan and PROMO databases were utilized to predict the binding sites between SNHG18 and miR-338-5p, miR-338-5p and FOXD1 mRNA 3ʹUTR, and E2F1 and SNHG18 promoter sequence, respectively. The correlation between E2F1 expression and SNHG18 expression was analyzed with StarBase database.

Chromatin immunoprecipitation (ChIP) assay [23]

The transfected U251 and T98G cells cultured for 36 h were fixed with 10% formalin, and the cell pellet was obtained after centrifugation. After that, the cells were suspended by PMSF-containing cell lysis buffer, and the nuclear precipitates were obtained by removing the supernatant. Lysates, after ultrasonic DNA shearing in an ice-water bath, were incubated with antibody against IgG (ab150077, 1:100, Abcam, Shanghai, China) or antibody against E2F1 (KH-95, Santa Cruz Biotechnology, Dallas, TX, USA) overnight at 4°C. Protein Agarose was adopted to precipitate DNA-protein complex DNA fragments, after cross-linking was reversed overnight at 65°C, were recovered following extraction and purification by phenol/chloroform. Lastly, qRT-PCR was performed to detect the binding of E2F1 to the SNHG18 promoter region with the SNHG18 specific primers.

Statistical analysis [24]

All of the experiments were performed in triplicate. SPSS 22.0 (SPSS Inc., Chicago, IL, USA) was employed to process the data expressed by ‘mean ± standard deviation’, and Graphpad Prism8.0 (GraphPad Software, Inc., La Jolla, CA, USA) software was adopted to draw the figures. The normality of the distribution was tested adopting Kolmogorov-Smirnov test or Shapiro-Wilk test. Students t-test and one-way ANOVA test were adopted to make the comparison between the two groups, or among 3 or more groups. Tukey’s test was employed to make the comparison between the 2 groups with the existence of a significant difference. A Chi-square test was employed to analyze the relationship between clinicopathological features of the patients and SNHG18 expression. Pearson correlation coefficients were used to examine the correlation between normally distributed variables. P < 0.05 signified statistical significance.

Results

We hypothesized that SNHG18 could facilitate the progression of glioma, and we demonstrated that SNHG18 could regulate the malignant biological behaviors of glioma cells and E2F1 bound to the SNHG18 promoter region to promote SNHG18 transcription. SNHG18 directly targeted the miR-338-5p/FOXD1 axis, and miR-338-5p inhibition weakened the inhibiting effects of SNHG18 knockdown on proliferation, migration and invasion of glioma cells.

SNHG18 is up-regulated in glioma and facilitates the growth of glioma cells

SNHG18 expression was quantified with the online TCGA-based tool GEPIA. The results showed that SNHG18 was highly expressed in GBM (Figure 1(a)). Subsequently, qRT-PCR data suggested that SNHG18 expression was up-regulated in glioma tissues (Figure 1(b)). Subsequently, we divided the 47 glioma patients into high and low SNHG18 expression groups. Moreover, chi-square test indicated that SNHG18 high expression was associated with an increase in glioma grade (Table 2).
Figure 1.

SNHG18 expression in glioma and its biological function in regulating cell proliferation.

Table 2.

Relationship between clinicopathological features and expression of SNHG18 in glioma

Pathological ParametersNumbers(n = 47)SNHG18 expressionHigh(n = 24) Low(n = 23)χ2p-Value
Sex   0.23550.6275
Female18108  
Male291415  
Age(years)   3.57670.0586
>4025169  
≤4022814  
Grade   6.59460.0102*
low grade(I+II)16412  
high grade(III+IV)312011  
Tumor size(cm)   0.01580.9001
≤4201010  
>4271413  

*P < 0.05

SNHG18 expression in glioma and its biological function in regulating cell proliferation. Relationship between clinicopathological features and expression of SNHG18 in glioma *P < 0.05 Moreover, survival analysis was performed with the GEPIA database, and the results authenticated that high SNHG18 was in association with a shorter overall survival time of glioma patients (Figure 1(c)). Additionally, SNHG18 expression in glioma cell lines was significantly higher than in human astrocyte NHA (Figure 1(d)). Next, we selected U251 and T98G cells with the highest relative expression of SNHG18 for follow-up experiments. U251 and T98G cells were transfected with si-NC, si-SNHG18#1, and si-SNHG18#2. After transfection, qRT-PCR validated the successful transfection (Figure 1(e)). CCK-8 experiment showed that the proliferation of U251 and T98G cells in the si-SNHG18 # 1 and si-SNHG18 # 2 groups were remarkably inhibited (Figure 1(f)). EdU experiment displayed that the proportion of EdU-positive cells in U251 and T98G cells in the si-SNHG18#1 and si-SNHG18#2 groups was remarkably lower (Figure 1(g)). These data implied that SNHG18 high expression was an indicator for the poor prognosis of glioma, and knockdown of SNHG18 could inhibit the proliferation of glioma cells.

The effects of SNHG18 on the migration and invasion of glioma cells in vitro

Transwell experiments showed that the migration and invasion of U251 and T98G cells in the si-SNHG18#1 and si-SNHG18#2 groups were observably reduced (Figure 2(a,b)). It is well known that E-cadherin, N-cadherin, and Vimentin are specific markers for the epithelial-mesenchymal transformation (EMT) process [25]. The expression of EMT markers in glioma cells was detected by Western blot and the results showed that both si-SNHG18#1 and si-SNHG18#2 enhanced the expression of E-cadherin and inhibited the expressions of N-cadherin and Vimentin (Figure 2(c)). These data further suggested that SNHG18 regulated the aggressiveness of glioma cells.
Figure 2.

Knockdown of SNHG18 inhibits the migration and invasion of glioma.

Knockdown of SNHG18 inhibits the migration and invasion of glioma.

SNHG18 sponges and downregulates miR-338-5p in glioma cells

Next, it was revealed that SNHG18 was enriched in the cytoplasm, not in the nucleus, suggesting its potential as a competitive endogenous RNA (ceRNA) (Figure 3(a)). Bioinformatics analysis tool LncBase Predicted V2.0 showed that miR-338-5p could probably be a target miRNA of SNHG18, and qRT-PCR showed that miR-338-5p expression was decreased in glioma cell lines (Figure 3(b)). Then we transfected the U251 and T98G cells with miR-338-5p mimics, mimics NC, miR-338-5p inhibitors or inhibitors NC, and the successful transfection was verified employing qRT-PCR (Figure 3(c)). Then dual-luciferase activity reporter assays were performed. It was found that miR-338-5p mimics markedly repressed the luciferase activity of the SNHG18 WT group; however, miR-338-5p mimics did not have a remarkable effect on that of SNHG18 MUT group (Figure 3(d,e)). Moreover, RIP assay revealed that SNHG18 and miR-338-5p were enriched in the immunoprecipitate containing Ago2, suggesting a direct binding relationship between them (Figure 3(f)). Furthermore, both si-SNHG18#1 and si-SNHG18#2 could enhance miR-338-5p expression in glioma cells (Figure 3(g)). Subsequently, the results of qRT-PCR suggested that miR-338-5p was remarkably down-regulated compared with adjacent brain tissues (Figure 3(h)). Furthermore, Pearson’s correlation analysis showed that SNHG18 expression was in negative correlation with miR-338-5p expression in glioma samples (Figure 3(i)). These results substantiated that SNHG18 in glioma, functioning as a ceRNA, directly targeted miR-338-5p and repressed it.
Figure 3.

SNHG18 specifically regulates miR-338-5p expression.

SNHG18 specifically regulates miR-338-5p expression.

MiR-338-5p inhibitors can reverse the inhibitory effect of SNHG18 on glioma cell proliferation and invasion

To determine whether SNHG18 participates in glioma progression by adsorbing miR-338-5p, we co-transfected si-SNHG18#1+ miR-338-5p inhibitors into U251 and T98G cells, and qRT-PCR validated the successful transfection (Figure 4(a)). It was found that the transfection of si-SNHG18#1 could repress malignant biological behaviors of glioma cells but miR-338-5p inhibitors abolished these effects (Figure 4(b–d); Supplementary Figure 1). Western blot revealed that si-SNHG18#1 could increase E-cadherin protein expression while inhibiting N-cadherin and Vimentin protein expression; miR-338-5p inhibitors could reverse this effect (Figure 4(e)). These data suggested the biological function of SNHG18 was dependent on miR-338-5p.
Figure 4.

MiR-338-5p inhibitors can reverse the effects of SNHG18 knockdown on the proliferation, migration, and invasion of U251 and T98G cells.

MiR-338-5p inhibitors can reverse the effects of SNHG18 knockdown on the proliferation, migration, and invasion of U251 and T98G cells.

SNHG18 up-regulates FOXD1 expression by adsorbing miR-338-5p

TargetScan database suggested that the 3ʹ-UTR of FOXD1 had two binding sites for miR-338-5p (Figure 5(a,b)). It was revealed that miR-338-5p mimics markedly reduced the luciferase activity of the FOXD1 WT reporter; nevertheless, miR-338-5p mimics had no significant impact on that of the FOXD1 MUT reporter (Figure 5(c)). Western blot showed that the transfection of si-SNHG18#1 inhibited the expression of FOXD1 protein in glioma cells, and co-transfection of miR-338-5p inhibitors rescued it (Figure 5(d)). In addition, qRT-PCR showed that FOXD1 mRNA expression was up-regulated in glioma tissues (Figure 5(e)). Pearson’s correlation analysis manifested that FOXD1 mRNA expression was in negative correlation with miR-338-5p mimics in glioma samples (figure 5(f)); FOXD1 mRNA was positively correlated with SNHG18 expression (Figure 5(g)). These data implied that SNHG18 could facilitate glioma progression via regulating the miR-338-5p/FOXD1 axis.
Figure 5.

SNHG18 knockdown can inhibit FOXD1 expression.

SNHG18 knockdown can inhibit FOXD1 expression.

E2F1 contributes to the dysregulation of SNHG18 in gliomas

Next, we explored the mechanism of SNHG18 dysregulation in gliomas. The data of qRT-PCR showed that the transfections of the FOXD1 or E2F1 overexpression vector were successful (Supplementary Fig. 2A-B). It was revealed that, overexpression of FOXD1 had no significant effect on SNHG18 expression in U251 and T98G cells (Supplementary Fig. 2C). To confirm the responsible transcription factor on SNHG18, bioinformatics analysis was performed, and it was found that E2F1 could bind to the SNHG18 promoter region (Supplementary Fig. 2D). Moreover, the StarBase database indicated that E2F1 expression was in positive correlation with SNHG18 expression in glioma tissues (Supplementary Fig. 2E). Furthermore, E2F1 overexpression could markedly elevate the luciferase activity of the SNHG18 WT reporter (Supplementary Fig. 2F). In ChIP assay, E2F1-bound complex was found to show a remarkable enrichment of the SNHG18 promoter (Supplementary Fig. 2G). Besides, E2F1 overexpression promoted SNHG18 expression in both U251 and T98G cells (Supplementary Fig. 2H). These data indicated that E2F1, as an oncogenic transcription factor, promoted the expression of SNHG18 in glioma.

Discussion

LncRNAs widely partake in the regulation of gene expression, thus playing an essential regulatory role in the malignant biological behaviors of tumor cells [26]. In glioma progression, lncRNA is also an important regulator. Reportedly, LINC00511 expression in glioma is up-regulated and associated with poor prognosis, and LINC00511 promotes tumor growth by modulating the miR-524-5p/YB1 molecular axis [27]. BCAR4 overexpression can promote tumor growth by modulating miR-2276/MMP7 axis [28]. Reportedly, SNHG18 is highly expressed in multiple myeloma (MM), which is closely related to Mayo Clinic Risk Stratification for MM and the short overall survival time [29]. Conversely, in liver cancer, SNHG18 is considered to be a tumor suppressor [30]. In glioma, it is reported that SNHG18 inhibits the nucleocytoplasmic transport of α-enolase, thus promoting glioma cell migration [13]. Another study reports that SNHG18 is overexpressed in glioma, and overexpression of SNHG18 reduces the radiosensitivity of glioma cells via inhibiting semaphorin 5A [12]. In this work, consistently, it was found that SNHG18 expression was elevated in glioma tissues and associated with poor prognosis of GBM patients. Additionally, knocking down SNHG18 repressed the malignant phenotypes of glioma cells. These results suggested that SNHG1 could promote glioma progression. MiRNA participates in the regulation of tumorigenesis and cancer development by inhibiting the translation of target mRNA [31,32]. Reportedly, miR-338-5p expression is decreased in many cancers, including glioma, and participates in inhibiting tumor growth and metastasis [33]. Nonetheless, in colorectal cancer, miR-338-5p expression is up-regulated, related to increased tumor stage, metastasis, and short survival time of the patients [34]. In glioma tissues, reportedly, miR-338-5p impedes tumor cell proliferation and invasion by targeting CTBP2 [35]. In this work, we substantiated that miR-338-5p was a target of SNHG18; SNHG18 facilitated malignant biological behaviors of glioma cells via adsorbing miR-338-5p. Importantly, the expressions of SNHG18 and miR-338-5p were negatively correlated in glioma cells. Our data proved that the SNHG18 may promote glioma progression by absorbing miR-338-5p. FOXD1, a transcription factor also known as FKHL8 and FREAC-4, belongs to the forkhead box (FOX) family [36,37]. FOX family partakes in regulating many biological processes, embryonic development, cell cycle regulation, metabolic control, stem cell maintenance, and signal transduction included [36,37]. In prostate cancer, cervical cancer, and colorectal cancer, FOXD1 is markedly up-regulated and indicates a poor prognosis of the patients; functionally, FOXD1 can promote tumor growth and metastasis [38-41]. In colorectal cancer, the up-regulated expression of FOXD1 can promote tumor progression by activating the ERK1/2 pathway [41]. In glioma, FOXD1 expression is also up-regulated and its high expression indicates a poor prognosis; knocking down FOXD1 inhibits glioma cell proliferation and migration; FOXD1 down-regulates p27 expression to induce G1/S transition and facilitate cell cycle progression [42]. Another study reports that silencing FOXD1 represses MEK-2, ERK-1, Bcl-2, DAF, and PCNA expression levels and increases Bax expression, thus repressing glioma cells’ proliferation and metastasis [43]. FOXD1 has been reported to be a target gene of miR-338-5p [43]. We also demonstrated that SNHG18 could positively regulate FOXD1 via repressing miR-338-5p. Additionally, herein, we also provided an explanation of the mechanism of SNHG18 dysregulation in glioma. We observed that E2F1 could bind with the promoter of SNHG18 to promote its expression. E2F1 is significantly up-regulated in glioma tissues, and it is a crucial transcription factor involved in maintaining the malignancy of glioma cells, and it is considered as a promising therapy target [44-46]. Our data suggest that SNHG18/miR-338-5p/FOXD1 axis is a vital downstream mechanism by which E2F1 participates in regulating glioma progression.

Conclusion

In summary, this work demonstrates that knocking down SNHG18 suppresses the malignant phenotypes of glioma cells via modulating miR-338-5p and FOXD1. Mechanistically, it is revealed that E2F1 is a regulator for SNHG18/miR-338-5p/FOXD1 axis in glioma. Our work implies that SNHG18 has the potential to become a diagnostic marker and molecular therapy target for glioma. There are several limitations of this work. Firstly, whether SNHG18 regulates other miRNAs remains to be further studied; secondly, the value of SNHG18 as a prognostic biomarker needs to be validated by a large-sample and multi-center study in the future; thirdly, the conclusion of the present study is only based on in vitro experiments, and animal models are needed to further verify the results. Click here for additional data file.
  46 in total

1.  Activated protein C promotes breast cancer cell migration through interactions with EPCR and PAR-1.

Authors:  Lea M Beaulieu; Frank C Church
Journal:  Exp Cell Res       Date:  2006-12-14       Impact factor: 3.905

2.  FOXD1 predicts prognosis of colorectal cancer patients and promotes colorectal cancer progression via the ERK 1/2 pathway.

Authors:  Fengping Pan; Minjiang Li; Wenbin Chen
Journal:  Am J Transl Res       Date:  2018-05-15       Impact factor: 4.060

Review 3.  The multisystemic functions of FOXD1 in development and disease.

Authors:  Paula Quintero-Ronderos; Paul Laissue
Journal:  J Mol Med (Berl)       Date:  2018-06-29       Impact factor: 4.599

4.  Silencing of Forkhead box D1 inhibits proliferation and migration in glioma cells.

Authors:  Yuan-Feng Gao; Tao Zhu; Xiao-Yuan Mao; Chen-Xue Mao; Ling Li; Ji-Ye Yin; Hong-Hao Zhou; Zhao-Qian Liu
Journal:  Oncol Rep       Date:  2017-01-02       Impact factor: 3.906

5.  MicroRNA-338-5p plays a tumor suppressor role in glioma through inhibition of the MAPK-signaling pathway by binding to FOXD1.

Authors:  Xin-Long Ma; Feng Shang; Wei Ni; Jin Zhu; Bin Luo; Yu-Qi Zhang
Journal:  J Cancer Res Clin Oncol       Date:  2018-09-17       Impact factor: 4.553

6.  The lncRNA MALAT1 acts as a competing endogenous RNA to regulate KRAS expression by sponging miR-217 in pancreatic ductal adenocarcinoma.

Authors:  Pingping Liu; Haiyan Yang; Jing Zhang; Xiaozhong Peng; Zhaohui Lu; Weimin Tong; Jie Chen
Journal:  Sci Rep       Date:  2017-07-12       Impact factor: 4.379

Review 7.  LncRNA HOTAIR in Tumor Microenvironment: What Role?

Authors:  Gerardo Botti; Giosuè Scognamiglio; Gabriella Aquino; Giuseppina Liguori; Monica Cantile
Journal:  Int J Mol Sci       Date:  2019-05-08       Impact factor: 5.923

8.  CXXC finger protein 4 inhibits the CDK18-ERK1/2 axis to suppress the immune escape of gastric cancer cells with involvement of ELK1/MIR100HG pathway.

Authors:  Ping Li; Dongfang Ge; Pengfei Li; Fangyong Hu; Junfeng Chu; Xiaojun Chen; Wenbo Song; Ali Wang; Guangyu Tian; Xiang Gu
Journal:  J Cell Mol Med       Date:  2020-07-26       Impact factor: 5.310

9.  Long Noncoding Ribonucleic Acid SNHG18 Promotes Glioma Cell Motility via Disruption of α-Enolase Nucleocytoplasmic Transport.

Authors:  Rong Zheng; Qiwei Yao; XiaoBo Li; Benhua Xu
Journal:  Front Genet       Date:  2019-11-13       Impact factor: 4.599

10.  Identification of an epithelial-mesenchymal transition related long non-coding RNA (LncRNA) signature in Glioma.

Authors:  Chuming Tao; Haitao Luo; Luyue Chen; Jingying Li; Xingen Zhu; Kai Huang
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

View more
  1 in total

1.  Foxhead box D1 promotes the partial epithelial-to-mesenchymal transition of laryngeal squamous cell carcinoma cells via transcriptionally activating the expression of zinc finger protein 532.

Authors:  Liang Fan; Jinxiu Wang; Pingping Deng; Yuanyuan Wang; Aiping Zhang; Mengsheng Yang; Gang Zeng
Journal:  Bioengineered       Date:  2022-02       Impact factor: 3.269

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.